Search Results

Search found 16354 results on 655 pages for 'getopt long'.

Page 599/655 | < Previous Page | 595 596 597 598 599 600 601 602 603 604 605 606  | Next Page >

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • Hide jQuery Accordion while loading

    - by zac
    I am testing a site build with a slow connection and I noticed the jQuery Accordion stays expanded for a long time, until the rest of the site is loaded, and then finally collapses. Not very pretty. I was wondering how I could keep it collapsed through the loading process and only expand when clicked. I am working with the standalone 1.6 version of the accordion plugin. The basic structure : <div class="sidebar"> <ul id="navigation" class="ui-accordion-container"> <li><a class="head" href="#">1</a> <ul class="sub"> <li><a href="#">1a</a></li> <li><a href="#">2a</a></li> </ul> </li> </ul> </div> and the script jQuery().ready(function(){ jQuery('#navigation').accordion({ active: 'false', header: '.head', navigation: true, animated: 'easeslide', collapsible: true }); }); I tried to hide the elements in the CSS to keep them from appearing while loading but all that achieved is in having them always hidden. Maybe the problem is in the CSS I have a background image in each of the sub menus: #navigation{ margin:0px; margin-left: 10px; padding:0px; text-indent:0px; font-size: 1.1em; width:200px; text-transform: uppercase; padding-bottom: 30px; } #navigation ul{ border-width:0px; margin:0px; padding:0px; text-indent:0px; } #navigation li{ list-style:none outside none; } #navigation li ul{ height:185px; overflow:auto; } #navigation li ul.sub{ background:url('../images/sub.jpg') no-repeat; dispaly: block; } #navigation li li a{ color:#000000; display:block; text-indent:20px; text-decoration: none; padding: 6px 0; } #navigation li li a:hover{ background-color:#FFFF99; color:#FF0000; } Thanks in advance for any advice on how to have this thing run a little smoother and having the accordion always collapsed. -edit - I forgot to mention that I am also hoping for a solution that will allow the nav to still be accessible for those without javscript.

    Read the article

  • Restore previously serialized JFrame-object, how?

    - by elementz
    Hi all. I have managed to serialize my very basic GUI-object containing a JTextArea and a few buttons to a file 'test.ser'. Now, I would like to completely restore the previously saved state from 'test.ser', but seem to have a misconception of how to properly deserialize an objects state. The class MyFrame creates the JFrame and serializes it. public class MyFrame extends JFrame implements ActionListener { // Fields JTextArea textArea; String title; static MyFrame gui = new MyFrame(); private static final long serialVersionUID = 1125762532137824262L; /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub gui.run(); } // parameterless default contructor public MyFrame() { } // constructor with title public MyFrame(String title) { } // creates Frame and its Layout public void run() { JFrame frame = new JFrame(title); JPanel panel_01 = new JPanel(); JPanel panel_02 = new JPanel(); JTextArea textArea = new JTextArea(20, 22); textArea.setLineWrap(true); JScrollPane scrollPane = new JScrollPane(textArea); scrollPane.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_AS_NEEDED); panel_01.add(scrollPane); // Buttons JButton saveButton = new JButton("Save"); saveButton.addActionListener(this); JButton loadButton = new JButton("Load"); loadButton.addActionListener(this); panel_02.add(loadButton); panel_02.add(saveButton); // Layout frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.getContentPane().add(BorderLayout.CENTER, panel_01); frame.getContentPane().add(BorderLayout.SOUTH, panel_02); frame.setSize(300, 400); frame.setVisible(true); } /* * */ public void serialize() { try { ObjectOutputStream oos = new ObjectOutputStream(new FileOutputStream("test.ser")); oos.writeObject(gui); oos.close(); } catch (Exception e) { // TODO: handle exception e.printStackTrace(); } } public void actionPerformed(ActionEvent ev) { System.out.println("Action received!"); gui.serialize(); } } Here I try to do the deserialization: public class Deserialize { static Deserialize ds; static MyFrame frame; public static void main(String[] args) { try { ObjectInputStream ois = new ObjectInputStream(new FileInputStream("test.ser")); frame = (MyFrame) ois.readObject(); ois.close(); } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (ClassNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } } Maybe somebody could point me into the direction where my misconception is? Thx in advance!

    Read the article

  • Jquery $.post and PHP - Prevent the ability to use script outside of main website.

    - by Tim
    I have a PHP script setup using Jquery $.post which would return a response or do an action within the targeted .php file within $.post. Eg. My page has a form where you type in your Name. Once you hit the submit form button, $.post is called and sends the entered Name field value into "mywebsite.xyz/folder/ajaxscript.php" If a user was to visit "mywebsite.xyz/folder/ajaxscript.php" directly and somehow POST the data to the script, the script would return a response / do an action, based on the submitted POST data. The problem is, I don't want others to be able to periodically "call" an action or request a response from my website without using the website directly. Theoretically, right now you could determine what Name values my website allows without even visiting it, or you could call an action without going through the website, by simply visiting "mywebsite.xyz/folder/ajaxscript.php" So, what measures can I take to prevent this from happening? So far my idea is to ensure that it is a $_POST and not a $_GET - so they cannot manually enter it into the browser, but they could still post data to the script... Another measure is to apply a session key that expires, and is only valid for X amount of visits until they revisit the website. ~ Or, just have a daily "code" that changes and they'd need to grab this code from the website each day to keep their direct access to the script working (eg. I pass the daily "code" into each post request. I then check that code matches in the ajax php script.) However, even with these meaures, they will STILL have access to the scripts so long as they know how to POST the data, and also get the new code each day. Also, having a daily code requirement will cause issues when visiting the site at midnight (12:00am) as the code will change and the script will break for someone who is on the website trying to call the script, with the invalid code being passed still. I have attempted using .htaccess however using: order allow,deny deny from all Prevents legitimate access, and I'd have to add an exception so the website's IP is allowed to access it.. which is a hassle to update I think. Although, if it's the only legitimate solution I guess I'll have to. If I need to be more clear please let me know.

    Read the article

  • How to Work Around Limitations in Generic Type Constraints in C#?

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • Is this a legitimate implementation of a 'remember me' function for my web app?

    - by user246114
    Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

    Read the article

  • Android: onListItemClick not getting called in ListActivity

    - by user521469
    I'm having problems with my first Android app. I have subclassed ListActivity, and I'm having no luck getting the overridden onListItemClick() to respond to click events. I've read focus can be a problem, but changing focus in the XML files does not seem to work. Here's the relevant bits of code. Anyone see what's I've buggered up? public class Notepadv1 extends ListActivity { private int mNoteNumber = 1; private NotesDbAdapter mDbHelper; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.notepad_list); mDbHelper = new NotesDbAdapter(this); mDbHelper.open(); fillData(); } private void fillData() { // Get all of the notes from the database and create the item list Cursor c = mDbHelper.fetchAllNotes(); startManagingCursor(c); String[] from = new String[] { NotesDbAdapter.KEY_TITLE }; int[] to = new int[] { R.id.text1 }; SimpleCursorAdapter notes = new SimpleCursorAdapter(this, R.layout.notes_row, c, from, to); setListAdapter(notes); } @Override public void onListItemClick (ListView l, View v, int position, long id){ super.onListItemClick(l, v, position, id); AlertDialog alert = new AlertDialog.Builder(this).create(); String message = "row clicked!"; alert.setMessage(message); alert.show(); } notepad_list.xml <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@android:id/list" android:layout_width="wrap_content" android:layout_height="wrap_content" android:dividerHeight="6dp"/> <TextView android:id="@android:id/empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/no_notes" /> </LinearLayout> And notes_row.xml <?xml version="1.0" encoding="utf-8"?> <TextView android:id="@+id/text1" xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="60dp" android:focusable="false"/>

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Is there a recommended approach to handle saving data in response to within-site navigation without

    - by Carvell Fenton
    Hello all, Preamble to scope my question: I have a web app (or site, this is an internal LAN site) that uses jQuery and AJAX extensively to dynamically load the content section of the UI in the browser. A user navigates the app using a navigation menu. Clicking an item in the navigation menu makes an AJAX call to php, and php then returns the content that is used to populate the central content section. One of the pages served back by php has a table form, set up like a spreadsheet, that the user enters values into. This table is always kept in sync with data in the database. So, when the table is created, is it populated with the relevant database data. Then when the user makes a change in a "cell", that change immediately is written back to the database so the table and database are always in sync. This approach was take to reassure users that the data they entered has been saved (long story...), and to alleviate them from having to click a save button of some kind. So, this always in sync idea is great, except that a user can enter a value in a cell, not take focus out of the cell, and then take any number of actions that would cause that last value to be lost: e.g. navigate to another section of the site via the navigation menu, log out of the app, close the browser, etc. End of preamble, on to the issue: I initially thought that wasn't a problem, because I would just track what data was "dirty" or not saved, and then in the onunload event I would do a final write to the database. Herein lies the rub: because of my clever (or not so clever, not sure) use of AJAX and dynamically loading the content section, the user never actually leaves the original url, or page, when the above actions are taken, with the exception of closing the browser. Therefore, the onunload event does not fire, and I am back to losing the last data again. My question, is there a recommended way to handle figuring out if a person is navigating away from a "section" of your app when content is dynamically loaded this way? I can come up with a solution I think, that involves globals and tracking the currently viewed page, but I thought I would check if there might be a more elegant solution out there, or a change I could make in my design, that would make this work. Thanks in advance as always!

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • How to use Facebook graph API to retrieve fan photos uploaded to wall of fan page?

    - by Joe
    I am creating an external photo gallery using PHP and the Facebook graph API. It pulls thumbnails as well as the large image from albums on our Facebook Fan Page. Everything works perfect, except I'm only able to retrieve photos that an ADMIN posts to our page. (graph.facebook.com/myalbumid/photos) Is there a way to use graph api to load publicy uploaded photos from fans? I want to retrieve the pictures from the "Photos from" album, but trying to get the ID for the graph query is not like other albums... it looks like this: http://www.facebook.com/media/set/?set=o.116860675007039 Another note: The only way i've come close to retreiving this data is by using the "feed" option.. ie: graph.facebook.com/pageid/feed EDIT: This is about as far as I could get- it works, but has certain issues stated below. Maybe someone could expand on this, or provide a better solution. (Using FB PHP SDK) <?php require_once ('config.php'); // get all photos for album $photos = $facebook->api("/YourID/tagged"); $maxitem =10; $count = 0; foreach($photos['data'] as $photo) { if ($photo['type'] == "photo"): echo "<img src='{$photo['picture']}' />", "<br />"; endif; $count+= 1; if ($count >= "$maxitem") break; } ?> Issues with this: 1) The fact that I don't know a method for graph querying specific "types" of Tags, I had to run a conditional statement to display photos. 2) You cannot effectively use the "?limit=#" with this, because as I said the "tagged" query contains all types (photo, video, and status). So if you are going for a photo gallery and wish to avoid running an entire query by using ?limit, you will lose images. 3) The only content that shows up in the "tagged" query is from people that are not Admins of the page. This isn't the end of the world, but I don't understand why Facebook wouldn't allow yourself to be shown in this data as long as you posted it "as yourself" and not as the page.

    Read the article

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • Release management with a distributed version control system

    - by See Sharp Cheddar
    We're considering a switch from SVN to a distributed VCS at my workplace. I'm familiar with all the reasons for wanting to using a DVCS for day-to-day development: local version control, easier branching and merging, etc., but I haven't seen that much that's compelling in terms of managing software releases. Here's our release process: Discover what changes are available for merging. Run a query to find the defects/tickets associated with these changes. Filter out changes associated with "open" tickets. In our environment, tickets must be in a closed state in order to merged with a release branch. Filter out changes we don't want in the release branch. We are very conservative when it comes to merging changes. If a change isn't absolutely necessary, it doesn't get merged. Merge available changes, preferably in chronological order. We group changes together if they're associated with the same ticket. Block unwanted changes from the release branch (svnmerge block) so we don't have to deal with them again. Sometimes we can be juggling 3-5 different milestones at a time. Some milestones have very different constraints, and the block list can get quite long. I've been messing around with git, mercurial and plastic, and as far as I can tell none of them address this model very well. It seems like they would work very well when you have only one product you're releasing, but I can't imagine using them for juggling multiple, very different products from the same codebase. For example, cherry-picking seems to be an afterthought in mercurial. (You have to use the 'transplant' command). After you cherry-pick a change into a branch it still shows up as an available integration. Cherry-picking breaks the mercurial way of working. DVCS seems to be better suited for feature branches. There's no need for cherry-picking if you merge directly from a feature branch to trunk and the release branch. But who wants to do all that merging all the time? And how do you query for what's available to merge? And how do you make sure all the changes in a feature branch belong together? It sounds like total chaos. I'm torn because the coder in me wants DVCS for day-to-day work. I really want it. But I fear the day when I have to put the release manager hat and sort out what needs to be merged and what doesn't. I want to write code, I don't want to be a merge monkey.

    Read the article

  • .Net Remote Log Querying

    - by jlafay
    I have a Win Service that I'm working on that consists of the service, WF Service (using WorkflowServiceHost), a Workflow (WorkflowApplication) that queries/processes data from a SQL Server DB, and a Comm Marshall class that handles data flow between the service and the WF. The WF does a lot of heavy data processing and the original app (early VB6) logged all the processing and displayed the results on the screen of the host machine. Critical events will be committed to eventlog because I strongly believe that should be common practice because admins naturally will look there and because it already has support for remote viewing. The workflow will also need to write logging events as it processes and iterates according to our business logic. Such as: records queried, records returned, processed records, etc. The data is very critical and we need to log actions as they occur. The logs are currently kept as text files on disk and I think that is ok. Ideally I would like to record log events in XML so it's easier to query and because it is less costly than a DB, especially since our DB servers do a lot of heavy processing anyways. Since we are replacing essentially a VB6 application with a robust windows service (taking advantage of WF 4.0), it has been requested that a remote client also be created. It receives callbacks from the service after subscribing to it and being added to a collection of subscribers. Basic statistics and summaries are updated client side after receiving basic monitoring data of what is going on with the service. We would like to also provide a way to provide details when we need to examine what is going on further because this is a long running data processing service and issues need to be addressed immediately. What is the best way to implement some type of query from the client that is sent to the service and returned to the client? Would it be efficient to implement another method to expose on the service and then have that pass that off to some querying class/object to examine the XML files by whichever specification and then return it to the client? That's the main concern. I don't want the service to processing to bottleneck much while this occurs. It seems that WF already auto-magically threads well for the most part but I want to make sure this is the right way to go about it. Any suggestions/recommendations on how to architect and implement a small log querying framework for a remote service would be awesome.

    Read the article

  • Hibernate MappingException Unknown entity: $Proxy2

    - by slynn1324
    I'm using Hibernate annotations and have a VERY basic data object: import java.io.Serializable; import javax.persistence.Entity; import javax.persistence.Id; @Entity public class State implements Serializable { /** * */ private static final long serialVersionUID = 1L; @Id private String stateCode; private String stateFullName; public String getStateCode() { return stateCode; } public void setStateCode(String stateCode) { this.stateCode = stateCode; } public String getStateFullName() { return stateFullName; } public void setStateFullName(String stateFullName) { this.stateFullName = stateFullName; } } and am trying to run the following test case: public void testCreateState(){ Session s = HibernateUtil.getSessionFactory().getCurrentSession(); Transaction t = s.beginTransaction(); State state = new State(); state.setStateCode("NE"); state.setStateFullName("Nebraska"); s.save(s); t.commit(); } and get an org.hibernate.MappingException: Unknown entity: $Proxy2 at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.event.def.AbstractSaveEventListener.saveWithGeneratedId(AbstractSaveEventListener.java:121) .... I haven't been able to find anything referencing the $Proxy part of the error - and am at a loss.. Any pointers to what I'm missing would be greatly appreciated. hibernate.cfg.xml <property name="hibernate.connection.driver_class">org.hsqldb.jdbcDriver</property> <property name="connection.url">jdbc:hsqldb:hsql://localhost/xdb</property> <property name="connection.username">sa</property> <property name="connection.password"></property> <property name="current_session_context_class">thread</property> <property name="dialect">org.hibernate.dialect.HSQLDialect</property> <property name="show_sql">true</property> <property name="hbm2ddl.auto">update</property> <property name="hibernate.transaction.factory_class">org.hibernate.transaction.JDBCTransactionFactory</property> <mapping class="com.test.domain.State"/> in HibernateUtil.java public static SessionFactory getSessionFactory(boolean testing ) { if ( sessionFactory == null ){ try { String configPath = HIBERNATE_CFG; AnnotationConfiguration config = new AnnotationConfiguration(); config.configure(configPath); sessionFactory = config.buildSessionFactory(); } catch (Exception e){ e.printStackTrace(); throw new ExceptionInInitializerError(e); } } return sessionFactory; }

    Read the article

  • Simple RSA encryption (Java)

    - by jake blue
    This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • Google Maps API 3 How to call initialize without putting it in Body onload

    - by Bex
    Hi I am using the google maps API and have copied the examples and have ended up with a function called "initialize" that is called from the body onload. I am using the maps in a few different user controls, which are placed within content place holders, so the body tag is in the master page. Is there a way of calling initialize directly in the usercontrol rather than having to place an onload on the masterpage? Ideally I want my user control to be a stand alone control that I can just slot into pages without trying to access the master page body onload. I have tried calling the Initialize function from my page load of the user control (by adding a start up script), but the map doesn't appear. Any suggestions? My code: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false">/script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> var map; var geocoder; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(51.8052184317649, -4.965819906250006); var myOptions = { zoom: 8, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); $.ajax({ type: "POST", url: "/GoogleMapsService.asmx/GetPointers", contentType: "application/json; charset=utf-8", dataType: "json", beforeSend: function () { $(".loadingData").html("<p>Loading data..</p>"); }, complete: function () { $(".loadingData").html(""); }, cache: true, success: mapPoints, error: onError }); } function onError(xhr, ajaxOptions, thrownError) { alert(xhr.status); alert(xhr.responseText); } function mapPoints(response) { if (response.d != null) { if (response.d.length > 0) { for (var i = 0; i < response.d.length; i++) { plotOnMap(response.d[i].Id, response.d[i].Name, response.d[i].Lat, response.d[i].Long, response.d[i].ShortDesc) } } } } and on my test master page: <body onload="initialize()"> <form runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePageMethods="true"></asp:ScriptManager> <asp:ContentPlaceHolder ID="MainContent" runat="server"> </asp:ContentPlaceHolder> </form> </body>

    Read the article

  • Can't access font resource in Silverlight class library

    - by Matt
    I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

    Read the article

  • What would you do to make this code more "over-engineered"? [closed]

    - by Mez
    A friend and I got bored, and, long story short, decided to make an over-engineered FizzBuzz in PHP <?php interface INumber { public function go(); public function setNumber($i); } class FBNumber implements INumber { private $value; private $fizz; private $buzz; public function __construct($fizz = 3 , $buzz = 5) { $this->setFizz($fizz); $this->setBuzz($buzz); } public function setNumber($i) { if(is_int($i)) { $this->value = $i; } } private function setFizz($i) { if(is_int($i)) { $this->fizz = $i; } } private function setBuzz($i) { if(is_int($i)) { $this->buzz = $i; } } private function isFizz() { return ($this->value % $this->fizz == 0); } private function isBuzz() { return ($this->value % $this->buzz == 0); } private function isNeither() { return (!$this->isBuzz() AND !$this->isFizz()); } private function isFizzBuzz() { return ($this->isFizz() OR $this->isBuzz()); } private function fizz() { if ($this->isFizz()) { return "Fizz"; } } private function buzz() { if ($this->isBuzz()) { return "Buzz"; } } private function number() { if ($this->isNeither()) { return $this->value; } } public function go() { return $this->fizz() . $this->buzz() . $this->number(); } } class FizzBuzz { private $limit; private $number_class; private $numbers = array(); function __construct(INumber $number_class, $limit = 100) { $this->number_class = $number_class; $this->limit = $limit; } private function collectNumbers() { for ($i=1; $i <= $this->limit; $i++) { $n = clone($this->number_class); $n->setNumber($i); $this->numbers[$i] = $n->go(); unset($n); } } private function printNumbers() { $return = ''; foreach($this->numbers as $number){ $return .= $number . "\n"; } return $return; } public function go() { $this->collectNumbers(); return $this->printNumbers(); } } $fb = new FizzBuzz(new FBNumber()); echo $fb->go(); In theory, what could we/would you do to make it even more "over-engineered"?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

    - by Doug Chamberlain
    Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

    Read the article

< Previous Page | 595 596 597 598 599 600 601 602 603 604 605 606  | Next Page >