Search Results

Search found 19603 results on 785 pages for 'variable length'.

Page 609/785 | < Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >

  • osCommerce custom PHP page

    - by Afrosimon
    Hello! One of my client has an old osCommerce website and while working on it I have to implement what I would call "custom php page", i.e. a page which query a MySQL table, not related to osCommerce, and list the result. I'm not sure of the version, this trick I have seen a lot didn't gave me any result : http://www.clubosc.com/how-to-know-what-version-of-oscommerce-you-are-using.html . And I'm having a hard time doing this seemingly simple task, since osCommerce doesn't allow any php code in the page creation, and I didn't find any module giving me this possibility (not that it is easy to search in this mess : http://addons.oscommerce.com/). At this point I figured it would be easier to just hack'n slash through the code and come up with a custom page : I copied the index.php (the entry point in the application) : <?php require('includes/application_top.php'); if(!$smarty->is_cached($sContentPage, $sCachingGroup)) { //we switch on the content recognition require('includes/pages/' . $sContentClass . '.php'); } $smarty->display($sContentPage, $sCachingGroup); require(DIR_WS_INCLUDES . 'application_bottom.php'); ?> Here I gave a specific value to $sContentClass (with or without the if makes no difference) and customize the corresponding PHP file so it show my custom content but also initialize the same variable than those other PHP file in the pages/ folder. But alas, all of this curious and dubious code simply return me the home page. So here I am, is there an osCommerce Guru around here, or would anyone has a better idea (oh and I also posted on the osCommerce forum, but I'm still waiting for a response...)? Thanks a lot in advance.

    Read the article

  • Clustering on WebLogic exception on Failover

    - by Markos Fragkakis
    Hi all, I deploy an application on a WebLogic 10.3.2 cluster with two nodes, and a load balancer in front of the cluster. I have set the <core:init distributable="true" debug="true" /> My Session and Conversation classes implement Serializable. I start using the application being served by the first node. The console shows that the session replication is working. <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> When I shutdown the first node from the Administration console, I get this in the other node: <Jun 17, 2010 11:23:46 AM EEST> <Error> <Kernel> <BEA-000802> <ExecuteRequest failed java.lang.NullPointerException. java.lang.NullPointerException at org.jboss.seam.intercept.JavaBeanInterceptor.callPostActivate(JavaBeanInterceptor.java:165) at org.jboss.seam.intercept.JavaBeanInterceptor.invoke(JavaBeanInterceptor.java:73) at com.myproj.beans.SortingFilteringBean_$$_javassist_seam_2.sessionDidActivate(SortingFilteringBean_$$_javassist_seam_2.java) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2258) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2222) at weblogic.servlet.internal.session.ReplicatedSessionData.becomePrimary(ReplicatedSessionData.java:231) at weblogic.cluster.replication.WrappedRO.changeStatus(WrappedRO.java:142) at weblogic.cluster.replication.WrappedRO.ensureStatus(WrappedRO.java:129) at weblogic.cluster.replication.LocalSecondarySelector$ChangeSecondaryInfo.run(LocalSecondarySelector.java:542) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:516) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) at weblogic.work.ExecuteThread.run(ExecuteThread.java:173) > What am I doing wrong? This is the SortingFilteringBean: import java.util.HashMap; import java.util.LinkedHashMap; import org.jboss.seam.ScopeType; import org.jboss.seam.annotations.Name; import org.jboss.seam.annotations.Scope; import com.myproj.model.crud.Filtering; import com.myproj.model.crud.Sorting; import com.myproj.model.crud.SortingOrder; /** * Managed bean aggregating the sorting and filtering values for all the * application's lists. A light-weight bean to always keep in the session with * minimum impact. */ @Name("sortingFilteringBean") @Scope(ScopeType.SESSION) public class SortingFilteringBean extends BaseManagedBean { private static final long serialVersionUID = 1L; private Sorting applicantProductListSorting; private Filtering applicantProductListFiltering; private Sorting homePageSorting; private Filtering homePageFiltering; /** * Creates a new instance of SortingFilteringBean. */ public SortingFilteringBean() { // ********************** // Applicant Product List // ********************** // Sorting LinkedHashMap<String, SortingOrder> applicantProductListSortingValues = new LinkedHashMap<String, SortingOrder>(); applicantProductListSortingValues.put("applicantName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("applicantEmail", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productEmail", SortingOrder.ASCENDING); applicantProductListSorting = new Sorting( applicantProductListSortingValues); // Filtering HashMap<String, String> applicantProductListFilteringValues = new HashMap<String, String>(); applicantProductListFilteringValues.put("applicantName", ""); applicantProductListFilteringValues.put("applicantEmail", ""); applicantProductListFilteringValues.put("productName", ""); applicantProductListFilteringValues.put("productEmail", ""); applicantProductListFiltering = new Filtering( applicantProductListFilteringValues); // ********* // Home page // ********* // Sorting LinkedHashMap<String, SortingOrder> homePageSortingValues = new LinkedHashMap<String, SortingOrder>(); homePageSortingValues.put("productName", SortingOrder.ASCENDING); homePageSortingValues.put("productId", SortingOrder.ASCENDING); homePageSortingValues.put("productAtcCode", SortingOrder.UNSORTED); homePageSortingValues.put("productEmaNumber", SortingOrder.UNSORTED); homePageSortingValues.put("productOrphan", SortingOrder.UNSORTED); homePageSortingValues.put("productRap", SortingOrder.UNSORTED); homePageSortingValues.put("productCorap", SortingOrder.UNSORTED); homePageSortingValues.put("applicationTypeDescription", SortingOrder.ASCENDING); homePageSortingValues.put("applicationId", SortingOrder.ASCENDING); homePageSortingValues .put("applicationEmaNumber", SortingOrder.UNSORTED); homePageSortingValues .put("piVersionImportDate", SortingOrder.ASCENDING); homePageSortingValues.put("piVersionId", SortingOrder.ASCENDING); homePageSorting = new Sorting(homePageSortingValues); // Filtering HashMap<String, String> homePageFilteringValues = new HashMap<String, String>(); homePageFilteringValues.put("productName", ""); homePageFilteringValues.put("productAtcCode", ""); homePageFilteringValues.put("productEmaNumber", ""); homePageFilteringValues.put("applicationTypeId", ""); homePageFilteringValues.put("applicationEmaNumber", ""); homePageFilteringValues.put("piVersionImportDate", ""); homePageFiltering = new Filtering(homePageFilteringValues); } /** * @return the applicantProductListFiltering */ public Filtering getApplicantProductListFiltering() { return applicantProductListFiltering; } /** * @param applicantProductListFiltering * the applicantProductListFiltering to set */ public void setApplicantProductListFiltering( Filtering applicantProductListFiltering) { this.applicantProductListFiltering = applicantProductListFiltering; } /** * @return the applicantProductListSorting */ public Sorting getApplicantProductListSorting() { return applicantProductListSorting; } /** * @param applicantProductListSorting * the applicantProductListSorting to set */ public void setApplicantProductListSorting( Sorting applicantProductListSorting) { this.applicantProductListSorting = applicantProductListSorting; } /** * @return the homePageSorting */ public Sorting getHomePageSorting() { return homePageSorting; } /** * @param homePageSorting * the homePageSorting to set */ public void setHomePageSorting(Sorting homePageSorting) { this.homePageSorting = homePageSorting; } /** * @return the homePageFiltering */ public Filtering getHomePageFiltering() { return homePageFiltering; } /** * @param homePageFiltering * the homePageFiltering to set */ public void setHomePageFiltering(Filtering homePageFiltering) { this.homePageFiltering = homePageFiltering; } /** * For convenience to view in the Seam Debug page. * * @see java.lang.Object#toString() */ @Override public String toString() { StringBuilder sb = new StringBuilder(""); sb.append("\n\n"); sb.append("applicantProductListSorting"); sb.append(applicantProductListSorting); sb.append("\n\n"); sb.append("applicantProductListFiltering"); sb.append(applicantProductListFiltering); sb.append("\n\n"); sb.append("homePageSorting"); sb.append(homePageSorting); sb.append("\n\n"); sb.append("homePageFiltering"); sb.append(homePageFiltering); return sb.toString(); } } And this is the BaseManagedBean, inheriting the AbstractMutable. import java.io.IOException; import java.io.OutputStream; import java.util.List; import javax.faces.application.FacesMessage; import javax.faces.application.FacesMessage.Severity; import javax.faces.context.FacesContext; import javax.servlet.http.HttpServletResponse; import org.apache.commons.lang.ArrayUtils; import org.jboss.seam.core.AbstractMutable; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.myproj.common.exceptions.WebException; import com.myproj.common.util.FileUtils; import com.myproj.common.util.StringUtils; import com.myproj.web.messages.Messages; public abstract class BaseManagedBean extends AbstractMutable { private static final Logger logger = LoggerFactory .getLogger(BaseManagedBean.class); private FacesContext facesContext; /** * Set a message to be displayed for a specific component. * * @param resourceBundle * the resource bundle where the message appears. Either base or * id may be used. * @param summaryResourceId * the id of the resource to be used as summary. For the detail * of the element, the element to be used will be the same with * the suffix {@code _detail}. * @param parameters * the parameters, in case the string is parameterizable * @param severity * the severity of the message * @param componentId * the component id for which the message is destined. Note that * an appropriate JSF {@code <h:message for="myComponentId">} tag * is required for the to appear, or alternatively a {@code * <h:messages>} tag. */ protected void setMessage(String resourceBundle, String summaryResourceId, List<Object> parameters, Severity severity, String componentId, Messages messages) { FacesContext context = getFacesContext(); FacesMessage message = messages.getMessage(resourceBundle, summaryResourceId, parameters); if (severity != null) { message.setSeverity(severity); } context.addMessage(componentId, message); } /** * Copies a byte array to the response output stream with the appropriate * MIME type and content disposition. The response output stream is closed * after this method. * * @param response * the HTTP response * @param bytes * the data * @param filename * the suggested file name for the client * @param mimeType * the MIME type; will be overridden if the filename suggests a * different MIME type * @throws IllegalArgumentException * if the data array is <code>null</code>/empty or both filename * and mimeType are <code>null</code>/empty */ protected void printBytesToResponse(HttpServletResponse response, byte[] bytes, String filename, String mimeType) throws WebException, IllegalArgumentException { if (response.isCommitted()) { throw new WebException("HTTP response is already committed"); } if (ArrayUtils.isEmpty(bytes)) { throw new IllegalArgumentException("Data buffer is empty"); } if (StringUtils.isEmpty(filename) && StringUtils.isEmpty(mimeType)) { throw new IllegalArgumentException( "Filename and MIME type are both null/empty"); } // Set content type (mime type) String calculatedMimeType = FileUtils.getMimeType(filename); // not among the known ones String newMimeType = mimeType; if (calculatedMimeType == null) { // given mime type passed if (mimeType == null) { // none available put default mime-type newMimeType = "application/download"; } else { if ("application/octet-stream".equals(mimeType)) { // small modification newMimeType = "application/download"; } } } else { // calculated mime type has precedence over given mime type newMimeType = calculatedMimeType; } response.setContentType(newMimeType); // Set content disposition and other headers String contentDisposition = "attachment;filename=\"" + filename + "\""; response.setHeader("Content-Disposition", contentDisposition); response.setHeader("Expires", "0"); response.setHeader("Cache-Control", "max-age=30"); response.setHeader("Pragma", "public"); // Set content length response.setContentLength(bytes.length); // Write bytes to response OutputStream out = null; try { out = response.getOutputStream(); out.write(bytes); } catch (IOException e) { throw new WebException("Error writing data to HTTP response", e); } finally { try { out.close(); } catch (Exception e) { logger.error("Error closing HTTP stream", e); } } } /** * Retrieve a session-scoped managed bean. * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected Object getSessionBean(String sessionBeanName) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { throw new IllegalArgumentException("No such object in Session"); } else { return sessionScopedBean; } } /** * Set a session-scoped managed bean * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected boolean setSessionBean(String sessionBeanName, Object sessionBean) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { FacesContext.getCurrentInstance().getExternalContext() .getSessionMap().put(sessionBeanName, sessionBean); } else { throw new IllegalArgumentException( "This session-scoped bean was already initialized"); } return true; } /** * For testing (enables mock of FacesContext) * * @return the faces context */ public FacesContext getFacesContext() { if (facesContext == null) { return FacesContext.getCurrentInstance(); } return facesContext; } /** * For testing (enables mocking of FacesContext). * * @param aFacesContext * a - possibly mock - faces context. */ public void setFacesContext(FacesContext aFacesContext) { this.facesContext = aFacesContext; } }

    Read the article

  • Getting minimum - Min() - for DateTime column in a DataTable using LINQ to DataSets?

    - by Jay Stevens
    I need to get the minimum DateTime value of a column in a DataTable. The DataTable is generated dynamically from a CSV file, therefore I don't know the name of that column until runtime. Here is code I've got that doesn't work... private DateTime GetStartDateFromCSV(string inputFile, string date_attr) { EnumerableRowCollection<DataRow> table = CsvStreamReader.GetDataTableFromCSV(inputFile, "input", true).AsEnumerable(); DateTime dt = table.Select(record => record.Field<DateTime>(date_attr)).Min(); return dt; } The variable table is broken out just for clarity. I basically need to find the minimum value as a DateTime for one of the columns (to be chosen at runtime and represented by date_attr). I have tried several solutions from SO (most deal with known columns and/or non-DateTime fields). What I've got throws an error at runtime telling me that it can't do the DateTime conversion (that seems to be a problem with Linq?) I've confirmed that the data for the column name that is in the string date_attr is a date value.

    Read the article

  • Accessing frame info in gdb

    - by Maelstrom
    In gdb, is there a way to access the contents of info frame in a script? I'm debugging a problem somewhere between Apache, PHP, APC and my own code, and I have about a hundred cores to choose from. Following the instructions here http://bugs.php.net/bugs-generating-backtrace.php I end up with a stacktrace like: #0 0x0121a31a in do_bind_function (opline=0xa94dd750, function_table=0x9b9cf98, compile_time=0 '\0') at /usr/src/debug/php-5.2.7/Zend/zend_compile.c:2407 #1 0x0124bb2e in ZEND_DECLARE_FUNCTION_SPEC_HANDLER (execute_data=0xbfef7990) at /usr/src/debug/php-5.2.7/Zend/zend_vm_execute.h:498 #2 0x01249dfa in execute (op_array=0xb79d5d3c) at /usr/src/debug/php-5.2.7/Zend/zend_vm_execute.h:92 #3 0x01261e31 in ZEND_INCLUDE_OR_EVAL_SPEC_VAR_HANDLER (execute_data=0xbfef80d0) at /usr/src/debug/php-5.2.7/Zend/zend_vm_execute.h:7809 #4 0x01249dfa in execute (op_array=0xb79d55ec) at /usr/src/debug/php-5.2.7/Zend/zend_vm_execute.h:92 ... #26 0x09caa894 in ?? () #27 0x00000000 in ?? () The stack will always look similar, with function execute and ZEND_something interleaved several times. I need to go up to the last instance of execute (up 2 in this case) and print myVar. Obviously gdb knows the function names, but does it surface them in any user variables I could access? Typing frame 2 shows a one-line version, and info frame shows a single stackframe in detail. I want to do something like while ($current_frame.function_name != "execute") {up;} print myVar but I don't see how to do it strictly within gdb. Is there a variable / structure / special memory location / something that allows access to gdb's information on either the whole stack (like bt) or to the current stack frame (like info frame)?

    Read the article

  • Scalaz: request for use case for Cokleisli composition

    - by oxbow_lakes
    This question isn't meant as flame-bait! As it might be apparent, I've been looking at Scalaz recently. I'm trying to understand why I need some of the functionality that the library provides. Here's something: import scalaz._ import Scalaz._ type NEL[A] = NonEmptyList[A] val NEL = NonEmptyList I put some println statements in my functions to see what was going on (aside: what would I have done if I was trying to avoid side effects like that?). My functions are: val f: NEL[Int] => String = (l: NEL[Int]) => {println("f: " + l); l.toString |+| "X" } val g: NEL[String] => BigInt = (l: NEL[String]) => {println("g: " + l); BigInt(l.map(_.length).sum) } Then I combine them via a cokleisli and pass in a NEL[Int] val k = cokleisli(f) =>= cokleisli(g) println("RES: " + k( NEL(1, 2, 3) )) What does this print? f: NonEmptyList(1, 2, 3) f: NonEmptyList(2, 3) f: NonEmptyList(3) g: NonEmptyList(NonEmptyList(1, 2, 3)X, NonEmptyList(2, 3)X, NonEmptyList(3)X) RES: 57 The RES value is the character count of the (String) elements in the final NEL. Two things occur to me: How could I have known that my NEL was going to be reduced in this manner from the method signatures involved? (I wasn't expecting the result at all) What is the point of this? Can a reasonably simple and easy-to-follow use case be distilled for me? This question is a thinly-veiled plea for some lovely person like retronym to explain how this powerful library actually works.

    Read the article

  • jQuery Autocomplete Json Ajax cross browser issue with Google Search Appliance

    - by skyfoot
    I am implementing a jquery autocomplete on a search form and am getting the suggestions from the Google Search Appliance Autocomple suggestions service which returns a result set in json. What I am trying to do is go off to the GSA to get suggestions when the user types something in the search box. The url to get the json suggestions is as follows: http://gsaurl/suggest?q=<query>&max=10&site=default_site&client=default_frontend&access=p&format=rich The json which is returned is as follows: { "query":"re", "results": [ {"name":"red", "type":"suggest"}, {"name":"read", "type":"suggest"}] } The jQuery autocomplete code is as follows: $(#q).autocomplete(searchUrl, { width: 320, dataType: 'json', highlight: false, scroll: true, scrollHeight: 300, parse: function(data) { var array = new Array(); for(var i=0;i<data.results.length;i++) { array[i] = { data: data.results[i], value: data.results[i].name, result: data.results[i].name }; } return array; }, formatItem: function(row) { return row.name; } }); This works in IE but fails in firefox as the data returned in the parse function is null. Any ideas why this would be the case? Workaround I created an aspx page to call the GSA suggest service and to return the json from the suggest service. Using this page as a proxy and setting it as the url in the jQuery autocomplete worked in both IE and FireFox.

    Read the article

  • How do I detect if there is already a similar document stored in Lucene index.

    - by Jenea
    Hi. I need to exclude duplicates in my database. The problem is that duplicates are not considered exact match but rather similar documents. For this purpose I decided to use FuzzyQuery like follows: var fuzzyQuery = new global::Lucene.Net.Search.FuzzyQuery( new Term("text", queryText), 0.8f, 0); hits = _searcher.Search(query); The idea was to set the minimal similarity to 0.8 (that I think is high enough) so only similar documents will be found excluding those that are not sufficiently similar. To test this code I decided to see if it finds already existing document. To the variable queryText was assigned a value that is stored in the index. The code from above found nothing, in other words it doesn't detect even exact match. Index was build by this code: doc.Add(new global::Lucene.Net.Documents.Field( "text", text, global::Lucene.Net.Documents.Field.Store.YES, global::Lucene.Net.Documents.Field.Index.TOKENIZED, global::Lucene.Net.Documents.Field.TermVector.WITH_POSITIONS_OFFSETS)); I followed recomendations from bellow and the results are: TermQuery doesn't return any result. Query contructed with var _analyzer = new RussianAnalyzer(); var parser = new global::Lucene.Net.QueryParsers .QueryParser("text", _analyzer); var query = parser.Parse(queryText); var _searcher = new IndexSearcher (Settings.General.Default.LuceneIndexDirectoryPath); var hits = _searcher.Search(query); Returns several results with the maximum score the document that has exact match and other several documents that have similar content.

    Read the article

  • Payapl sandbox a/c in Dotnet..IPN Response Invaild

    - by Sam
    Hi, I am Integrating paypal to mysite.. i use sandbox account,One Buyer a/c and one more for seller a/c...and downloaded the below code from paypal site string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } and when add this snippets in pageload event of success page i get the ipn response as INVALID but amount paid successfully but i am getting invalid..any help..Paypal Docs in not Clear. thanks in advance

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Vertical-Align: A Full Explanation

    - by Livvy Jeffs
    I've been struggling with vertical alignments, a seemingly simple enough process that has a lot of idiosyncrasies throughout different languages and element types. I've done a lot of reading through stackexchange and can't seem to find a common thread of understanding. Here are the rules that I have been able to gather: 1) Vertical-align does not work in <\div>s, you have to set div {display: table-cell; vertical-align: middle} This seems like a big hassle, especially since table-cells override the height limitation even when overflow is set to hidden and expands to fit content, which means the vertical "center" is variable. I just read some source-code from Pinterest where button {vertical-align: middle}, but no other vertical-align commands seem to work. It seems as if button is by default aligned in the middle. Can someone provide a clear explanation for the vertical-align attribute? What html elements respond to vertical-align? Which html elements have default vertical-align attributes? Which html elements have non-overridable vertical-align attributes? And any clues as to understanding the idiosyncracies would help as well! Thanks in advance!

    Read the article

  • CSS Menu disappear

    - by WtFudgE
    Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

    Read the article

  • AS3 microphone recording/saving works, in-flash PCM playback double speed

    - by Lowgain
    I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

    Read the article

  • Using both chunked transfer encoding and gzip

    - by RadiantHeart
    I recently started using gzip on my site and it worked like charm on all browsers except Opera which gives an error saying it could not decompress the content due to damaged data. From what I can gather from testing and googling it might be a problem with using both gzip and chunked transfer encoding. The fact that there is no error when requesting small files like css-files also points in that direction. Is this a known issue or is there something else that I havent thought about? Someone also mentioned that it could have something to do with sending a Content-Length header. Here is a simplified version of the most relevant part of my code: $contents = ob_get_contents(); ob_end_clean(); header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); print($contents); exit();

    Read the article

  • Fck editor problem

    - by Josemalive
    Hi, Im using FCK Editor control instead a textarea element. I installed it without problems. But when i want to validate it with a Custom validator of ASP.Net 2.0, im not getting the result expected. These lines are the code that i have: <textarea style="width:30px;height:20px;" class="ckeditor" id="txtdescription" runat="server" name="txtdescription" cols="5" rows="10"></textarea> <asp:CustomValidator id="descval" runat="server" ControlToValidate="txtdescription" EnableClientScript="true" Enabled="true" ValidateEmptyText="true" Display="Dynamic" ClientValidationFunction="ValidateTextDesc" Text="*" ErrorMessage="*"/> <asp:Button ID="buttonadd" runat="server" Text="Add text" OnClick="buttonadd_Click" /> And my javascript code that executes the CustomValidator client function is: function ValidateTextDesc(source, args) { var descriptiontext = document.getElementById("txtdescription"); if ((descriptiontext.value.indexOf("<script") != -1) || (descriptiontext.value.length==0)) { args.IsValid=false; } else { args.IsValid = true; } return args.IsValid; } My problem is that i have to click twice my submit button to execute this Client function: Do you know why this issue is happening? Thanks in advance. Regards. Josema.

    Read the article

  • SoundManager / Jquery : Get SoundID sID

    - by j-man86
    So I am trying to access a jquery soundmanager variable from one script (wpaudio.js – from the wp-audio plugin) inside of another (init.js – my own javascript). I am creating an alternate pause/play button higher up on the page and need to resume the current soundID, which is contained as part of a class name in the DOM. Here is the code that creates that class name in wpaudio.js: function wpaButtonCheck() { if (!this.playState || this.paused) jQuery('#' + this.sID + '_play').attr('src', wpa_url + '/wpa_play.png'); else jQuery('#' + this.sID + '_play').attr('src', wpa_url + '/wpa_pause.png'); } Here is the output: <img src="http://24.232.185.173/wordpress/wp-content/plugins/wpaudio-mp3-player/wpa_play.png" class="wpa_play" id="wpa0_play"> where wpa0 would be the sID of the sound I need. My current script in init.js is: $('.mixesSidebar #currentSong .playBtn').toggle(function() { soundManager.pauseAll(); $(this).addClass('paused'); }, function() { soundManager.resumeAll(); $(this).removeClass('paused'); }); I need to change resumeAll to "resume(this.sID)", but I need to somehow store the sID onclick and call it in the above function. Alternately, I think a regular expression that could get the class name of the current play button and either parse the string up to the "_play" or use a trim function to get rid of "_play"– but I'm not sure how to do this. Thanks for your help!

    Read the article

  • CURL & web.py: transfer closed with outstanding read data remaining

    - by Richard J
    Hi Folks, I have written a web.py POST handler, thus: import web urls = ('/my', 'Test') class Test: def POST(self): return "Here is your content" app = web.application(urls, globals()) if __name__ == "__main__": app.run() When I interact with it using Curl from the command line I get different responses depending on whether I post it any data or not: curl -i -X POST http://localhost:8080/my HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:42:41 GMT Server: CherryPy/3.1.2 WSGI Server Here is your content (Posting of no data to the server gives me back the "Here is your content" string) curl -i -X POST --data-binary "@example.zip" http://localhost:8080/my HTTP/1.1 100 Content-Length: 0 Content-Type: text/plain HTTP/1.1 200 OK Transfer-Encoding: chunked Date: Thu, 06 Jan 2011 16:43:47 GMT Server: CherryPy/3.1.2 WSGI Server curl: (18) transfer closed with outstanding read data remaining (Posting example.zip to the server results in this error) I've scoured the web.py documentation (what there is of it), and can't find any hints as to what might be going on here. Possibly something to do with 100 continue? I tried writing a python client which might help clarify: h1 = httplib.HTTPConnection('localhost:8080') h1.request("POST", "http://localhost:8080/my", body, headers) print h1.getresponse() body = the contents of the example.zip, and headers = empty dictionary. This request eventually timed out without printing anything, which I think exonerates curl from being the issue, so I believe something is going on in web.py which isn't quite right (or at least not sufficiently clear) Any web.py experts got some tips? Cheers, Richard

    Read the article

  • "echo" in functions or "echo" all page?

    - by jasmine
    Is this a good method to save to all index in a variable and then echo this? for example <?php $txt='<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-9" /> <link rel="stylesheet" type="text/css" href="css/style.css"/> <title>Untitled Document</title> </head> <body> <div class="wrapper"> <div class="header"> <h2>'.heaf_func().'</h2> </div> <div class="content">content</div> <div class="footer">footer</div> </div> </body> </html>'; echo $txt; ?>

    Read the article

  • Singleton with inheritance, Derived class is not able to get instantiated in parent?

    - by yesraaj
    Below code instantiates a derived singleton object based on environment variable. The compiler errors saying error C2512: 'Dotted' : no appropriate default constructor. I don't understand what the compiler is complaining about. #include <stdlib.h> #include <iostream> #include <string> using namespace std; class Dotted; class Singleton{ public: static Singleton instant(){ if (!instance_) { char * style = getenv("STYLE"); if (!style){ if (strcmp(style,"dotted")==0) { instance_ = new Dotted(); return *instance_; } } else{ instance_ = new Singleton(); return *instance_; } } return *instance_; } void print(){cout<<"Singleton";} ~Singleton(){}; protected: Singleton(){}; private: static Singleton * instance_; Singleton(const Singleton & ); void operator=(const Singleton & ); }; class Dotted:public Singleton{ public: void print(){cout<<"Dotted";} protected: Dotted(); }; Dotted::Dotted():Singleton(){} int main(){ Singleton::instant().print(); cin.get(); }

    Read the article

  • funny behavior of jquery code

    - by user253530
    Funny thing is that if i delete the comment for alert(data[i].id) the code works. As it is in the example, the string is not concatenated thus i have no options in the select box. Hints? Help? var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(data){ for(var i = 0; i < data.length; i++){ //alert( data[i].id); bookmarkingSites += '<option value = \"' + data[i].id + '\">' + data[i].title + '</option>'; } }); <some more code> -------> toAppend += '<td><select name="sb2" id="sb2">'+ '<option value="'+ data.results[i].bookmark +'">' + data.results[i].bookmark +'</option>' + bookmarkingSites + '</select></td>'; <some more code>

    Read the article

  • Python with Wiimote using pywiiuse module

    - by Anon
    After seeing the abilities and hackibility of wiimotes I really want to use it in my 'Intro to programming' final. Everyone must make a python program and present it to the class. I want to make a game with pygame incorporating a wiimote. I found pywiiuse which is a very basic wrapper for the wiiuse library using c types. I can NOT get anything beyond LEDs and vibrating to work. Buttons, IR, motion sensing, nothing. I've tried different versions of wiiuse, pywiiuse, even python. I can't even get the examples that came with it to run. Here's the code I made as a simple test. I copied some of the example C++ code. from pywiiuse import * from time import sleep #Init wiimotes = wiiuse_init() #Find and start the wiimote found = wiiuse_find(wiimotes,1,5) #Make the variable wiimote to the first wiimote init() found wiimote = wiimotes.contents #Set Leds wiiuse_set_leds(wiimote,WIIMOTE_LED_1) #Rumble for 1 second wiiuse_rumble(wiimote,1) sleep(1) wiiuse_rumble(wiimote,0) #Turn motion sensing on(supposedly) wiiuse_motion_sensing(wiimote,1) while 1: #Poll the wiimotes to get the status like pitch or roll if(wiiuse_poll(wiimote,1)): print 'EVENT' And here's the output when I run it. wiiuse version 0.9 wiiuse api version 8 [INFO] Found wiimote [assigned wiimote id 1]. EVENT EVENT Traceback (most recent call last): File "C:\Documents and Settings\Nick\Desktop\wiimotetext.py", line 26, in <mod ule> if(wiiuse_poll(wiimote,1)): WindowsError: exception: access violation reading 0x00000004 It seems each time I run it, it prints out EVENT 2-5 times until the trace back. I have no clue what to do at this point, I've been trying for the past two days to get it working. Thanks!

    Read the article

  • JAVASCRIPT changing on click

    - by Webby
    Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

    Read the article

  • Accessing the selected element inside a templated textblock bound to a wpf listbox

    - by black sensei
    Hello good people , i'm trying to achieve a functionality but i'm don't know how to start it. I'm using vs 2008 sp1 and i'm consuming a webservice which returns a collection (is contactInfo[]) that i bind to a ListBox with little datatemplate on it. <ListBox Margin="-146,-124,-143,-118.808" Name="contactListBox" MaxHeight="240" MaxWidth="300" MinHeight="240" MinWidth="300"> <ListBox.ItemTemplate> <DataTemplate> <TextBlock> <CheckBox Name="contactsCheck" Uid="{Binding fullName}" Checked="contacts_Checked" /><Label Content="{Binding fullName}" FontSize="15" FontWeight="Bold"/> <LineBreak/> <Label Content="{Binding mobile}" FontSize="10" FontStyle="Italic" Foreground="DimGray" /> <Label Content="{Binding email}" FontStyle="Italic" FontSize="10" Foreground="DimGray"/> </TextBlock> </DataTemplate> </ListBox.ItemTemplate> </ListBox> Every works fine so far. so When a checkbox is checked i'll like to access the information of the labels (either the) belonging to the same row or attached to it and append the information to a global variable for example (for each checkbox checked). My problem right now is that i don't know how to do that. Can any one shed some light on how to do that? if you notice Checked="contacts_Checked" that's where i planned to perform the operations. thanks for reading and helping out

    Read the article

  • Java: volatile guarantees and out-of-order execution

    - by WizardOfOdds
    Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

    Read the article

  • PHP, We have sessions, and cookies....I love cookies, but they are blowing my mind right now.

    - by Matt
    I am not sure how to go about accessing the variable I need to set on a cookie... I was thinking about using the $_POST global but I dont know how based on my design if it will work. I am using a master page type design seperating index.php from my function includes and database information and individual pages (that will be returned to an include in index.php based on a $_GET) Okay so back to my question. What is the most efficient way to set a cookie on a design that has a main page that everything will branch from. How would I pull the value. Is $_POST a good enough way to go about it? Also...by saying it must be the first thing sent...does that mean I cannot run any serverside scripts before that? I could definately utilize a login query I think but I dont want to write code just to be dissapointed based on my lack of time and knowledge. I did search for answers...I know this most likely feels like a generic question that could be answered in a difference place...but I know I will get an accurate and professional answer here...so I dont want to bet on the half answers I found otherwise. Of course I will sanitize everything and not store any sensitive information (passwords,address,phone,or anything really for that matter besides some kind of session ID and the username) If this is confusing I am sorry but I am on a gov computer...and they lock these tighter than ft knox...so getting my code on here will be a chore until I get back to my room. Thanks, Matt

    Read the article

  • Custom Validation Attribute with Custom Model Binder in MVC 2

    - by griegs
    I apologise for the amount of code I have included. I've tried to keep it to a minimum. I'm trying to have a Custom Validator Attribute on my model as well as a Custom Model binder. The Attribute and the Binder work great seperately but if I have both, then the Validation Attribute no longer works. Here is my code snipped for readability. If I leave out the code in global.asax the custom validation fires but not if I have the custom binder enabled. Validation Attribute; public class IsPhoneNumberAttribute : ValidationAttribute { public override bool IsValid(object value) { //do some checking on 'value' here return true; } } Useage of the attribute in my model; [Required(ErrorMessage = "Please provide a contact number")] [IsPhoneNumberAttribute(ErrorMessage = "Not a valid phone number")] public string Phone { get; set; } Custom Model Binder; public class CustomContactUsBinder : DefaultModelBinder { protected override void OnModelUpdated(ControllerContext controllerContext, ModelBindingContext bindingContext) { ContactFormViewModel contactFormViewModel = bindingContext.Model as ContactFormViewModel; if (!String.IsNullOrEmpty(contactFormViewModel.Phone)) if (contactFormViewModel.Phone.Length > 10) bindingContext.ModelState.AddModelError("Phone", "Phone is too long."); } } Global asax; System.Web.Mvc.ModelBinders.Binders[typeof(ContactFormViewModel)] = new CustomContactUsBinder();

    Read the article

< Previous Page | 605 606 607 608 609 610 611 612 613 614 615 616  | Next Page >