Search Results

Search found 1826 results on 74 pages for 'formatted'.

Page 60/74 | < Previous Page | 56 57 58 59 60 61 62 63 64 65 66 67  | Next Page >

  • python / sqlite - database locked despite large timeouts

    - by Chris Phillips
    Hi, I'm sure I'm missing something pretty obvious, but I can't for the life of me stop my pysqlite scripts crashing out with a database is locked error. I have two scripts, one to load data into the database, and one to read data out, but both will frequently, and instantly, crash depending on what the other is doing with the database at any given time. I've got the timeout on both scripts set to 30 seconds: cx = sqlite.connect("database.sql", timeout=30.0) and think I can see some evidence of the timeouts in that i get what appears to be a timing stamp (e.g 0.12343827e-06 0.1 - and how do I stop that being printed?) dumped occasionally in the middle of my curses formatted output screen, but no delay that ever gets remotely near the 30 second timeout, but still one of the other keeps crashing again and again from this. I'm running RHEL5.4 on a 64 bit 4 cpu HS21 IBM blade, and have heard some mention about issues about multi-threading and am not sure if this might be relevant. Packages in use are sqlite-3.3.6-5 and python-sqlite-1.1.7-1.2.1, and upgrading to newer versions outside of RedHat's official provisions is not a great option for me. Possible, but not desirable due to the environment in general. I have had autocommit=1 on previously on both scripts, but have since disabled on both, and am now cx.commit()ing on the inserting script and not committing on the select script. Ultimately as I only ever have one script actually making any modifications, I don't really see why this locking should ever ever happen. I have noticed that this is significantly worse over time when the database has gotten larger. It was recently at 13mb with 3 equal sized tables, which was about 1 day's worth of data. creating a new file has significantly improved this, which seems understandable, but the timeout ultimately just doesn't seem to be being obeyed. Any pointers very much appreciated. Thanks Chris

    Read the article

  • iPhone offline reading

    - by Andy
    Hi, first of all - I am quite new to iPhone App development (3 months). I am working for a software company that offers a content management system. Our customers are for the main part publishing houses for magazines. They use our software to write articles to their homepages. Now we want to offer iPhone Applications to go with our cms. What I have accomplished so far is an RSS reader that shows newly published articles in a list view. The user selects one article and is redirected to a specially formatted detail view of this article. The next step is to add offline reading capabilities. I have searched the internet up and down but couldn't find anything like a best practice for that. I get it that there are two possibilities in general: Store the contents of the uiwebview locally on the iPhone/iPad (including css, images, js and so on). There would be the need to rework the basic html to use the downloaded css, images and js. Also I would have to somehow edit hyperlinks to following pages in multipage articles - Sounds like a lot of work ;) Create a PDF on the server side and download that to the mobile device. Rework the RSS Source to point to the locally saved pdf instead of the website on the server. My question is - what is the better way to go? Are there any downsides for either of the possibilities? Are there other (simple ;)) ways to implement offline reading features? Are there possibly any howto's that I could've missed? Thanks y'all!

    Read the article

  • Extract wrong data from a frame in C?

    - by ipkiss
    I am writing a program that reads the data from the serial port on Linux. The data are sent by another device with the following frame format: |start | Command | Data | CRC | End | |0x02 | 0x41 | (0-127 octets) | | 0x03| ---------------------------------------------------- The Data field contains 127 octets as shown and octet 1,2 contains one type of data; octet 3,4 contains another data. I need to get these data. Because in C, one byte can only holds one character and in the start field of the frame, it is 0x02 which means STX which is 3 characters. So, in order to test my program, On the sender side, I construct an array as the frame formatted above like: char frame[254]; frame[0] = 0x02; // starting field frame[1] = 0x41; // command field which is character 'A' ..so on.. And, then On the receiver side, I take out the fields like: char result[254]; // read data read(result); printf("command = %c", result[1]); // get the command field of the frame // get other field's values the command field value (result[1]) is not character 'A'. I think, this because the first field value of the frame is 0x02 (STX) occupying 3 first places in the array frame and leading to the wrong results on the receiver side. How can I correct the issue or am I doing something wrong at the sender side? Thanks all. related questions: http://stackoverflow.com/questions/2500567/parse-and-read-data-frame-in-c http://stackoverflow.com/questions/2531779/clear-data-at-serial-port-in-linux-in-c

    Read the article

  • Reading CSV files in numpy where delimiter is ","

    - by monch1962
    Hello all, I've got a CSV file with a format that looks like this: "FieldName1", "FieldName2", "FieldName3", "FieldName4" "04/13/2010 14:45:07.008", "7.59484916392", "10", "6.552373" "04/13/2010 14:45:22.010", "6.55478493312", "9", "3.5378543" ... Note that there are double quote characters at the start and end of each line in the CSV file, and the "," string is used to delimit fields within each line. When I try to read this into numpy via: import numpy as np data = np.genfromtxt(csvfile, dtype=None, delimiter=',', names=True) all the data gets read in as string values, surrounded by double-quote characters. Not unreasonable, but not much use to me as I then have to go back and convert every column to its correct type When I use delimiter='","' instead, everything works as I'd like, except for the 1st and last fields. As the start of line and end of line characters are a single double-quote character, this isn't seen as a valid delimiter for the 1st and last fields, so they get read in as e.g. "04/13/2010 14:45:07.008 and 6.552373" - note the leading and trailing double-quote characters respectively. Because of these redundant characters, numpy assumes the 1st and last fields are both String types; I don't want that to be the case Is there a way of instructing numpy to read in files formatted in this fashion as I'd like, without having to go back and "fix" the structure of the numpy array after the initial read?

    Read the article

  • Parsing a complicated array with GetJSON Jquery

    - by Ozaki
    TLDR: Started with this question simplified it after got some of it working and continuing it here. I need to 'GET' the JSON array Format it correctly and for each within the array place it in the corresponding DIV. ?? It works. This is a followup from this question to simplify and continue. I need to some complicated JSON data from an array. With it I need the title and it's value. The reason why I am doing this is because I will know what the array is called but not the data that is being generated inside it. Lets say this new array looks as follows: {"Days": ["Sunday":"10.00", "Monday":"12.00", "Tuesday":"09.00", "Wednesday":"10.00", "Thursday":"02.00", "Friday":"05.00", "Saturday":"08.00"] } I would need it to get Sunday & 10.00 as well as the same for all of the others. My code to parse this at the moment is as follows: $.getJSON(url, function(data){ $.each(data, function(i,item){ $('.testfield').append('<p>' + item + '</p>'); }); }); Without the added times on each date it will parse the data as follows: Sunday, Monday, Tuesday, Wednesday, Thursday, Friday, Saturday With the times added to the days in the array Firebug no longer recognizes it as a JSON string. So I am guessing I have formatted something wrong here. Also, I need each day & time to be on a new line I thought that $('.testfield').append('<p>' + item + '</p>' + '<br />'); Would have applied each one to a new line but that did not work. How do I get each day or item to be on a new line? How do I get the $getjson to parse the data correctly day and its value, into a div?

    Read the article

  • What is the correct date format for a Date column in YUI DataTable ?

    - by giulio
    I have produced a data table. All the columns are sortable. It has a date in one column which I formatted dd/mm/yyyy hh:mm:ss . This is different from the default format as defined in the doco, but I should be able to define my own format for non-american formats. (See below) The DataTable class provides a set of built-in static functions to format certain well-known types of data. In your Column definition, if you set a Column's formatter to YAHOO.widget.DataTable.formatDate, that function will render data of type Date with the default syntax of "MM/DD/YYYY". If you would like to bypass a built-in formatter in favor of your own, you can point a Column's formatter to a custom function that you define. The table is generated from HTML Markup, so the data is held within "" tags. This gives me some more clues about compatible string dates for javascript: In general, the RecordSet expects to hold data in native JavaScript types. For instance, a date is expected to be a JavaScript Date instance, not a string like "4/26/2005" in order to sort properly. Converting data types as data comes into your RecordSet is enabled through the parser property in the fields array of your DataSource's responseSchema I suspect that the I'm missing something in the date format. So what is an acceptable string date for javascript, that Yui dataTable will recognise, given that I want format it as "dd/mm/yyyy hh:mm:ss" ?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Copy data from different worksheet to a master worksheet but no duplicates

    - by sam
    hi all, i want to clarify my initial question for a possible solutions from any savior out there. Say i have 3 excel sheets one for each user for data entry located in separate workbooks to avoid excel share workbook problems. I also have a master sheet in another workbook where i want individual data enter on those sheets precisely sheets 1 should copy to the next available row of sheet 1 in the master sheet as the users enter them. i need a vba code that can copy each record without copying a duplicate row in the master sheet but highlight the duplicate row and lookup the initial record in a master sheet and return the name of the Imputer looking up the row say column ( I) where each user sign there initials after every row of entry like below. All 4 worksheets are formatted as below: lastname account cardno. type tran amount date location comments initials JAME 65478923 1975 cash 500 4/10/2010 miles st. this acct is resolve MLK BEN 52436745 1880 CHECK 400 4/12/2010 CAREY ST Ongoing investigation MLK JAME 65478923 1975 cash 500 4/10/2010 miles st. this acct is resolve MLK I need the vba to recognize duplicates only if the account number and the card number matches the initial records. So if the duplicates exist a pop up message should be display that a duplicates exist and return the initial Imputer say MLK in COLUMN( I) to any user inputting in the individual worksheets other than warehouse sheets (master). So please any idea will be appreciated.

    Read the article

  • Is there a way to effect user defined data types in MySQL?

    - by Dancrumb
    I have a database which stores (among other things), the following pieces of information: Hardware IDs BIGINTs Storage Capacities BIGINTs Hardware Names VARCHARs World Wide Port Names VARCHARs I'd like to be able to capture a more refined definition of these datatypes. For instance, the hardware IDs have no numerical significance, so I don't care how they are formatted when displayed. The Storage Capacities, however, are cardinal numbers and, at a user's request, I'd like to present them with thousands and decimal separators, e.g. 123,456.789. Thus, I'd like to refine BIGINT into, say ID_NUMBER and CARDINAL. The same with Hardware Names, which are simple text and WWPNs, which are hexstrings, e.g. 24:68:AC:E0. Thus, I'd like to refine VARCHAR into ENGLISH_WORD and HEXSTRING. The specific datatypes I made up are just for illustrative purposes. I'd like to keep all this information in one place and I'm wondering if anybody knows of a good way to hold this all in my MySQL table definitions. I could use the Comment field of the table definition, but that smells fishy to me. One approach would be to define the data structure elsewhere and use that definition to generate my CREATE TABLEs, but that would be a major rework of the code that I currently have, so I'm looking for alternatives. Any suggestions? The application language in use is Perl, if that helps.

    Read the article

  • Invalidating Memcached Keys on save() in Django

    - by Zack
    I've got a view in Django that uses memcached to cache data for the more highly trafficked views that rely on a relatively static set of data. The key word is relatively: I need invalidate the memcached key for that particular URL's data when it's changed in the database. To be as clear as possible, here's the meat an' potatoes of the view (Person is a model, cache is django.core.cache.cache): def person_detail(request, slug): if request.is_ajax(): cache_key = "%s_ABOUT_%s" % settings.SITE_PREFIX, slug # Check the cache to see if we've already got this result made. json_dict = cache.get(cache_key) # Was it a cache hit? if json_dict is None: # That's a negative Ghost Rider person = get_object_or_404(Person, display = True, slug = slug) json_dict = { 'name' : person.name, 'bio' : person.bio_html, 'image' : person.image.extra_thumbnails['large'].absolute_url, } cache.set(cache_key) # json_dict will now exist, whether it's from the cache or not response = HttpResponse() response['Content-Type'] = 'text/javascript' response.write(simpljson.dumps(json_dict)) # Make sure it's all properly formatted for JS by using simplejson return response else: # This is where the fully templated response is generated What I want to do is get at that cache_key variable in it's "unformatted" form, but I'm not sure how to do this--if it can be done at all. Just in case there's already something to do this, here's what I want to do with it (this is from the Person model's hypothetical save method) def save(self): # If this is an update, the key will be cached, otherwise it won't, let's see if we can't find me try: old_self = Person.objects.get(pk=self.id) cache_key = # Voodoo magic to get that variable old_key = cache_key.format(settings.SITE_PREFIX, old_self.slug) # Generate the key currently cached cache.delete(old_key) # Hit it with both barrels of rock salt # Turns out this doesn't already exist, let's make that first request even faster by making this cache right now except DoesNotExist: # I haven't gotten to this yet. super(Person, self).save() I'm thinking about making a view class for this sorta stuff, and having functions in it like remove_cache or generate_cache since I do this sorta stuff a lot. Would that be a better idea? If so, how would I call the views in the URLconf if they're in a class?

    Read the article

  • Hidden controls, iframes or divs

    - by user287745
    What happens to the controls or the iframe or the div, which are hidden? Do they get transferred to the user side? Disabled: does it get transferred to the user side? What I want is, an aspx page will be having many iframes to display different pages. There will be many div tags to display CSS formatted information. To understand what I mean by many:- I have to transfer a complete website with 30 aspx pages into one single page! I have simply combined everything resulting in one extremely huge page. My concern is that on local host it loads fast, but when on online server accessed by numerous people for education purposes, the site (ONE PAGE) WILL SLOW DOWN terribly. To overcome this I thought of using hidden and disable options. What is an improved way of achieving the above? Yes, it sounds silly but this is the requirement. Edit: Yes, I know id and server tag must be set, but what I am asking will the div tag be sent to the user's browser? One answer is no. So can I enable them using JavaScript? Like document.getElementById(id).style.visibility="visible" What if I disable them, and from coding of JavaScript enable them? Will they be loaded at the time of enabling?

    Read the article

  • MS-Excel Negative times

    - by oxinabox.ucc.asn.au
    I'm writing a spreadsheet for a shop manager. What it does is keep track of the number of hours a worker has worked. So you enter times for Monday-Sunday, and then an adjustment - e.g. if they work 40/40/40/32 hours for the month, then you would have an adjustment of -2/-2/-2/+6 to bring the worker to the 38 hour week that he's being paid for. Some (most) weeks may be adjusted for overtime. The spreadsheet then totals the hours. This spreadsheet is supposed to just be a self-calculating version of a paper form. It needs to match the paper form as it has to be substituted for the old form which is given to some other member of the company (pay clerk, I don't know; I'm not rebuilding their whole system, just replacing a form) I'm having trouble entering a negative time in the adj field - the field has a [h]:mm formatting. and when i enter a negative time (e.g. -2:00) it displays an error, saying "incorrectly formatted equation", with the suggestion that if I was entering a string then I should prefix with a apostrophe. How do I overcome this?

    Read the article

  • How to get NSFormatter subclass to work with NSTableColumn sort key and selector?

    - by Andrew
    My setup: I have a sqlite database from which I populate a NSMutableArray of NSDictionary objects this is the DataSource for my NSTableView. One of the columns holds "time", the time is a float that holds seconds. I would like to display the values in this column as minutes:seconds. For instance my data would be 123.4329387 I want to display 2:03 which I have no problem doing with a subclass of NSFormatter (or NSNumberFormatter) applied to my NSTextField in the column. I have sorting set up by using the Table Column Attributes in IB, I just have the sort key set to "time" and the selector set to "compare:" which works fine without the formatter. Currently this gives me something like this when I sort (descending) 1:37, 1:31, 0:10, 0:10, 0:09, 1:30, 1:30, 1:26, 0:09 and similar nonsense, it looks like something is going on but it's definitely not sorted. How do I get the sort to look at the underlying data instead of the formatted value? Alternately, how do I specify a custom sort method and where do I put the code for said method? I have searched around quite a bit and have not found anything to help me out with this problem, any help with this is most appreciated.

    Read the article

  • compact Number formatting behavior in Java (automatically switch between decimal and scientific notation)

    - by kostmo
    I am looking for a way to format a floating point number dynamically in either standard decimal format or scientific notation, depending on the value of the number. For moderate magnitudes, the number should be formatted as a decimal with trailing zeros suppressed. If the floating point number is equal to an integral value, the decimal point should also be suppressed. For extreme magnitudes (very small or very large), the number should be expressed in scientific notation. Alternately stated, if the number of characters in the expression as standard decimal notation exceeds a certain threshold, switch to scientific notation. I should have control over the maximum number of digits of precision, but I don't want trailing zeros appended to express the minimum precision; all trailing zeros should be suppressed. Basically, it should optimize for compactness and readability. 2.80000 - 2.8 765.000000 - 765 0.0073943162953 - 0.00739432 (limit digits of precision—to 6 in this case) 0.0000073943162953 - 7.39432E-6 (switch to scientific notation if the magnitude is small enough—less than 1E-5 in this case) 7394316295300000 - 7.39432E+6 (switch to scientific notation if the magnitude is large enough—for example, when greater than 1E+10) 0.0000073900000000 - 7.39E-6 (strip trailing zeros from significand in scientific notation) 0.000007299998344 - 7.3E-6 (rounding from the 6-digit precision limit causes this number to have trailing zeros which are stripped) Here's what I've found so far: The .toString() method of the Number class does most of what I want, except it doesn't upconvert to integer representation when possible, and it will not express large integral magnitudes in scientific notation. Also, I'm not sure how to adjust the precision. The "%G" format string to the String.format(...) function allows me to express numbers in scientific notation with adjustable precision, but does not strip trailing zeros. I'm wondering if there's already some library function out there that meets these criteria. I guess the only stumbling block for writing this myself is having to strip the trailing zeros from the significand in scientific notation produced by %G.

    Read the article

  • Insert multiple line breaks into a JavaScript string (regex) (CodeMirror)

    - by PJH
    I have a few strings and I would like to insert some line breaks into them at certain points. I figured out a few of the logistics but as a whole I can't seem to crack this problem, probably because I have limited experience with regex. Basically I have a long string of XML tags that is all on one line. I want to add line breaks at certain points to get the data more formatted and looking nice. I am using CodeMirror to display this data on a webpage but for some reason its all on line #1. So I need to go from something like this: <Sample><Name></Name><PhoneNumber><AreaCode></AreaCode><Number></Number></PhoneNumber></Sample> To something like this: <Sample> <Name></Name> <PhoneNumber> <AreaCode></AreaCode> <Number></Number> </PhoneNumber> </Sample> CodeMirror will take care of the rest of the formatting all I need to do is insert the line breaks in the right spot using regex or a loop of some sort. The Tags will or can change so I am guessing regex has to be used. I have had success inserting line breaks with \n and &#xD but can't seem to get regex to detect the proper locations. Any help would be greatly appreciated. Thanks. UPDATE I overlooked this but the brackets are in fact being sent as < and > So example tag would look like: &lt;PhoneNumber&gt; or &lt;/PhoneNumber&gt; So basically need to insert a \n after every &gt; that is a closing tag or a beginning tag that contains children tags.

    Read the article

  • JSP Document/JSPX: what determines how space/linebreaks are removed in the output?

    - by NoozNooz42
    I've got a "JSP Document" ("JSP in XML") nicely formatted and when the webpage is generated and sent to the user, some linebreaks are removed. Now the really weird part: apparently the "main" .jsp always gets all its linebreak removed but for any subsequent .jsp included from the main .jsp, linebreaks seems to be randomly removed (some are there, others aren't). For example, if I'm looking at the webpage served from Firefox and ask to "view source", I get to see what is generated. So, what determines when/how linebreaks are kept/removed? This is just an example I made up... Can you force a .jsp to serve this: <body><div id="page"><div id="header"><div class="title">... or this: <body> <div id="page"> <div id="header"> <div class="title">... ? I take it that linebreaks are removed to save on bandwidth, but what if I want to keep them? And what if I want to keep the same XML indentation as in my .jsp file? Is this doable?

    Read the article

  • Query by datetime in JDOQL / Java / GAE

    - by Jan Kuboschek
    I'm working on a GAE app. I want to query datastore and retrieve all records between startDate and endDate. Each record has a datetime field. I'm using a query similar to this (the below code is something I quickly grabbed - I'm not near my developer machine.): Query query = pm.newQuery(Employee.class); query.setFilter("lastName == lastNameParam"); query.setOrdering("hireDate desc"); query.declareParameters("String lastNameParam"); try { List results = (List) query.execute("Smith"); if (results.iterator().hasNext()) { for (Employee e : results) { // ... } } else { // ... no results ... } } finally { query.closeAll(); } How do I have to format the date to form a correctly working query? How is the datetime stamp stored in datastore? As timestamp? Fully formatted? I can't find ANY information on this. Please help.

    Read the article

  • JSP Document/JSPX: what determines how tabs/space/linebreaks are removed in the output?

    - by NoozNooz42
    I've got a "JSP Document" ("JSP in XML") nicely formatted and when the webpage is generated and sent to the user, some linebreaks are removed. Now the really weird part: apparently the "main" .jsp always gets all its linebreak removed but for any subsequent .jsp included from the main .jsp, linebreaks seems to be randomly removed (some are there, others aren't). For example, if I'm looking at the webpage served from Firefox and ask to "view source", I get to see what is generated. So, what determines when/how linebreaks are kept/removed? This is just an example I made up... Can you force a .jsp to serve this: <body><div id="page"><div id="header"><div class="title">... or this: <body> <div id="page"> <div id="header"> <div class="title">... ? I take it that linebreaks are removed to save on bandwidth, but what if I want to keep them? And what if I want to keep the same XML indentation as in my .jsp file? Is this doable? EDIT Following skaffman's advice, I took a look at the generated .java files and the "main" one doesn't have lots of out.write but not a single one writing tabs nor newlines. Contrary to that file, all the ones that I'm including from that main .jsp have lots of lines like: out.write("\t...\n"); So I guess my question stays exactly the same: what determines how tabs/space/linebreaks are included/removed in the output?

    Read the article

  • Apache HTTP and WEblogic Plug-in Location Directive question

    - by user275633
    All, We are using Weblogic Portal and Apache 2.x http server with the weblogic plug-in for apache for load-balancing. We have an application that right now can only be accessed from one of our managed servers. What I would like to do is us the Location directive to direct all requests for that page to the one managed server and I can't get it to work. The context that the portal tries to forward to is something like /MyWebApp?portalusername= (where equals a legitimate user. For example /MyWebApp?portalusername=joesmith All other applications and the plug-in is load balancing as expected because every now and then you'll get sent to teh second managed server for this particular application and its not deployed. I tried various things in the apache http.conf like the following but can't seem to get it work? Any suggestions? The followign is a snippet of the httpd.conf: (Note formatting did not come thru properly but it is formatted correctly in my httpd.conf) Blockquote Location /MyWebApp SetHandler weblogic-handler WebLogicCluster myserver:7011 Location Blockquote Location / SetHandler weblogic-handler WebLogicCluster myserver:7011, myserver2:7012 Location Thanks in advance.

    Read the article

  • Flex through Flash Builder 4; Connecting to a dynamic XML feed: "The response is not a valid XML or

    - by jtromans
    I am learning how to use Flex with Adobe Flash Builder 4 standalone. I am working my through the Adobe Flash Build 4 Bible by David Gassner. This has led me to create my own micro problems to try and solve. I am trying to connect to a dynamix XML feed created by the following aspx page: generate_xml.aspx When I create the data connection through the Data/Service panel, I can pick between XML and HTTP. I figured because the generate_xml.aspx has to generate the XML file first, I should use the HTTP service as opposed to the XML. The HTTP service offers GET, which seems to be the kinda thing I want. However, I am really struggling to do this. I keep getting: "The response is not a valid XML or a JSON string" The actual STATIC generated XML file that is created by this page works perfectly when I save it and manually connect with the XML service. Therefore I know my XML code is properly formatted and contains no other HTML of JavaScript. I figure my problem occurs because the page itself is .aspx, but I cannot work out how to successfully ask Flex to request the output of this page, rather than the page itself.

    Read the article

  • JQuery & Wordpress - Hide multiple divs inside unique ID?

    - by steelfrog
    I'm trying to write a short Wordpress JQuery for Wordpress comments that would allow users to toggle specific comments on and off. This is my first script, and I'm having a tough time. Once overtly simplified, the comments are formatted like so: <li id="li-comment-<?php comment_ID() ?>"> <div class="gravatar"><img src="#" /></div> <div class="comment_poster">Username</div> <div class="comment_options">Option buttons</div> <div class="comment_content">Comment</div> </li> In the "comment_options" DIV is a series of buttons that control the individual comments (reply, quote, edit, close, etc.). The close button is what I'm trying to write this script for. I need it to toggle the "gravtar" and "comment_content" DIVs, but leave the rest in place so that it still displays the user ID and controls. However, I can't seem to figure out how to contain the action. This is what I have so far: $(document).ready(function() { $("div.trigger").click(function() { $("div.gravatar").slideToggle(); $("div.comment_content").slideToggle(); }); }); The problem with this is that it closes are the .gravatar and .comment_content on the page, not just the ones found in the same list item. If you're curious, this is the page I'm working on. Any idea how I could resolve this? Again, this is my firs time with JQuery, so I'm a little fuzzy on how it all works. Thanks!

    Read the article

  • Jquery - custom countdown

    - by matthewsteiner
    So I found this countdown at http://davidwalsh.name/jquery-countdown-plugin, I altered it a little bit: jQuery.fn.countDown = function(settings,to) { settings = jQuery.extend({ duration: 1000, startNumber: $(this).text(), endNumber: 0, callBack: function() { } }, settings); return this.each(function() { //where do we start? if(!to && to != settings.endNumber) { to = settings.startNumber; } //set the countdown to the starting number $(this).text(to); //loopage $(this).animate({ 'fontSize': settings.endFontSize },settings.duration,'',function() { if(to > settings.endNumber + 1) { $(this).text(to - 1).countDown(settings,to - 1); } else { settings.callBack(this); } }); }); }; Then I have this code: $(document).ready(function(){ $('.countdown').countDown({ callBack: function(me){ $(me).text('THIS IS THE TEXT'); } }); }); I don't mind taking everything out of the "animate" loop; I'd prefer that since nothing needs to be animated. (I don't need the font size to change). So everything's working to a point. I have a span with class countdown and whatever is in it when the page is refreshed goes down second by second. However, I need it to be formatted in M:S format. So, my two questions: 1) What can I use instead of animate to take care of the loop yet maintain the callback 2) How (where in the code should I) can I play with the time format? Thanks.

    Read the article

  • Using a version control system as a data backend

    - by JacobM
    I'm involved in a project that, among other things, involves storing edits and changes to a large hierarchical document (HTML-formatted text). We want to include versioning of textual changes and of structural changes. Currently we're maintaining the tree of document sections in a relational database, but as we start working on how to manage versioning of structural changes, it's clear that we're in danger of having to write a lot of the functionality that a version control system provides. We don't want to reinvent the wheel. Is it possible that we could use an existing version control system as the data store, at least for the document itself? Presumably we could do so by writing out new versions to the filesystem, and keeping that directory under version control (and programmatically doing commits and so forth) but it would be better if we could directly interact with the repository via code. The VCS that we are most familiar with is Subversion, but I'm not thrilled with how Subversion represents changes to the directory structure -- it would be nice if we could see that a particular revision included moving a section from Chapter 2 to Chapter 6, rather than just seeing a new version of the tree. This sounds more like the way a system like Mercurial handles changes to the structure. Any advice? Do VCS's have public APIs and so forth? The project is in Java (with Spring) if it matters.

    Read the article

  • How to parse a custom XML-style error code response from a website

    - by user1870127
    I'm developing a program that queries and prints out open data from the local transit authority, which is returned in the form of an XML response. Normally, when there are buses scheduled to run in the next few hours (and in other typical situations), the XML response generated by the page is handled correctly by the java.net.URLConnection.getInputStream() function, and I am able to print the individual results afterwards. The problem is when the buses are NOT running, or when some other problem with my queries develops after it is sent to the transit authority's web server. When the authority developed their service, they came up with their own unique error response codes, which are also sent as XMLs. For example, one of these error messages might look like this: <Error xmlns:i="http://www.w3.org/2001/XMLSchema-instance"> <Code>3005</Code> <Message>Sorry, no stop estimates found for given values.</Message> </Error> (This code and similar is all that I receive from the transit authority in such situations.) However, it appears that URLConnection.getInputStream() and some of its siblings are unable to interpret this custom code as a "valid" response that I can handle and print out as an error message. Instead, they give me a more generic HTTP/1.1 404 Not Found error. This problem cascades into my program which then prints out a java.io.FileNotFoundException error pointing to the offending input stream. My question is therefore two-fold: 1. Is there a way to retrieve, parse, and print a custom XML-formatted error code sent by a web service using the plugins that are available in Java? 2. If the above is not possible, what other tools should I use or develop to handle such custom codes as described?

    Read the article

  • Encoding MySQL text fields into UTF-8 text files - problems with special characters

    - by Matt Andrews
    I'm writing a php script to export MySQL database rows into a .txt file formatted for Adobe InDesign's internal markup. Exports work, but when I encounter special characters like é or umlauts, I get weird symbols (eg Chloë Hanslip instead of Chloë Hanslip). Rather than run a search and replace for every possible weird character, I need a better method. I've checked that when the text hits the database, it's saved properly - in the database I see the special characters. My export code basically runs some regular expressions to put in the InDesign code tags, and I'm left with the weird symbols. If I just output the text to the browser (rather than prompt for a text file download), it displays properly. When I save the file I use this code: header("Content-disposition: attachment; filename=test.txt"); header("Content-Type: text/plain; charset=utf-8"); I've tried various combinations of utf8_encode() and iconv() to no avail. Can anybody point me in the right direction here?

    Read the article

< Previous Page | 56 57 58 59 60 61 62 63 64 65 66 67  | Next Page >