Search Results

Search found 18626 results on 746 pages for 'nicholas key'.

Page 61/746 | < Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >

  • Add new row in a databound form with a Oracle Sequence as the primary key

    - by Ranhiru
    I am connecting C# with Oracle 11g. I have a DataTable which i fill using an Oracle Data Adapter. OracleDataAdapter da; DataTable dt = new DataTable(); da = new OracleDataAdapter("SELECT * FROM Author", con); da.Fill(dt); I have few text boxes that I have databound to various rows in the data table. txtAuthorID.DataBindings.Add("Text", dt, "AUTHORID"); txtFirstName.DataBindings.Add("Text", dt, "FIRSTNAME"); txtLastName.DataBindings.Add("Text", dt, "LASTNAME"); txtAddress.DataBindings.Add("Text", dt, "ADDRESS"); txtTelephone.DataBindings.Add("Text", dt, "TELEPHONE"); txtEmailAddress.DataBindings.Add("Text", dt, "EMAIL"); I also have a DataGridView below the Text Boxes, showing the contents of the DataTable. dgvAuthor.DataSource = dt; Now when I want to add a new row, i do bm.AddNew(); where bm is defined in Form_Load as BindingManagerBase bm; bm = this.BindingContext[dt]; And when the save button is clicked after all the information is entered and validated, i do this.BindingContext[dt].EndCurrentEdit(); try { da.Update(dt); } catch (Exception ex) { MessageBox.Show(ex.Message); } However the problem comes where when I usually enter a row to the database (using SQL Plus) , I use a my_pk_sequence.nextval for the primary key. But how do i specify that when i add a new row in this method? I catch this exception ORA-01400: cannot insert NULL into ("SYSMAN".AUTHOR.AUTHORID") which is obvious because nothing was specified for the primary key. How do get around this? Thanx a lot in advance :)

    Read the article

  • Key strokes in wpf window hosted in MFC ActiveX running in Internet Explorer

    - by user310046
    We have an MFC ActiveX control created in Visual Studio 2008 with CLR support which creates a WPF grid and shows a WPF window within that grid. This ActiveX is hosted within Internet Explorer and it shows up and works nicely except that the tab key, backspace, function keys etc. does not work since they are handeled by IE instead of the WPF window. Regular characters works nicely. This is a known feature and previously when we used to have MFC based dialogs within this ActiveX we used this: http://support.microsoft.com/kb/187988. By just using this code directly the AfxGetApp()->PreTranslateMessage((LPMSG)lParam) statement will return FALSE, so I'm not able to get the key stroke to be handled by the WPF window. I beleive I need to ask the WPF application this instead of the CWinApp, but I'm not sure how and if this can be done. Does anyone have enough understanding of what's going on here to get this to work? Using XBAP instead of ActiveX is not an option as this is run in an intranet application which needs more access than the sandbox can give us. I hope this is enough information. With best regards Svein Dybvik

    Read the article

  • I am not able to drop foreign key in mysql Error 150. Please help

    - by Shantanu Gupta
    i am trying to create a foreign key in my table. But when i executes my query it shows me error 150 Error Code : 1005 Can't create table '.\vts#sql-6ec_1.frm' (errno: 150) (0 ms taken) My Queries are Query to create a foreign Key alter table `vts`.`tblguardian` add constraint `FK_tblguardian` FOREIGN KEY (`GuardianPickPointId`) REFERENCES `tblpickpoint` (`PickPointId`) EDIT: Now I am trying to drop this constraint But it fails again and shows me same error as it was giving when i was trying to create foreign key. alter table `vts`.`tblguardian` drop index `FK_tblguardian` Primary Key table CREATE TABLE `tblpickpoint` ( `PickPointId` int(4) NOT NULL auto_increment, `PickPointName` varchar(500) default NULL, `PickPointLabel` varchar(500) default NULL, `PickPointLatLong` varchar(100) NOT NULL, PRIMARY KEY (`PickPointId`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 CHECKSUM=1 DELAY_KEY_WRITE=1 ROW_FORMAT=DYNAMIC Foreign Key Table CREATE TABLE `tblguardian` ( `GuardianId` int(4) NOT NULL auto_increment, `GuardianName` varchar(500) default NULL, `GuardianAddress` varchar(500) default NULL, `GuardianMobilePrimary` varchar(15) NOT NULL, `GuardianMobileSecondary` varchar(15) default NULL, `GuardianPickPointId` int(4) default NULL, PRIMARY KEY (`GuardianId`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1

    Read the article

  • entity framework - getting null exception using foreign key

    - by Nick
    Having some trouble with what should be a very simple scenario. For example purposes, I have two tables: -Users -Comments There is a one-to-many relationship set up for this; there is a foreign key from Comments.CommentorID to Users.UserID. When I do the LINQ query and try to bind to a DataList, I get a null exception. Here is the code: FKMModel.FKMEntities ctx = new FKMModel.FKMEntities(); IQueryable<Comment> CommentQuery = from x in ctx.Comment where x.SiteID == 101 select x; List<Comment> Comments = CommentQuery.ToList(); dl_MajorComments.DataSource = Comments; dl_MajorComments.DataBind(); In the ASPX page, I have the following as an ItemTemplate (I simplified it and took out the styling, etc, for purposes of posting here since it's irrelevant): <div> <%# ((FKMModel.Comment)Container.DataItem).FKMUser.Username %> <%# ((FKMModel.Comment)Container.DataItem).CommentDate.Value.ToShortDateString() %> <%# ((FKMModel.Comment)Container.DataItem).CommentTime %> </div> The exception occurs on the first binding (FKMUser.Username). Since the foreign key is set up, I should have no problem accessing any properties from the Users table. Intellisense set up the FKMUser navigation property and it knows the properties of that foreign table. What is going on here??? Thanks, Nick

    Read the article

  • jqGrid : "All in One" approach width jqGridEdit Class > how to set a composite primary key ?

    - by Qualliarys
    Hello, How to set a composite primary key for a "All in One" approach (grid defined in JS file, and data using jqGridEdit Class in php file) ? Please, for me a composite primary key of a table T, is a elementary primary key that is defined with some fields belong to this table T ! Here is my test, but i get no data and cannot use the CRUD operations : In my JS file i have this lines code: ... colModel":[ {"name":"index","index":"index","label":"index"}, // <= THAT'S JUST THE INDEX OF MY TABLE {"name":"user","index":"user","label":"user","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"pwd","index":"pwd","label":"pwd","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"state","index":"state","label":"state","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY ... <= AND SO ON "url":"mygrid_crud.php", "datatype":"json", "jsonReader":{repeatitems:false}, "editurl": "mygrid_crud.php", "prmNames":{"id":"index"} // <= WHAT I NEED TO WRITE HERE ??? ... In my php file (mygrid_crud.php) : ... $grid = new jqGridEdit($conn); $query = "SELECT * FROM mytable WHERE user='$user' and pwd='$pwd' and state='$state'..."; // <= SELECT * it's ok or i need to specify all fields i need ? $grid->SelectCommand = $query; $grid->dataType = "json"; $grid->table = 'mytable'; $grid->setPrimaryKeyId('index'); // <= WHAT I NEED TO WRITE HERE ??? ... $grid->editGrid(); Please, say me what is wrong, and how to do to set a composite primary key in this approach !? Thank you so much for tour responses.

    Read the article

  • TextArea being used as an itemEditor misbehaves when the enter key is pressed

    - by ChrisInCambo
    Hi, I have a TextArea inside an itemEditor component, the problem is that when typing in the TextArea if the enter key is pressed the itemEditor resets itself rather moving the caret to the next line as expected: <mx:List width="100%" editable="true" > <mx:dataProvider> <mx:ArrayCollection> <mx:Array> <mx:Object title="Stairway to Heaven" /> </mx:Array> </mx:ArrayCollection> </mx:dataProvider> <mx:itemRenderer> <mx:Component> <mx:Text height="100" text="{data.title}"/> </mx:Component> </mx:itemRenderer> <mx:itemEditor> <mx:Component> <mx:TextArea height="100" text="{data.title}"/> </mx:Component> </mx:itemEditor> </mx:List> </mx:Application> Could anyone advise how I can get around this strange behaviour and make the enter key behave as expected? Thanks, Chris

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • capture delete key in CListCtrl and do soem processing

    - by user333422
    Hi, I have a class which inherits from CListCtrl class, say class list. I have another class dlg, which inherits from CDialog. Class dlg contains an instance of class list. I have got a delete button in class dlg, on which I delete the selected item in listCtrl and do lots of other processing. I want the same functionality on delete key. I added OnKeyDown() fn is my class list, where I can capture VK_DELETE key. But my problem is that, how do I do otehr processing that I need to do in dialog class. All that processing is dlg class based not list class based. I have many such dlg classes with different data and in every dlg class processing is different. I tried capturing VK_DELETE in dialog class, but it doesn't capture it if focus is on list class. I am totally stuck and have no idea, how to do this. Please give me some idea how i can do this. Thanks, SG

    Read the article

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • How to test if a doctrine records has any relations that are used

    - by murze
    Hi, I'm using a doctrine table that has several optional relations (of types Doctrine_Relation_Association and Doctrine_Relation_ForeignKey) with other tables. How can I test if a record from that table has connections with records from the related table. Here is an example to make my question more clear. Assume that you have a User and a user has a many to many relation with Usergroups and a User can have one Userrole How can I test if a give user is part of any Usergroups or has a role. The solution starts I believe with $relations = Doctrine_Core::getTable('User')->getRelations(); $user = Doctrine_Core::getTable('User')->findOne(1); foreach($relations as $relation) { //here should go a test if the user has a related record for this relation if ($relation instanceof Doctrine_Relation_Association) { //here the related table probably has more then one foreign key (ex. user_id and group_id) } if ($relation instanceof Doctrine_Relation_ForeignKey) { //here the related table probably has the primary key of this table (id) as a foreign key (user_id) } } //true or false echo $result I'm looking for a general solution that will work no matter how many relations there are between user and other tables. Thanks!

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • Load PEM encoded private RSA key in Crypto++

    - by 01100110
    Often times, user will have PEM encoded RSA private keys. Crypto++ requires that these keys be in DER format to load. I've been asking people to manually convert their PEM files to DER beforehand using openssl like this: openssl pkcs8 -in in_file.pem -out out_file.der -topk8 -nocrypt -outform der That works fine, but some people don't understand how to do that nor do they want to. So I would like to convert PEM files to DER files automatically within the program. Is it as simple as striping the "-----BEGIN CERTIFICATE-----" and "-----END CERTIFICATE-----" from the PEM or is some other transformation required as well? I've been told that between those markers that it's just b64 encoded DER. Here's some code that demonstrates the issue: // load the private key CryptoPP::RSA::PrivateKey PK; CryptoPP::ByteQueue bytes; try { CryptoPP::FileSource File( rsa.c_str(), true, new CryptoPP::Base64Decoder() ); File.TransferTo( bytes ); bytes.MessageEnd(); // This line Causes BERDecodeError when a PEM encoded file is used PK.Load( bytes ); } catch ( CryptoPP::BERDecodeErr ) { // Convert PEM to DER and try to load the key again } I'd like to avoid making system calls to openssl and do the transformation entirely in Crypto++ so that users can provide either format and things "just work". Thanks for any advice.

    Read the article

  • "Special case" records for foreign key constraints

    - by keithjgrant
    Let's say I have a mysql table, called foo with a foreign key option_id constrained to the option table. When I create a foo record, the user may or may not have selected an option, and 'no option' is a viable selection. What is the best way to differentiate between 'null' (i.e. the user hasn't made a selection yet) and 'no option' (i.e. the user selected 'no option')? Right now, my plan is to insert a special record into the option table. Let's say that winds up with an id of 227 (this table already has a number of records at this point, so '1' isn't available). I have no need to access this record at a database level, and it would act as nothing more than a placeholder that the foreign key in the foo table can reference. So do I just hard-code '227' in my codebase when I'm creating 'foo' records where the user has selected 'no option'? The hard-coded id seems sloppy, and leaves room for error as the code is maintained down the road, but I'm not really sure of another approach.

    Read the article

  • Going "behind Hibernate's back" to update foreign key values without an associated entity

    - by Alex Cruise
    Updated: I wound up "solving" the problem by doing the opposite! I now have the entity reference field set as read-only (insertable=false updatable=false), and the foreign key field read-write. This means I need to take special care when saving new entities, but on querying, the entity properties get resolved for me. I have a bidirectional one-to-many association in my domain model, where I'm using JPA annotations and Hibernate as the persistence provider. It's pretty much your bog-standard parent/child configuration, with one difference being that I want to expose the parent's foreign key as a separate property of the child alongside the reference to a parent instance, like so: @Entity public class Child { @Id @GeneratedValue Long id; @Column(name="parent_id", insertable=false, updatable=false) private Long parentId; @ManyToOne(cascade=CascadeType.ALL) @JoinColumn(name="parent_id") private Parent parent; private long timestamp; } @Entity public class Parent { @Id @GeneratedValue Long id; @OrderBy("timestamp") @OneToMany(mappedBy="parent", cascade=CascadeType.ALL, fetch=FetchType.LAZY) private List<Child> children; } This works just fine most of the time, but there are many (legacy) cases when I'd like to put an invalid value in the parent_id column without having to create a bogus Parent first. Unfortunately, Hibernate won't save values assigned to the parentId field due to insertable=false, updatable=false, which it requires when the same column is mapped to multiple properties. Is there any nice way to "go behind Hibernate's back" and sneak values into that field without having to drop down to JDBC or implement an interceptor? Thanks!

    Read the article

  • Invoke Command When "ENTER" Key Is Pressed In XAML

    - by bitxwise
    I want to invoke a command when ENTER is pressed in a TextBox. Consider the following XAML: <UserControl ... xmlns:i="clr-namespace:System.Windows.Interactivity;assembly=System.Windows.Interactivity" ...> ... <TextBox> <i:Interaction.Triggers> <i:EventTrigger EventName="KeyUp"> <i:InvokeCommandAction Command="{Binding MyCommand}" CommandParameter="{Binding Text}" /> </i:EventTrigger> </i:Interaction.Triggers> </TextBox> ... </UserControl> and that MyCommand is as follows: public ICommand MyCommand { get { return new DelegateCommand<string>(MyCommandExecute); } } private void MyCommandExecute(string s) { ... } With the above, my command is invoked for every key press. How can I restrict the command to only invoke when the ENTER key is pressed? I understand that with Expression Blend I can use Conditions but those seem to be restricted to elements and can't consider event arguments. I have also come across SLEX which offers its own InvokeCommandAction implementation that is built on top of the Systems.Windows.Interactivity implementation and can do what I need. Another consideration is to write my own trigger, but I'm hoping there's a way to do it without using external toolkits.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Use MySQL trigger to update another table when duplicate key found

    - by Jason
    Been scratching my head on this one, hoping one of you kind people and direct me towards solving this problem. I have a mysql table of customers, it contains a lot of data, but for the purpose of this question, we only need to worry about 4 columns 'ID', 'Firstname', 'Lastname', 'Postcode' Problem is, the table contains a lot of duplicated customers. A new table is being created where each customer is unique and for us, we decide a unique customer is based on 'Firstname', 'Lastname' and 'Postcode' However, (this is the important bit) we need to ensure each new "unique" customer record also can be matched to the original multiple entries of that customer in the original table. I believe the best way to do this is to have a third table, that has 'NewUniqueID', 'OldCustomerID'. So we can search this table for 'NewUniqueID' = '123' and it would return multiple 'OldCustomerID' values where appropriate. I am hoping to make this work using a trigger and the on duplicate key syntax. So what would happen is as follows: An query is run taking the old customer table and inserting it in to the new unique table. (A standard Insert Select query) On duplicate key continue adding records, but add one entry in to the third table noting the 'NewUniqueID' that duped along with the 'OldCustomerID' of the record we were trying to insert. Hope this makes sense, my apologies if it isn't clear. I welcome and appreciate any thoughts on this one! Many thanks Jason

    Read the article

  • Handle BACK key event in child view

    - by Mick Byrne
    In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Displaying cookies as key=value for all domains?

    - by OverTheRainbow
    Hello, This question pertains to the use of the cookie-capable WebClient derived class presented in the How can I get the WebClient to use Cookies? question. I'd like to use a ListBox to... 1) display each cookie individually as "key=value" (the For Each loop displays all of them as one string), and 2) be able to display all cookies, regardless of the domain from which they came ("www.google.com", here): Imports System.IO Imports System.Net Public Class Form1 Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim webClient As New CookieAwareWebClient Const URL = "http://www.google.com" Dim response As String response = webClient.DownloadString(URL) RichTextBox1.Text = response 'How to display cookies as key/value in ListBox? 'PREF=ID=5e770c1a9f279d5f:TM=1274032511:LM=1274032511:S=1RDPaKJKpoMT9T54 For Each mycc In webClient.cc.GetCookies(New Uri(URL)) ListBox1.Items.Add(mycc.ToString) Next End Sub End Class Public Class CookieAwareWebClient Inherits WebClient Public cc As New CookieContainer() Private lastPage As String Protected Overrides Function GetWebRequest(ByVal address As System.Uri) As System.Net.WebRequest Dim R = MyBase.GetWebRequest(address) If TypeOf R Is HttpWebRequest Then With DirectCast(R, HttpWebRequest) .CookieContainer = cc If Not lastPage Is Nothing Then .Referer = lastPage End If End With End If lastPage = address.ToString() Return R End Function End Class Thank you.

    Read the article

  • Java RSA Encrypt using .NET XML Key File - need help

    - by badMonkey
    In .net I have generated the following public key file: <RSAKeyValue> <Modulus>xTSiS4+I/x9awUXcF66Ffw7tracsQfGCn6g6k/hGkLquHYMFTCYk4mOB5NwLwqczwvl8HkQfDShGcvrm47XHKUzA8iadWdA5n4toBECzRxiCWCHm1KEg59LUD3fxTG5ogGiNxDj9wSguCIzFdUxBYq5ot2J4iLgGu0qShml5vwk=</Modulus> <Exponent>AQAB</Exponent> .NET is happy to encrypt using it's normal methods. I am trying to use this key to encode a string in Java and am running into an Arithmetic problem (exception) when I attempt to encrypt the string. The following is the code I am using to encrypt: byte[] modulusBytes = Base64.decode(this.getString(R.string.public_key_modulus)); byte[] exponentBytes = Base64.decode(this.getString(R.string.public_key_exponent)); BigInteger modulus = new BigInteger( modulusBytes ); BigInteger exponent = new BigInteger( exponentBytes); RSAPublicKeySpec rsaPubKey = new RSAPublicKeySpec(modulus, exponent); KeyFactory fact = KeyFactory.getInstance("RSA"); PublicKey pubKey = fact.generatePublic(rsaPubKey); Cipher cipher = Cipher.getInstance("RSA"); cipher.init(Cipher.ENCRYPT_MODE, pubKey); byte[] cipherData = cipher.doFinal( new String("big kitty dancing").getBytes() ); It is the final line in the code block that fails. I have looked at numerous examples and this is the best I could come up with. If it is not obvious, the R.string.public_key_modulus is a copy/paste of the text in the Modulus element, same applies for exponent.

    Read the article

  • Loop through Array with conditional output based on key/value pair

    - by Daniel C
    I have an array with the following columns: Task Status I would like to print out a table that shows a list of the Tasks, but not the Status column. Instead, for Tasks where the Status = 0, I want to add a tag <del> to make the completed task be crossed out. Here's my current code: foreach ($row as $key => $val){ if ($key != 'Status') print "<td>$val</td>"; else if ($val == '0') print "<td><del>$val</del></td>"; } This seems to be correct, but when I print it out, it prints all the tasks with the <del> tag. So basically the "else" clause is being run every time. Here is the var_dump($row): array 'Task' => string 'Task A' (length=6) 'Status' => string '3' (length=1) array 'Task' => string 'Task B' (length=6) 'Status' => string '0' (length=1)

    Read the article

  • List all foreign key constraints that refer to a particular column in a specific table

    - by Sid
    I would like to see a list of all the tables and columns that refer (either directly or indirectly) a specific column in the 'main' table via a foreign key constraint that has the ON DELETE=CASCADE setting missing. The tricky part is that there would be an indirect relationships buried across up to 5 levels deep. (example: ... great-grandchild- FK3 = grandchild = FK2 = child = FK1 = main table). We need to dig up the leaf tables-columns, not just the very 1st level. The 'good' part about this is that execution speed isn't of concern, it'll be run on a backup copy of the production db to fix any relational issues for the future. I did SELECT * FROM sys.foreign_keys but that gives me the name of the constraint - not the names of the child-parent tables and the columns in the relationship (the juicy bits). Plus the previous designer used short, non-descriptive/random names for the FK constraints, unlike our practice below The way we're adding constraints into SQL Server: ALTER TABLE [dbo].[UserEmailPrefs] WITH CHECK ADD CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] FOREIGN KEY([UserId]) REFERENCES [dbo].[UserMasterTable] ([UserId]) ON DELETE CASCADE GO ALTER TABLE [dbo].[UserEmailPrefs] CHECK CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] GO The comments in this SO question inpire this question.

    Read the article

< Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >