Search Results

Search found 16800 results on 672 pages for 'alan long'.

Page 618/672 | < Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • How to tag photos in facebook-api?

    - by Camillo
    Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • Need help simplifying my php table

    - by user342391
    I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

  • problem to create session of facebook

    - by khoyendra
    try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

    - by Pickels
    Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • Will this ever result in a stack overflow error?

    - by David
    Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Change HttpContext.Request.InputStream

    - by user320478
    I am getting lot of errors for HttpRequestValidationException in my event log. Is it possible to HTMLEncode all the inputs from override of ProcessRequest on web page. I have tried this but it gives context.Request.InputStream.CanWrite == false always. Is there any way to HTMLEncode all the feilds when request is made? public override void ProcessRequest(HttpContext context) { if (context.Request.InputStream.CanRead) { IEnumerator en = HttpContext.Current.Request.Form.GetEnumerator(); while (en.MoveNext()) { //Response.Write(Server.HtmlEncode(en.Current + " = " + //HttpContext.Current.Request.Form[(string)en.Current])); } long nLen = context.Request.InputStream.Length; if (nLen > 0) { string strInputStream = string.Empty; context.Request.InputStream.Position = 0; byte[] bytes = new byte[nLen]; context.Request.InputStream.Read(bytes, 0, Convert.ToInt32(nLen)); strInputStream = Encoding.Default.GetString(bytes); if (!string.IsNullOrEmpty(strInputStream)) { List<string> stream = strInputStream.Split('&').ToList<string>(); Dictionary<int, string> data = new Dictionary<int, string>(); if (stream != null && stream.Count > 0) { int index = 0; foreach (string str in stream) { if (str.Length > 3 && str.Substring(0, 3) == "txt") { string textBoxData = str; string temp = Server.HtmlEncode(str); //stream[index] = temp; data.Add(index, temp); index++; } } if (data.Count > 0) { List<string> streamNew = stream; foreach (KeyValuePair<int, string> kvp in data) { streamNew[kvp.Key] = kvp.Value; } string newStream = string.Join("", streamNew.ToArray()); byte[] bytesNew = Encoding.Default.GetBytes(newStream); if (context.Request.InputStream.CanWrite) { context.Request.InputStream.Flush(); context.Request.InputStream.Position = 0; context.Request.InputStream.Write(bytesNew, 0, bytesNew.Length); //Request.InputStream.Close(); //Request.InputStream.Dispose(); } } } } } } base.ProcessRequest(context); }

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • C++ using cdb_read returns extra characters on some reads

    - by Moe Be
    Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

    Read the article

  • C strange array behaviour

    - by LukeN
    After learning that both strncmp is not what it seems to be and strlcpy not being available on my operating system (Linux), I figured I could try and write it myself. I found a quote from Ulrich Drepper, the libc maintainer, who posted an alternative to strlcpy using mempcpy. I don't have mempcpy either, but it's behaviour was easy to replicate. First of, this is the testcase I have #include <stdio.h> #include <string.h> #define BSIZE 10 void insp(const char* s, int n) { int i; for (i = 0; i < n; i++) printf("%c ", s[i]); printf("\n"); for (i = 0; i < n; i++) printf("%02X ", s[i]); printf("\n"); return; } int copy_string(char *dest, const char *src, int n) { int r = strlen(memcpy(dest, src, n-1)); dest[r] = 0; return r; } int main() { char b[BSIZE]; memset(b, 0, BSIZE); printf("Buffer size is %d", BSIZE); insp(b, BSIZE); printf("\nFirst copy:\n"); copy_string(b, "First", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); printf("\nSecond copy:\n"); copy_string(b, "Second", BSIZE); insp(b, BSIZE); printf("b = '%s'\n", b); return 0; } And this is its result: Buffer size is 10 00 00 00 00 00 00 00 00 00 00 First copy: F i r s t b = 46 69 72 73 74 00 62 20 3D 00 b = 'First' Second copy: S e c o n d 53 65 63 6F 6E 64 00 00 01 00 b = 'Second' You can see in the internal representation (the lines insp() created) that there's some noise mixed in, like the printf() format string in the inspection after the first copy, and a foreign 0x01 in the second copy. The strings are copied intact and it correctly handles too long source strings (let's ignore the possible issue with passing 0 as length to copy_string for now, I'll fix that later). But why are there foreign array contents (from the format string) inside my destination? It's as if the destination was actually RESIZED to match the new length.

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • Two loops speeds drawing in a Jframe

    - by noahn567
    I have a program that requires two classes. The player-Names class, and the Player-Model class. I want the player-Names class to repaint every half second, and the Player-Model class to repaint 60 times per second because i want the movement to be smooth. The problem that i am having is that i want all of this to be done on one J-frame. How would i go about doing this? If you could lead me in the right direction or give me a little example that would be great! Thank you :). for some reason it wont let me post so i'm going to put in some random code import java.awt.Color; import java.awt.Font; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.RenderingHints; import javax.swing.JComponent; import javax.swing.JFrame; public class PlayerNames extends JFrame { static int connectionTimer = 0; static int connectionTimer2 = 0; static int reconnect = 0; static int reconnectValue = 1; static int x = 0; static int reconnectWait = connectionTimer + reconnectValue; private static final long serialVersionUID = 1L; public graph gg = new graph(); public graph g = new graph(); private static GameClient socketClient; private GameServer socketServer; public static void main(int width, int height) { PlayerNames tt = new PlayerNames(); // PlayerGraphics t = new PlayerGraphics(); tt.setSize(width, height); if (Game.ServerOwner == 1) { tt.setTitle("Server: " + Game.username); } else { tt.setTitle("Username: " + Game.username); } tt.setVisible(true); tt.getContentPane().add(tt.gg); tt.getContentPane().add(tt.g); tt.setDefaultCloseOperation(EXIT_ON_CLOSE); tt.setResizable(false); }

    Read the article

  • ASP.Net MVC Ajax form with jQuery validation

    - by Tomas Lycken
    I have an MVC view with a form built with the Ajax.BeginForm() helper method, and I'm trying to validate user input with the jQuery Validation plugin. I get the plugin to highlight the inputs with invalid input data, but despite the invalid input the form is posted to the server. How do I stop this, and make sure that the data is only posted when the form validates? My code The form: <fieldset> <legend>leave a message</legend> <% using (Ajax.BeginForm("Post", new AjaxOptions { UpdateTargetId = "GBPostList", InsertionMode = InsertionMode.InsertBefore, OnSuccess = "getGbPostSuccess", OnFailure = "showFaliure" })) { %> <div class="column" style="width: 230px;"> <p> <label for="Post.Header"> Rubrik</label> <%= Html.TextBox("Post.Header", null, new { @style = "width: 200px;", @class="text required" }) %></p> <p> <label for="Post.Post"> Meddelande</label> <%= Html.TextArea("Post.Post", new { @style = "width: 230px; height: 120px;" }) %></p> </div> <p> <input type="submit" value="OK!" /></p> </fieldset> The JavaScript validation: $(document).ready(function() { // for highlight var elements = $("input[type!='submit'], textarea, select"); elements.focus(function() { $(this).parents('p').addClass('highlight'); }); elements.blur(function() { $(this).parents('p').removeClass('highlight'); }); // for validation $("form").validate(); }); EDIT: As I was getting downvotes for publishing follow-up problems and their solutions in answers, here is also the working validate method... function ajaxValidate() { return $('form').validate({ rules: { "Post.Header": { required: true }, "Post.Post": { required: true, minlength: 3 } }, messages: { "Post.Header": "Please enter a header", "Post.Post": { required: "Please enter a message", minlength: "Your message must be 3 characters long" } } }).form(); }

    Read the article

< Previous Page | 614 615 616 617 618 619 620 621 622 623 624 625  | Next Page >