Search Results

Search found 16393 results on 656 pages for 'long gu'.

Page 601/656 | < Previous Page | 597 598 599 600 601 602 603 604 605 606 607 608  | Next Page >

  • Hibernate MappingException Unknown entity: $Proxy2

    - by slynn1324
    I'm using Hibernate annotations and have a VERY basic data object: import java.io.Serializable; import javax.persistence.Entity; import javax.persistence.Id; @Entity public class State implements Serializable { /** * */ private static final long serialVersionUID = 1L; @Id private String stateCode; private String stateFullName; public String getStateCode() { return stateCode; } public void setStateCode(String stateCode) { this.stateCode = stateCode; } public String getStateFullName() { return stateFullName; } public void setStateFullName(String stateFullName) { this.stateFullName = stateFullName; } } and am trying to run the following test case: public void testCreateState(){ Session s = HibernateUtil.getSessionFactory().getCurrentSession(); Transaction t = s.beginTransaction(); State state = new State(); state.setStateCode("NE"); state.setStateFullName("Nebraska"); s.save(s); t.commit(); } and get an org.hibernate.MappingException: Unknown entity: $Proxy2 at org.hibernate.impl.SessionFactoryImpl.getEntityPersister(SessionFactoryImpl.java:628) at org.hibernate.impl.SessionImpl.getEntityPersister(SessionImpl.java:1366) at org.hibernate.event.def.AbstractSaveEventListener.saveWithGeneratedId(AbstractSaveEventListener.java:121) .... I haven't been able to find anything referencing the $Proxy part of the error - and am at a loss.. Any pointers to what I'm missing would be greatly appreciated. hibernate.cfg.xml <property name="hibernate.connection.driver_class">org.hsqldb.jdbcDriver</property> <property name="connection.url">jdbc:hsqldb:hsql://localhost/xdb</property> <property name="connection.username">sa</property> <property name="connection.password"></property> <property name="current_session_context_class">thread</property> <property name="dialect">org.hibernate.dialect.HSQLDialect</property> <property name="show_sql">true</property> <property name="hbm2ddl.auto">update</property> <property name="hibernate.transaction.factory_class">org.hibernate.transaction.JDBCTransactionFactory</property> <mapping class="com.test.domain.State"/> in HibernateUtil.java public static SessionFactory getSessionFactory(boolean testing ) { if ( sessionFactory == null ){ try { String configPath = HIBERNATE_CFG; AnnotationConfiguration config = new AnnotationConfiguration(); config.configure(configPath); sessionFactory = config.buildSessionFactory(); } catch (Exception e){ e.printStackTrace(); throw new ExceptionInInitializerError(e); } } return sessionFactory; }

    Read the article

  • Problem setting row backgrounds in Android Listview

    - by zchtodd
    I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

    Read the article

  • Release management with a distributed version control system

    - by See Sharp Cheddar
    We're considering a switch from SVN to a distributed VCS at my workplace. I'm familiar with all the reasons for wanting to using a DVCS for day-to-day development: local version control, easier branching and merging, etc., but I haven't seen that much that's compelling in terms of managing software releases. Here's our release process: Discover what changes are available for merging. Run a query to find the defects/tickets associated with these changes. Filter out changes associated with "open" tickets. In our environment, tickets must be in a closed state in order to merged with a release branch. Filter out changes we don't want in the release branch. We are very conservative when it comes to merging changes. If a change isn't absolutely necessary, it doesn't get merged. Merge available changes, preferably in chronological order. We group changes together if they're associated with the same ticket. Block unwanted changes from the release branch (svnmerge block) so we don't have to deal with them again. Sometimes we can be juggling 3-5 different milestones at a time. Some milestones have very different constraints, and the block list can get quite long. I've been messing around with git, mercurial and plastic, and as far as I can tell none of them address this model very well. It seems like they would work very well when you have only one product you're releasing, but I can't imagine using them for juggling multiple, very different products from the same codebase. For example, cherry-picking seems to be an afterthought in mercurial. (You have to use the 'transplant' command). After you cherry-pick a change into a branch it still shows up as an available integration. Cherry-picking breaks the mercurial way of working. DVCS seems to be better suited for feature branches. There's no need for cherry-picking if you merge directly from a feature branch to trunk and the release branch. But who wants to do all that merging all the time? And how do you query for what's available to merge? And how do you make sure all the changes in a feature branch belong together? It sounds like total chaos. I'm torn because the coder in me wants DVCS for day-to-day work. I really want it. But I fear the day when I have to put the release manager hat and sort out what needs to be merged and what doesn't. I want to write code, I don't want to be a merge monkey.

    Read the article

  • .Net Remote Log Querying

    - by jlafay
    I have a Win Service that I'm working on that consists of the service, WF Service (using WorkflowServiceHost), a Workflow (WorkflowApplication) that queries/processes data from a SQL Server DB, and a Comm Marshall class that handles data flow between the service and the WF. The WF does a lot of heavy data processing and the original app (early VB6) logged all the processing and displayed the results on the screen of the host machine. Critical events will be committed to eventlog because I strongly believe that should be common practice because admins naturally will look there and because it already has support for remote viewing. The workflow will also need to write logging events as it processes and iterates according to our business logic. Such as: records queried, records returned, processed records, etc. The data is very critical and we need to log actions as they occur. The logs are currently kept as text files on disk and I think that is ok. Ideally I would like to record log events in XML so it's easier to query and because it is less costly than a DB, especially since our DB servers do a lot of heavy processing anyways. Since we are replacing essentially a VB6 application with a robust windows service (taking advantage of WF 4.0), it has been requested that a remote client also be created. It receives callbacks from the service after subscribing to it and being added to a collection of subscribers. Basic statistics and summaries are updated client side after receiving basic monitoring data of what is going on with the service. We would like to also provide a way to provide details when we need to examine what is going on further because this is a long running data processing service and issues need to be addressed immediately. What is the best way to implement some type of query from the client that is sent to the service and returned to the client? Would it be efficient to implement another method to expose on the service and then have that pass that off to some querying class/object to examine the XML files by whichever specification and then return it to the client? That's the main concern. I don't want the service to processing to bottleneck much while this occurs. It seems that WF already auto-magically threads well for the most part but I want to make sure this is the right way to go about it. Any suggestions/recommendations on how to architect and implement a small log querying framework for a remote service would be awesome.

    Read the article

  • Simple RSA encryption (Java)

    - by jake blue
    This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

    Read the article

  • What is GC holes?

    - by tianyi
    I wrote a long TCP connection socket server in C#. Spike in memory in my server happens. I used dotNet Memory Profiler(a tool) to detect where the memory leaks. Memory Profiler indicates the private heap is huge, and the memory is something like below(the number is not real,what I want to show is the GC0 and GC2's Holes are very very huge, the data size is normal): Managed heaps - 1,500,000KB Normal heap - 1400,000KB Generation #0 - 600,000KB Data - 100,000KB "Holes" - 500,000KB Generation #1 - xxKB Data - 0KB "Holes" - xKB Generation #2 - xxxxxxxxxxxxxKB Data - 100,000KB "Holes" - 700,000KB Large heap - 131072KB Large heap - 83KB Overhead/unused - 130989KB Overhead - 0KB Howerver, what is GC hole? I read an article about the hole: http://kaushalp.blogspot.com/2007/04/what-is-gc-hole-and-how-to-create-gc.html The author said : The code snippet below is the simplest way to introduce a GC hole into the system. //OBJECTREF is a typedef for Object*. { PointerTable *pTBL = o_pObjectClass->GetPointerTable(); OBJECTREF aObj = AllocateObjectMemory(pTBL); OBJECTREF bObj = AllocateObjectMemory(pTBL); //WRONG!!! “aObj” may point to garbage if the second //“AllocateObjectMemory” triggered a GC. DoSomething (aOb, bObj); } All it does is allocate two managed objects, and then does something with them both. This code compiles fine, and if you run simple pre-checkin tests, it will probably “work.” But this code will crash eventually. Why? If the second call to “AllocateObjectMemory” triggers a GC, that GC discards the object instance you just assigned to “aObj”. This code, like all C++ code inside the CLR, is compiled by a non-managed compiler and the GC cannot know that “aObj” holds a root reference to an object you want kept live. ======================================================================== I can't understand what he explained. Does the sample mean aObj becomes a wild pointer after GC? Is it mean { aObj = (*aObj)malloc(sizeof(object)); free(aObj); function(aObj);? } ? I hope somebody can explain it.

    Read the article

  • Why an object declared in method is subject to garbage collection before the method returns?

    - by SiLent SoNG
    Consider an object declared in a method: public void foo() { final Object obj = new Object(); // A long run job that consumes tons of memory and // triggers garbage collection } Will obj be subject to garbage collection before foo() returns? UPDATE: Previously I thought obj is not subject to garbage collection until foo() returns. However, today I find myself wrong. I have spend several hours in fixing a bug and finally found the problem is caused by obj garbage collected! Can anyone explain why this happens? And if I want obj to be pinned how to achieve it? Here is the code that has problem. public class Program { public static void main(String[] args) throws Exception { String connectionString = "jdbc:mysql://<whatever>"; // I find wrap is gc-ed somewhere SqlConnection wrap = new SqlConnection(connectionString); Connection con = wrap.currentConnection(); Statement stmt = con.createStatement(ResultSet.TYPE_FORWARD_ONLY, ResultSet.CONCUR_READ_ONLY); stmt.setFetchSize(Integer.MIN_VALUE); ResultSet rs = stmt.executeQuery("select instance_id, doc_id from crawler_archive.documents"); while (rs.next()) { int instanceID = rs.getInt(1); int docID = rs.getInt(2); if (docID % 1000 == 0) { System.out.println(docID); } } rs.close(); //wrap.close(); } } After running the Java program, it will print the following message before it crashes: 161000 161000 ******************************** Finalizer CALLED!! ******************************** ******************************** Close CALLED!! ******************************** 162000 Exception in thread "main" com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: And here is the code of class SqlConnection: class SqlConnection { private final String connectionString; private Connection connection; public SqlConnection(String connectionString) { this.connectionString = connectionString; } public synchronized Connection currentConnection() throws SQLException { if (this.connection == null || this.connection.isClosed()) { this.closeConnection(); this.connection = DriverManager.getConnection(connectionString); } return this.connection; } protected void finalize() throws Throwable { try { System.out.println("********************************"); System.out.println("Finalizer CALLED!!"); System.out.println("********************************"); this.close(); } finally { super.finalize(); } } public void close() { System.out.println("********************************"); System.out.println("Close CALLED!!"); System.out.println("********************************"); this.closeConnection(); } protected void closeConnection() { if (this.connection != null) { try { connection.close(); } catch (Throwable e) { } finally { this.connection = null; } } } }

    Read the article

  • Google Maps API 3 How to call initialize without putting it in Body onload

    - by Bex
    Hi I am using the google maps API and have copied the examples and have ended up with a function called "initialize" that is called from the body onload. I am using the maps in a few different user controls, which are placed within content place holders, so the body tag is in the master page. Is there a way of calling initialize directly in the usercontrol rather than having to place an onload on the masterpage? Ideally I want my user control to be a stand alone control that I can just slot into pages without trying to access the master page body onload. I have tried calling the Initialize function from my page load of the user control (by adding a start up script), but the map doesn't appear. Any suggestions? My code: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false">/script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> var map; var geocoder; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(51.8052184317649, -4.965819906250006); var myOptions = { zoom: 8, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); $.ajax({ type: "POST", url: "/GoogleMapsService.asmx/GetPointers", contentType: "application/json; charset=utf-8", dataType: "json", beforeSend: function () { $(".loadingData").html("<p>Loading data..</p>"); }, complete: function () { $(".loadingData").html(""); }, cache: true, success: mapPoints, error: onError }); } function onError(xhr, ajaxOptions, thrownError) { alert(xhr.status); alert(xhr.responseText); } function mapPoints(response) { if (response.d != null) { if (response.d.length > 0) { for (var i = 0; i < response.d.length; i++) { plotOnMap(response.d[i].Id, response.d[i].Name, response.d[i].Lat, response.d[i].Long, response.d[i].ShortDesc) } } } } and on my test master page: <body onload="initialize()"> <form runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePageMethods="true"></asp:ScriptManager> <asp:ContentPlaceHolder ID="MainContent" runat="server"> </asp:ContentPlaceHolder> </form> </body>

    Read the article

  • Can't access font resource in Silverlight class library

    - by Matt
    I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

    - by Doug Chamberlain
    Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • What would you do to make this code more "over-engineered"? [closed]

    - by Mez
    A friend and I got bored, and, long story short, decided to make an over-engineered FizzBuzz in PHP <?php interface INumber { public function go(); public function setNumber($i); } class FBNumber implements INumber { private $value; private $fizz; private $buzz; public function __construct($fizz = 3 , $buzz = 5) { $this->setFizz($fizz); $this->setBuzz($buzz); } public function setNumber($i) { if(is_int($i)) { $this->value = $i; } } private function setFizz($i) { if(is_int($i)) { $this->fizz = $i; } } private function setBuzz($i) { if(is_int($i)) { $this->buzz = $i; } } private function isFizz() { return ($this->value % $this->fizz == 0); } private function isBuzz() { return ($this->value % $this->buzz == 0); } private function isNeither() { return (!$this->isBuzz() AND !$this->isFizz()); } private function isFizzBuzz() { return ($this->isFizz() OR $this->isBuzz()); } private function fizz() { if ($this->isFizz()) { return "Fizz"; } } private function buzz() { if ($this->isBuzz()) { return "Buzz"; } } private function number() { if ($this->isNeither()) { return $this->value; } } public function go() { return $this->fizz() . $this->buzz() . $this->number(); } } class FizzBuzz { private $limit; private $number_class; private $numbers = array(); function __construct(INumber $number_class, $limit = 100) { $this->number_class = $number_class; $this->limit = $limit; } private function collectNumbers() { for ($i=1; $i <= $this->limit; $i++) { $n = clone($this->number_class); $n->setNumber($i); $this->numbers[$i] = $n->go(); unset($n); } } private function printNumbers() { $return = ''; foreach($this->numbers as $number){ $return .= $number . "\n"; } return $return; } public function go() { $this->collectNumbers(); return $this->printNumbers(); } } $fb = new FizzBuzz(new FBNumber()); echo $fb->go(); In theory, what could we/would you do to make it even more "over-engineered"?

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • How do you combine "Revision Control" with "WorkFlow" for R?

    - by Tal Galili
    Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • HTML table ignoring element-style width

    - by sangil
    HTML table ignoring element-style width I have an HTML table where certain cells have very long text contents. I want to specify a width (in pixels) for these cells using jQuery, but the rendered table just ignores the given width. Is there any way to force the table to respect this width? Thanks! JSFiddle: http://jsfiddle.net/sangil/6hejy/35/ (If you inspect the cell you can see the the computed width is different than the element-style width) HTML: <div id="tblcont" class="tblcont"> <table id="pivot_table"> <tbody> <tr> <th id="h0" >product</th> <th id="h1" >price</th> <th id="h2" >change</th> </tr> <tr> <!-- this is the cell causing trouble --> <td id="c00" >Acer 2400 aaaaaaaaaaaaaaaaaaaaaaaaaa</td> <td id="c01" >3212</td> <td id="c02" >219</td> </tr> <tr> <td id="c10" >Acer</td> <td id="c11" >3821</td> <td id="c12" >206</td> </tr> </tbody> </table> </div> CSS: .tblcont { overflow: hidden; width: 500px; } table { table-layout: fixed; border-collapse: collapse; overflow-x: scroll; border-spacing:0; width: 100%; } th, td { overflow: hidden; text-overflow: ellipsis; word-wrap: break-word; } th { height: 50px; } ?Javascript: $(document).ready(function() { // THIS LINE HAS NO EFFECT! $('#c00').width(30); });

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • How to tag photos in facebook-api?

    - by Camillo
    Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Need help simplifying my php table

    - by user342391
    I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

< Previous Page | 597 598 599 600 601 602 603 604 605 606 607 608  | Next Page >