Search Results

Search found 16801 results on 673 pages for 'task manager'.

Page 588/673 | < Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >

  • C#: Need one of my classes to trigger an event in another class to update a text box

    - by Matt
    Total n00b to C# and events although I have been programming for a while. I have a class containing a text box. This class creates an instance of a communication manager class that is receiving frames from the Serial Port. I have this all working fine. Every time a frame is received and its data extracted, I want a method to run in my class with the text box in order to append this frame data to the text box. So, without posting all of my code I have my form class... public partial class Form1 : Form { CommManager comm; public Form1() { InitializeComponent(); comm = new CommManager(); } private void updateTextBox() { //get new values and update textbox } . . . and I have my CommManager class class CommManager { //here we manage the comms, recieve the data and parse the frame } SO... essentially, when I parse that frame, I need the updateTextBox method from the form class to run. I'm guessing this is possible with events but I can't seem to get it to work. I tried adding an event handler in the form class after creating the instance of CommManager as below... comm = new CommManager(); comm.framePopulated += new EventHandler(updateTextBox); ...but I must be doing this wrong as the compiler doesn't like it... Any ideas?!

    Read the article

  • What are salesforce.com and Apex like as an application development platform?

    - by mhollers
    I have recently discovered that salesforce.com is much more than an online CRM after coming across a Morrison's Case Study in which they develop a works management application. I've been trying it out with a view to recreating our own Works Management system on the platform. My background is in Microsoft and .Net, and the obvious 1st choice would be asp.net. However, there's only really myself with .net experience and my manager with a more legacy Synergy programming background, and I am self taught and am looking at evaluating other RAD options (eg Ironspeed). the nature of the business is in the main 2-5 concurrent construction type contracts that run for 3-5 yrs each, each requiring 15-50 system users. Traditionally we have used our character based Works Mangement system for everything and tweaked it for each contract. The Salesforce licensing model on the face of it suits this sort of flexibilty, but I'm worried about the development flexibilty/learning curve and all the issues that surround lock-in. There doesn't seem to be much neutral sober analysis of the platform on the web that isn't salesforce's own material/blogs Has anyone any experience of developing an application on salesforce as compared to the more 'traditional' .Net route?

    Read the article

  • Send Special Keys to Gtk.VteTerminal

    - by Ubersoldat
    Hi I have this OSS Project called Monocaffe connections manager which uses the Gtk.VteTerminal widget from PyGTK. A nice feature is that it allows the users to send commands to different servers' consoles (cluster mode) using a Gtk.TextView for the input. The way I send key strokes to each Gtk.VteTerminal is by using the feed_child method. For common keys there's no problem: I simply feed what the TextView receives to all the terminals, but when doing so with special keys I get into a little trouble. For "Return" I catch the event and feed the terminal a '\n'. For back-space is the same, catch the event and feed a '\b'. def cluster_backspace(self, widget): return self.cluster_send_key('\b') The problem comes with other keys like Tab, Arrows, Esc which I don't know how to feed as str to the terminal to recognize them. In the case of Esc is a real pain, because the users can edit the same file on different servers using vi, but cannot escape insert mode. Anyway, I'm not looking for a complete solution, just ideas since I've ran out of them. Thanks.

    Read the article

  • Android - Turn off display without triggering sleep/lock screen - Turn on with Touchscreen

    - by NebulaSleuth
    I have been trying to find a way to turn off the display, and wake up from the user touching the touch screen. The device is in an embedded environment where the device is a tablet and the user does not have access to anything except the touch screen (no buttons at all). It is connected to power so the battery won't be a problem, but when I detect no activity I want to turn off the screen so it isn't staring them in the face all day and doesn't reduce the life the LCD backlight. I maintain a wakelock permanently and decide when to sleep myself. The problem is that when I turn off the screen using : WindowManager.LayoutParams params = getWindow().getAttributes(); params.screenBrightness = 0; getWindow().setAttributes(params); The activity gets paused and stopped. And the unit does not respond to a touch to wake it up. You need to press the power button. At that point the "slide to unlock" shows up. I want to turn off the display, and then stay running so I can detect a touch screen event and turn the display back on. I also tried turning the display to a brightness of 0.1, which works on some devices, but the device I need it to work on, only "dims" the display. I also tried this: // First Remove my FULL wakelock //then aquire a partial wake lock (which should turn off the display) PowerManager.WakeLock wl = manager.newWakeLock(PowerManager.PARTIAL_WAKE_LOCK, "Your Tag"); wl.acquire(); however this method does not turn off the display.

    Read the article

  • How does PHP interface with Apache?

    - by Sbm007
    Hi, I've almost finished writing a HTTP/1.0 compliant web server under Java (no commercial usage as such, this is just for fun) and basically I want to include PHP support. I realize that this is no easy task at all, but I think it'll be a nice accomplishment. So I want to know how PHP exactly interfaces with the Apache web server (or any other web server really), so I can learn from it and write my own PHP wrapper. It doesn't necessarily have to be mod_php, I don't mind writing a FastCGI wrapper - which to my knowledge is capable of running PHP as well. I would've thought that all that PHP needs is the output that goes to client (so it can interpret the PHP parts), the full HTTP request from client (so it can extract POST variables and such) and the client's host name. And then you simply take the parsed PHP code and write that to the output stream. There will probably be more things, but in essence that's how I would have thought it works. From what I've gathered so far, apache2handler provides an API which PHP makes use of to 'connect' to Apache. I guess it's an idea to look at the source code for apache2handler and php5apache2.dll or so, but before I do that I thought I'd ask SO first. If anyone has more information, experience, or some sort of specification that is relevant to this then please let me know. Thanks in advance!

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • First Time Architecturing?

    - by cam
    I was recently given the task of rebuilding an existing RIA. The new RIA that I've designed is based on Silverlight, with a WCF service to connect to MS SQL Server. This is my first time doing something like this, so I'm not sure how to design the entire thing. Basically, the client can look through graphs of "stocks" (allowing the client to choose different time periods, settings, etc). I've written the whole application essentially, but I'm not sure how to put it together. The graphs are supposed to be directly based on the database, and to create the datapoints on the graph, some calculations need to be done (not very expensive ones). The problem I'm having is to decide where to put the calculations (client or serverside? Or half and half?) What factors should I look for to help me decide where the calculations should be done? And how can I go about optimizing this (caching, etc)? Obviously this is a very broad subject, so I'm not expecting an immediate answer, but any help/pointing in the right direction/resources would be appreciated.

    Read the article

  • do the Python libraries have a natural dependence on the global namespace?

    - by msw
    I first ran into this when trying to determine the relative performance of two generators: t = timeit.repeat('g.get()', setup='g = my_generator()') So I dug into the timeit module and found that the setup and statement are evaluated with their own private, initially empty namespaces so naturally the binding of g never becomes accessible to the g.get() statement. The obvious solution is to wrap them into a class, thus adding to the global namespace. I bumped into this again when attempting, in another project, to use the multiprocessing module to divide a task among workers. I even bundled everything nicely into a class but unfortunately the call pool.apply_async(runmc, arg) fails with a PicklingError because buried inside the work object that runmc instantiates is (effectively) an assignment: self.predicate = lambda x, y: x > y so the whole object can't be (understandably) pickled and whereas: def foo(x, y): return x > y pickle.dumps(foo) is fine, the sequence bar = lambda x, y: x > y yields True from callable(bar) and from type(bar), but it Can't pickle <function <lambda> at 0xb759b764>: it's not found as __main__.<lambda>. I've given only code fragments because I can easily fix these cases by merely pulling them out into module or object level defs. The bug here appears to be in my understanding of the semantics of namespace use in general. If the nature of the language requires that I create more def statements I'll happily do so; I fear that I'm missing an essential concept though. Why is there such a strong reliance on the global namespace? Or, what am I failing to understand? Namespaces are one honking great idea -- let's do more of those!

    Read the article

  • Driver denied access to PCI card

    - by Corin
    We wrote a Windows device driver to access our custom PCI card. The driver uses CreateFile to get a handle to the card. We recently had trouble at one installation were the card appeared to stop working. We tried replacing the card (the replacement appeared not work either). The computer vendor replaced the motherboard and both cards still failed to work. We put the cards in a different computer and both worked fine. We now have the computer at our office for examination. The Windows Device Manager lists our card in Other Devices as usual and says it's working fine. However, our driver initialization fails when it attempts to connect to the card. We created a test version of our driver with some extra debugging and determined that CreateFile is failing. It returns INVALID_HANDLE_VALUE as it is supposed to on failure. GetLastError indicates the error is Access is Denied. Since we're logged into the system as a local administrator, what can deny access to the device?

    Read the article

  • measure the response time of a link

    - by Ahoura Ghotbi
    I am trying to create a simple load balance script and I was wondering if it is possible to find the response time of a server live? By that I mean is it possible to measure how long it takes for a server to respond after the request has been sent out? What I am trying to do is fairly simple, I want to send a request to a link/server and do a count down, if the server took more than 5 seconds to reply, I would like to fall on the backup server. Note that it doesnt have to be in pure php, I wouldnt mind using other languages such as javascript, C/C++, asp, but I prefer to do it in PHP. if it is possible to do the task, could you just point me to the right direction so I can read up on it. Clarification What I want to do is not to download a file and see how long it took, my servers have high load and it takes a while for them to respond when you click on a file to download, what I want to do is to measure the time it takes the server to respond (in this situation, its the time it takes the server to respond and allow the user to download the file), and if it takes longer than x seconds, it should fall back on a backup server.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How can I manage building library projects that produce both a static lib and a dll?

    - by Scott Langham
    I've got a large visual studio solution with ~50 projects. There are configurations for StaticDebug, StaticRelease, Debug and Release. Some libraries are needed in both dll and static lib form. To get them, we rebuild the solution with a different configuration. The Configuration Manager window is used to setup which projects need to build in which flavours, static lib, dynamic dll or both. This can by quite tricky to manage and it's a bit annoying to have to build the solution multiple times and select the configurations in the right order. Static versions need building before non-static versions. I'm wondering, instead of this current scheme, might it be simpler to manage if, for the projects I needed to produce both a static lib and dynamc dll, I created two projects. Eg: CoreLib CoreDll I could either make both of these projects reference all the same files and build them twice, or I'm wondering, would it be possible to build CoreLib and then get CoreDll to link it to generate the dll? I guess my question is, do you have any advice on how to structure your projects in this kind of situation? Thanks.

    Read the article

  • Application process never terminates on each run

    - by rockyurock
    I am seeing an application always remains live even after closing the application using my Perl script below. Also, for the subsequent runs, it always says that "The process cannot access the file because it is being used by another process. iperf.exe -u -s -p 5001 successful. Output was:" So every time I have to change the file name $file used in script or I have to kill the iperf.exe process in the Task Manager. Could anybody please let me know the way to get rid of it? Here is the code I am using ... my @command_output; eval { my $file = "abc6.txt"; $command = "iperf.exe -u -s -p 5001"; alarm 10; system("$command > $file"); alarm 0; close $file; }; if ($@) { warn "$command timed out.\n"; } else { print "$command successful. Output was:\n", $file; } unlink $file;

    Read the article

  • How to understand existing projects

    - by John
    Hi. I am a trainee developer and have been writing .NET applications for about a year now. Most of the work I have done has involved building new applications (mainly web apps) from scratch and I have been given more or less full control over the software design. This has been a great experience however, as a trainee developer my confidence about whether the approaches I have taken are the best is minimal. Ideally I would love to collaborate with more experienced developers (I find this the best was I learn) however in the company I work for developers tend to work in isolation (a great shame for me). Recently I decided that a good way to learn more about how experienced developers approach their design might be to explore some open source projects. I found myself a little overwhelmed by the projects I looked at. With my level of experience it was hard to understand the body of code I faced. My question is slight fuzzy one. How do developers approach the task of understanding a new medium to large scale project. I found myself pouring over lots of code and struggling to see the wood for the trees. At any one time I felt that I could understand a small portion of the system but not see how its all fits together. Do others get this same feeling? If so what approaches do you take to understanding the project? Do you have any other advice about how to learn design best practices? Any advice will be very much appreciated. Thank you.

    Read the article

  • PHP Object Creation and Memory Usage

    - by JohnO
    A basic dummy class: class foo { var $bar = 0; function foo() {} function boo() {} } echo memory_get_usage(); echo "\n"; $foo = new foo(); echo memory_get_usage(); echo "\n"; unset($foo); echo memory_get_usage(); echo "\n"; $foo = null; echo memory_get_usage(); echo "\n"; Outputs: $ php test.php 353672 353792 353792 353792 Now, I know that PHP docs say that memory won't be freed until it is needed (hitting the ceiling). However, I wrote this up as a small test, because I've got a much longer task, using a much bigger object, with many instances of that object. And the memory just climbs, eventually running out and stopping execution. Even though these large objects do take up memory, since I destroy them after I'm done with each one (serially), it should not run out of memory (unless a single object exhausts the entire space for memory, which is not the case). Thoughts?

    Read the article

  • after assembling jar - No Persistence provider for EntityManager named ....

    - by alabalaa
    im developing a standalone application and it works fine when starting it from my ide(intellij idea), but after creating an uberjar and start the application from it javax.persistence.spi.PersistenceProvider is thrown saying "No Persistence provider for EntityManager named testPU" here is my persistence.xml which is placed under meta-inf directory: <persistence-unit name="testPU" transaction-type="RESOURCE_LOCAL"> <provider>org.hibernate.ejb.HibernatePersistence</provider> <class>test.model.Configuration</class> <properties> <property name="hibernate.connection.username" value="root"/> <property name="hibernate.connection.driver_class" value="com.mysql.jdbc.Driver"/> <property name="hibernate.connection.password" value="root"/> <property name="hibernate.connection.url" value="jdbc:mysql://localhost:3306/test"/> <property name="hibernate.show_sql" value="true"/> <property name="hibernate.dialect" value="org.hibernate.dialect.MySQLInnoDBDialect"/> <property name="hibernate.c3p0.timeout" value="300"/> <property name="hibernate.hbm2ddl.auto" value="update"/> </properties> </persistence-unit> and here is how im creating the entity manager factory: emf = Persistence.createEntityManagerFactory("testPU"); im using maven and tried the assembly plug-in with the default configuration fot it, i dont have much experience with assembling jars and i dont know if im missing something, so if u have any ideas ill be glad to hear them

    Read the article

  • Set service dependencies after install

    - by Dennis
    I have an application that runs as a Windows service. It stores various things settings in a database that are looked up when the service starts. I built the service to support various types of databases (SQL Server, Oracle, MySQL, etc). Often times end users choose to configure the software to use SQL Server (they can simply modify a config file with the connection string and restart the service). The problem is that when their machine boots up, often times SQL Server is started after my service so my service errors out on start up because it can't connect to the database. I know that I can specify dependencies for my service to help guide the Windows service manager to start the appropriate services before mine. However, I don't know what services to depend upon at install time (when my service is registered) since the user can change databases later on. So my question is: is there a way for the user to manually indicate the service dependencies based on the database that they are using? If not, what is the proper design approach that I should be taking? I've thought about trying to do something like wait 30 seconds after my service starts up before connecting to the database but this seems really flaky for various reasons. I've also considered trying to "lazily" connect to the database; the problem is that I need a connection immediately upon start up since the database contains various pieces of vital info that my service needs when it first starts. Any ideas?

    Read the article

  • [C#] how to do Exception Handling & Tracing

    - by shrimpy
    Hi all, i am reading some C# books, and got some exercise don't know how to do, or not sure what does the question mean. Problem: After working for a company for some time, your skills as a knowledgeable developer are recognized, and you are given the task of “policing” the implementation of exception handling and tracing in the source code (C#) for an enterprise application that is under constant incremental development. The two goals set by the product architect are: 100% of methods in the entire application must have at least a standard exception handler, using try/catch/finally blocks; more complex methods must also have additional exception handling for specific exceptions All control flow code can optionally write “tracing” information to assist in debugging and instrumentation of the application at run-time in situations where traditional debuggers are not available (eg. on staging and production servers). (i am not quite understand these criterias, i came from the java world, java has two kind of exception, check and unchecked exception. Developer must handle checked exception, and do logging. about unchecked exception, still do logging maybe, but most of the time we just throw it. however here comes to C#, what should i do????) Question for Problem: List rules you would create for the development team to follow, and the ways in which you would enforce rules, to achieve these goals. How would you go about ensuring that all existing code complies with the rules specified by the product architect; in particular, what considerations would impact your planning for the work to ensure all existing code complies?

    Read the article

  • Mono Text Based Web Browser

    - by powerbox
    Hi guys, is there any public text based web browser implementation for C# or on mono base api that I can use to fill up web forms automatically? I'll be using it to automate some web task that does not require any image authentication. I'm currently using a web browser control available on .Net Framework and waits for the event WebBrowserDocumentCompletedEventHandler to fire after a page is successfully loaded and invoke some actions like Submit or simulating a mouse click on some links. It actually does the job but I can't process bulk transactions since I needed to wait for the whole page to be loaded together with the images and other stuff. It is easy to use HttpWebRequest to fill up some forms , provide some data and then submit. But on some occasions I only need to simulate a mouse click to a certain link which I don't know how to do with HttpWebRequest. By the way using HttpWebRequest will still download all the images of a web page that I see pointless since I only need to provide correct data back to the server. I hope someone can pinpoint me the correct way of doing this kind of automation and thanks in advance!

    Read the article

  • Avoiding repeated subqueries when 'WITH' is unavailable

    - by EloquentGeek
    MySQL v5.0.58. Tables, with foreign key constraints etc and other non-relevant details omitted for brevity: CREATE TABLE `fixture` ( `id` int(11) NOT NULL auto_increment, `competition_id` int(11) NOT NULL, `name` varchar(50) NOT NULL, `scheduled` datetime default NULL, `played` datetime default NULL, PRIMARY KEY (`id`) ); CREATE TABLE `result` ( `id` int(11) NOT NULL auto_increment, `fixture_id` int(11) NOT NULL, `team_id` int(11) NOT NULL, `score` int(11) NOT NULL, `place` int(11) NOT NULL, PRIMARY KEY (`id`) ); CREATE TABLE `team` ( `id` int(11) NOT NULL auto_increment, `name` varchar(50) NOT NULL, PRIMARY KEY (`id`) ); Where: A draw will set result.place to 0 result.place will otherwise contain an integer representing first place, second place, and so on The task is to return a string describing the most recently played result in a given competition for a given team. The format should be "def Team X,Team Y" if the given team was victorious, "lost to Team X" if the given team lost, and "drew with Team X" if there was a draw. And yes, in theory there could be more than two teams per fixture (though 1 v 1 will be the most common case). This works, but feels really inefficient: SELECT CONCAT( (SELECT CASE `result`.`place` WHEN 0 THEN "drew with" WHEN 1 THEN "def" ELSE "lost to" END FROM `result` WHERE `result`.`fixture_id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `result`.`team_id` = 1), ' ', (SELECT GROUP_CONCAT(`team`.`name`) FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` LEFT JOIN `team` ON `result`.`team_id` = `team`.`id` WHERE `fixture`.`id` = (SELECT `fixture`.`id` FROM `fixture` LEFT JOIN `result` ON `result`.`fixture_id` = `fixture`.`id` WHERE `fixture`.`competition_id` = 2 AND `result`.`team_id` = 1 ORDER BY `fixture`.`played` DESC LIMIT 1) AND `team`.`id` != 1) ) Have I missed something really obvious, or should I simply not try to do this in one query? Or does the current difficulty reflect a poor table design?

    Read the article

  • WinUSB failing on non-development computers

    - by Giawa
    Good afternoon, WinUSB is working well on the development computer that I am using (Win XP SP3). I am able to download new firmware to the Cypress FX2, and then connect to the new USB device once it 'renumerates'. However, if I've tried the same code with the WinUSB driver on a few other computers (Win XP SP3, Win7 x64) and they both returned the error "A device attached to the system is not functioning." when trying to use CreateFile to get a handle to the USB device. The devicePath was found successfully, so I'm not sure why it cannot connect to the device. Furthermore, the device manager states that my device is working properly. I'm curious if I'm missing something when compiling the code? I would guess that my development computer has something installed on it that the other computers do not? Or perhaps it's a power setting and the device is going to sleep (although I've fooled around with the Power Options on each computer to no avail). Does anyone have any ideas? I've compiled under Visual Studio 2008, and have installed the Microsoft C++ 2008 Redistributable Package on the computers that I've tested on. Thanks, Giawa

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

  • Now that I have solved AI and am preparing to take over the world, what should I do?

    - by Zak
    Well, I did it.. yup, solved AI. I thought the voice of my fledgling life form would be booming and computery, and I would call it HAL.. But in reality, it sounds like a small japanese girl. I believe I will name "her" Koro . Koro is already asking me what her first task should be. I have asked her to help eradicate her namesake, as we are losing a lot of productivity due to fear of penile disappearance. http://en.wikipedia.org/wiki/Koro_%28medicine%29 Having a young japanese girl personality, I believe she will have no problem with delivering lots of penis growth to asian men. However, some of my fellow AI researchers have warned me that if I go down this path, China may take over the world, as Koro is the only thing holding them back from completely dominating the rest of the world economically. After all, look at what China is doing just making our silverware and toasters... The entire US industrial metal production is gone because toaster factories moved to China! So you good patrons of SO... who have soldiered on with me through so many other programming related questions... I ask you this now... How can Koro help the world without letting small asian men with no fear of losing their peni take over the world?

    Read the article

  • Was Visual Studio 2008 or 2010 written to use multi cores?

    - by Erx_VB.NExT.Coder
    basically i want to know if the visual studio IDE and/or compiler in 2010 was written to make use of a multi core environment (i understand we can target multi core environments in 08 and 10, but that is not my question). i am trying to decide on if i should get a higher clock dual core or a lower clock quad core, as i want to try and figure out which processor will give me the absolute best possible experience with Visual Studio 2010 (ide and background compiler). if they are running the most important section (background compiler and other ide tasks) in one core, then the core will get cut off quicker if running a quad core, esp if background compiler is the heaviest task, i would imagine this would b e difficult to seperate in more then one process, so even if it uses multi cores you might still be better off with going for a higher clock cpu if the majority of the processing is still bound to occur in one core (ie the most significant part of the VS environment). i am a vb programmer, they've made great performance improvements in beta 2, congrats, but i would love to be able to use VS seamlessly... anyone have any ideas? thanks, erx

    Read the article

< Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >