Search Results

Search found 16278 results on 652 pages for 'fuzzy search'.

Page 624/652 | < Previous Page | 620 621 622 623 624 625 626 627 628 629 630 631  | Next Page >

  • What variable dictates position of non-focused elements in the roundabout plugin?

    - by kristina childs
    Part of the problem here is that i'm not sure what the best language to use in order to find the solution. I search and searched so please forgive if this is already a thread somewhere. I'm using the roundabout plugin to cycle through 3 divs. Each div is 794px wide, which makes the roundabout-in-focus element 794 and the two not in focus 315.218px wide, positioned so half of each is hidden by the in-focus div. This is all well and good, however the total width of the display needs to stay within 1000px (ideally 980px, but i can fudge if need be.) Basically I want to make the non-focused divs be 3/4 hidden by the in-focus div but for the life of me can't figure out what variables i need to edit in order to do it. Unfortunately it's not one of the many easily-changed options like z-index and minScale. i tried minScale but it's clear this isn't going to work. the plugin outputs this code: <li class="roundabout-moveable-item" style="position: absolute; left: -57px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i need to find out what changes the left positioning so it's shifted closer to the center of the stage, like this: <li class="roundabout-moveable-item" style="position: absolute; left: 5px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i tried playing with the positioning functions of the plugin but all that did was shift everything in tandem left or right. any help is greatly appreciated. this site is going to be awesome once i figure out all this jquery stuff! here is a link to my .js file: http://avalon.eaw.com/scripts/jquery.roundabout2.js i've got an overflow:hidden on the to help guide the positioning of those no-focused items.

    Read the article

  • Unable to add item to dataset in Linq to SQL

    - by Mike B
    I am having an issue adding an item to my dataset in Linq to SQL. I am using the exact same method in other tables with no problem. I suspect I know the problem but cannot find an answer (I also suspect all i really need is the right search term for Google). Please keep in mind this is a learning project (Although it is in use in a business) I have posted my code and datacontext below. What I am doing is: Create a view model (Relevant bits are shown) and a simple wpf window that allows editing of 3 properties that are bound to the category object. Category is from the datacontext. Edit works fine but add does not. If I check GetChangeSet() just before the db.submitChanges() call there are no adds, edits or deletes. I suspect an issue with the fact that a Category added without a Subcategory would be an orphan but I cannot seem to find the solution. Command code to open window: CategoryViewModel vm = new CategoryViewModel(); AddEditCategoryWindow window = new AddEditCategoryWindow(vm); window.ShowDialog(); ViewModel relevant stuff: public class CategoryViewModel : ViewModelBase { public Category category { get; set; } // Constructor used to Edit a Category public CategoryViewModel(Int16 categoryID) { db = new OITaskManagerDataContext(); category = QueryCategory(categoryID); } // Constructor used to Add a Category public CategoryViewModel() { db = new OITaskManagerDataContext(); category = new Category(); } } The code for saving changes: // Don't close window unless all controls are validated if (!vm.IsValid(this)) return; var changes = vm.db.GetChangeSet(); // DEBUG try { vm.db.SubmitChanges(ConflictMode.ContinueOnConflict); } catch (ChangeConflictException) { vm.db.ChangeConflicts.ResolveAll(RefreshMode.KeepChanges); vm.db.SubmitChanges(); } The Xaml (Edited fror brevity): <TextBox Text="{Binding category.CatName, Mode=TwoWay, ValidatesOnDataErrors=True, UpdateSourceTrigger=PropertyChanged}" /> <TextBox Text="{Binding category.CatDescription, ValidatesOnDataErrors=True, UpdateSourceTrigger=PropertyChanged}" /> <CheckBox IsChecked="{Binding category.CatIsInactive, Mode=TwoWay}" /> IssCategory in the Issues table is the old, text based category. This field is no longer used and will be removed from the database as soon as this is working and pushed live.

    Read the article

  • Moving from Windows to Ubuntu.

    - by djzmo
    Hello there, I used to program in Windows with Microsoft Visual C++ and I need to make some of my portable programs (written in portable C++) to be cross-platform, or at least I can release a working version of my program for both Linux and Windows. I am total newcomer in Linux application development (and rarely use the OS itself). So, today, I installed Ubuntu 10.04 LTS (through Wubi) and equipped Code::Blocks with the g++ compiler as my main weapon. Then I compiled my very first Hello World linux program, and I confused about the output program. I can run my program through the "Build and Run" menu option in Code::Blocks, but when I tried to launch the compiled application externally through a File Browser (in /media/MyNTFSPartition/MyProject/bin/Release; yes, I saved it in my NTFS partition), the program didn't show up. Why? I ran out of idea. I need to change my Windows and Microsoft Visual Studio mindset to Linux and Code::Blocks mindset. So I came up with these questions: How can I execute my compiled linux programs externally (outside IDE)? In Windows, I simply run the generated executable (.exe) file How can I distribute my linux application? In Windows, I simply distribute the executable files with the corresponding DLL files (if any) What is the equivalent of LIBs (static library) and DLLs (dynamic library) in linux and how to use them? In Windows/Visual Studio, I simply add the required libraries to the Additional Dependencies in the Project Settings, and my program will automatically link with the required static library(-ies)/DLLs. Is it possible to use the "binary form" of a C++ library (if provided) so that I wouldn't need to recompile the entire library source code? In Windows, yes. Sometimes precompiled *.lib files are provided. If I want to create a wxWidgets application in Linux, which package should I pick for Ubuntu? wxGTK or wxX11? Can I run wxGTK program under X11? In Windows, I use wxMSW, Of course. If question no. 4 is answered possible, are precompiled wxX11/wxGTK library exists out there? Haven't tried deep google search. In Windows, there is a project called "wxPack" (http://wxpack.sourceforge.net/) that saves a lot of my time. Sorry for asking many questions, but I am really confused on these linux development fundamentals. Any kind of help would be appreciated =) Thanks.

    Read the article

  • adding other parameter to function

    - by Ronnie Chester Lynwood
    hello. i got a function that listing downloads in a table with foreach. it's also lists searched term, search type. public function fetchDownloads($displaySite=true) { $downloads = array(); $sqlWhere = ""; if(isset($this->q)) { if(strlen($this->q) <= $this->recents_length && !empty($this->q)) { $insertRecent = $this->processDataHook("insertRecent",$this->q); if($insertRecent) { if(!@mysql_query("INSERT INTO wcddl_recents (query) VALUES ('".$this->qSQL."')")) { @mysql_query("UPDATE wcddl_recents SET searches = searches+1 WHERE query = '".$this->qSQL."'"); } } } if($this->search_type == "narrow") { $sqlWhere = " WHERE title LIKE '%".mysql_real_escape_string(str_replace(" ","%",$this->q))."%'"; } elseif($this->search_type == "wide") { $qExp = explode(" ",$this->q); $sqlWhere = array(); foreach($qExp as $fq) $sqlWhere[] = "title LIKE '%".mysql_real_escape_string($fq)."%'"; $sqlWhere = implode(" OR ",$sqlWhere); $sqlWhere = " WHERE (".$sqlWhere.")"; } } if(isset($this->type)) { if(!empty($sqlWhere)) { $sqlWhere .= " AND type = '".$this->typeSQL."'"; } else { $sqlWhere = " WHERE type = '".$this->typeSQL."'"; } } $sqlWhere = $this->processDataHook("fetchDownloadsSQLWhere",$sqlWhere); $this->maxPages = mysql_query("SELECT COUNT(*) FROM wcddl_downloads".$sqlWhere.""); $this->maxPages = mysql_result($this->maxPages,0); $this->numRows = $this->maxPages; $this->maxPages = ceil($this->maxPages/$this->limit); $sqlMain = "SELECT id,sid,title,type,url,dat,views,rating FROM wcddl_downloads".$sqlWhere." ORDER BY ".(isset($this->sqlOrder) ? mysql_real_escape_string($this->sqlOrder) : "id DESC")." LIMIT ".$this->pg.",".$this->limit.""; $sqlMain = $this->processDataHook("whileFetchDownloadsSQL",$sqlMain); $sqlMain = mysql_query($sqlMain); $this->processHook("whileFetchDownloads"); while($row = mysql_fetch_assoc($sqlMain)) { if($displaySite) { $downloadSite = mysql_query("SELECT name as sname, url as surl, rating as srating FROM wcddl_sites WHERE id = '".$row['sid']."'"); $downloadSite = mysql_fetch_assoc($downloadSite); $row = array_merge($row,$downloadSite); } $downloads_current = $this->mapit($row,array("stripslashes","strip_tags")); $downloads_current = $this->processDataHook("fetchDownloadsRow",$downloads_current); $downloads[] = $downloads_current; } $this->pageList = $this->getPages($this->page,$this->maxPages); $this->processHook("endFetchDownloads"); return $downloads; } I want to add if $_REQUEST['site'] is set, order downloads by sname that catching from wcddl_sites.

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Connection hangs after time of inactivity

    - by Sinuhe
    In my application, Spring manages connection pool for database access. Hibernate uses these connections for its queries. At first glance, I have no problems with the pool: it works correctly with concurrent clients and a pool with only one connection. I can execute a lot of queries, so I think that I (or Spring) don't leave open connections. My problem appears after some time of inactivity (sometimes 30 minutes, sometimes more than 2 hours). Then, when Hibernate does some search, it lasts too much. Setting log4j level to TRACE, I get this logs: ... 18:27:01 DEBUG nsactionSynchronizationManager - Retrieved value [org.springframework.orm.hibernate3.SessionHolder@99abd7] for key [org.hibernate.impl.SessionFactoryImpl@7d2897] bound to thread [http-8080-Processor24] 18:27:01 DEBUG HibernateTransactionManager - Found thread-bound Session [org.hibernate.impl.SessionImpl@8878cd] for Hibernate transaction 18:27:01 DEBUG HibernateTransactionManager - Using transaction object [org.springframework.orm.hibernate3.HibernateTransactionManager$HibernateTransactionObject@1b2ffee] 18:27:01 DEBUG HibernateTransactionManager - Creating new transaction with name [com.acjoventut.service.GenericManager.findByExample]: PROPAGATION_REQUIRED,ISOLATION_DEFAULT 18:27:01 DEBUG HibernateTransactionManager - Preparing JDBC Connection of Hibernate Session [org.hibernate.impl.SessionImpl@8878cd] 18:27:01 TRACE SessionImpl - setting flush mode to: AUTO 18:27:01 DEBUG JDBCTransaction - begin 18:27:01 DEBUG ConnectionManager - opening JDBC connection Here it gets frozen for about 2 - 10 minutes. But then continues: 18:30:11 DEBUG JDBCTransaction - current autocommit status: true 18:30:11 DEBUG JDBCTransaction - disabling autocommit 18:30:11 TRACE JDBCContext - after transaction begin 18:30:11 DEBUG HibernateTransactionManager - Exposing Hibernate transaction as JDBC transaction [jdbc:oracle:thin:@212.31.39.50:30998:orcl, UserName=DEVELOP, Oracle JDBC driver] 18:30:11 DEBUG nsactionSynchronizationManager - Bound value [org.springframework.jdbc.datasource.ConnectionHolder@843a9d] for key [org.apache.commons.dbcp.BasicDataSource@7745fd] to thread [http-8080-Processor24] 18:30:11 DEBUG nsactionSynchronizationManager - Initializing transaction synchronization ... After that, it works with no problems, until another period of inactivity. IMHO, it seems like connection pool returns an invalid/closed connection, and when Hibernate realizes that, ask another connection to the pool. I don't know how can I solve this problem or things I can do for delimiting it. Any help achieving this will be appreciate. Thanks. EDIT: Well, it finally was due a firewall rule. Database detects the connection is lost, but pool (dbcp or c3p0) not. So, it tries to query the database with no success. What is still strange for me is that timeout period is very variable. Maybe the rule is specially strange or firewall doesn't work correctly. Anyway, I have no access to that machine and I can only wait for an explanation. :(

    Read the article

  • Why does my entire page reload in Chrome and Firefox when using asynchronous UpdatePanel postbacks?

    - by Alex
    Being a bit perplexed about this issue by now, I hope some of you gurus can shed some light on my problem... I've developed a AJAX-enhanced website, which has been running fine in IE, Chrome and Firefox for a year or so. I use a Timer-control to check for incoming messages every 30 seconds, and this updates an UpdatePanel showing potential new messages. Now several one of my Firefox users complain about the page refreshing every 30 seconds! I my self cannot reproduce this behaviour, but given the "30 seconds"-description, I cursed my Timer-solution as the culprit. But now, I'm experiencing this error myself, not in Firefox though, but in Google Chrome! (And only on one of my two computers!) Every 30 seconds the page reloads! But I found that it's not only related to the Timer, because all other asynchronous postbacks to the server within UpdatePanels reloads the entire page as well. This error has never been experienced in Internet Explorer (to my knowledge). As I said, this it not only related to the Timer postback, but if it's of interest to anybody the code is like this: <asp:Timer runat="server" ID="MailCheckTimer" Interval="30000" OnTick="MailChecker_Tick"></asp:Timer> <asp:UpdatePanel runat="server" ID="MailCheckerUpdatePanel" UpdateMode="Conditional"> <ContentTemplate> <div class="newmail_box" runat="server" id="newmail_box"> <!-- Content stripped for this example --> </div> </ContentTemplate> <Triggers> <asp:AsyncPostBackTrigger ControlID="MailCheckTimer" /> </Triggers> </asp:UpdatePanel> In other places of the website I call the client side __doPostBack function directly from JavaScript in relation to an UpdatePanel. Normal behaviour for this call is to updated the referenced UpdatePanel with some content, but now in Chrome this refreshes the entire page! (but again not consistently, and never in IE) Even the most fundamental UpdatePanel operations like refreshing the content after a button (inside the panel) is clicked, forces the page to reload completely: <asp:Button ID="btnSearch" runat="server" Text="Search" OnClick="btnSearch_Click"></asp:Button> And just to torment me further, I only experience this on my public website, and not in my local development environment, making it a tedious affair for me to find the actual cause! :( Any ideas on why this happens? Why so inconsistently? Has it to do with my UpdatePanel-design? Or does some security setting in Firefox/Chrome that prevent some asynchronous UpdatePanel callbacks? Any help or idea is highly appreciated!

    Read the article

  • Normalizing Item Names & Synonyms

    - by RabidFire
    Consider an e-commerce application with multiple stores. Each store owner can edit the item catalog of his store. My current database schema is as follows: item_names: id | name | description | picture | common(BOOL) items: id | item_name_id | picture | price | description | picture item_synonyms: id | item_name_id | name | error(BOOL) Notes: error indicates a wrong spelling (eg. "Ericson"). description and picture of the item_names table are "globals" that can optionally be overridden by "local" description and picture fields of the items table (in case the store owner wants to supply a different picture for an item). common helps separate unique item names ("Jimmy Joe's Cheese Pizza" from "Cheese Pizza") I think the bright side of this schema is: Optimized searching & Handling Synonyms: I can query the item_names & item_synonyms tables using name LIKE %QUERY% and obtain the list of item_name_ids that need to be joined with the items table. (Examples of synonyms: "Sony Ericsson", "Sony Ericson", "X10", "X 10") Autocompletion: Again, a simple query to the item_names table. I can avoid the usage of DISTINCT and it minimizes number of variations ("Sony Ericsson Xperia™ X10", "Sony Ericsson - Xperia X10", "Xperia X10, Sony Ericsson") The down side would be: Overhead: When inserting an item, I query item_names to see if this name already exists. If not, I create a new entry. When deleting an item, I count the number of entries with the same name. If this is the only item with that name, I delete the entry from the item_names table (just to keep things clean; accounts for possible erroneous submissions). And updating is the combination of both. Weird Item Names: Store owners sometimes use sentences like "Harry Potter 1, 2 Books + CDs + Magic Hat". There's something off about having so much overhead to accommodate cases like this. This would perhaps be the prime reason I'm tempted to go for a schema like this: items: id | name | picture | price | description | picture (... with item_names and item_synonyms as utility tables that I could query) Is there a better schema you would suggested? Should item names be normalized for autocomplete? Is this probably what Facebook does for "School", "City" entries? Is the first schema or the second better/optimal for search? Thanks in advance! References: (1) Is normalizing a person's name going too far?, (2) Avoiding DISTINCT

    Read the article

  • Calculate pixels within a polygon

    - by DoomStone
    In an assignment for school do we need to do some image recognizing, where we have to find a path for a robot. So far have we been able to find all the polygons in the image, but now we need to generate a pixel map, that be used for an astar algorithm later. We have found a way to do this, show below, but the problem is that is very slow, as we go though each pixel and test if it is inside the polygon. So my question is, are there a way that we can generate this pixel map faster? We have a list of cordinates for the polygon private List<IntPoint> hull; The fuction "getMap" is called to get the pixel map public Point[] getMap() { List<Point> points = new List<Point>(); lock (hull) { Rectangle rect = getRectangle(); for (int x = rect.X; x <= rect.X + rect.Width; x++) { for (int y = rect.Y; y <= rect.Y + rect.Height; y++) { if (inPoly(x, y)) points.Add(new Point(x, y)); } } } return points.ToArray(); } Get Rectangle is used to limit the search, se we don't have to go thoug the whole image public Rectangle getRectangle() { int x = -1, y = -1, width = -1, height = -1; foreach (IntPoint item in hull) { if (item.X < x || x == -1) x = item.X; if (item.Y < y || y == -1) y = item.Y; if (item.X > width || width == -1) width = item.X; if (item.Y > height || height == -1) height = item.Y; } return new Rectangle(x, y, width-x, height-y); } And atlast this is how we check to see if a pixel is inside the polygon public bool inPoly(int x, int y) { int i, j = hull.Count - 1; bool oddNodes = false; for (i = 0; i < hull.Count; i++) { if (hull[i].Y < y && hull[j].Y >= y || hull[j].Y < y && hull[i].Y >= y) { try { if (hull[i].X + (y - hull[i].X) / (hull[j].X - hull[i].X) * (hull[j].X - hull[i].X) < x) { oddNodes = !oddNodes; } } catch (DivideByZeroException e) { if (0 < x) { oddNodes = !oddNodes; } } } j = i; } return oddNodes; }

    Read the article

  • Using Singleton synchronized array with NSThread

    - by hmthur
    I have a books app with a UISearchBar, where the user types any book name and gets search results (from ext API call) below as he types. I am using a singleton variable in my app called retrievedArray which stores all the books. @interface Shared : NSObject { NSMutableArray *books; } @property (nonatomic, retain) NSMutableArray *books; + (id)sharedManager; @end This is accessed in multiple .m files using NSMutableArray *retrievedArray; ...in the header file retrievedArray = [[Shared sharedManager] books]; My question is how do I ensure that the values inside retrievedArray remain synchronized across all the classes. Actually the values inside retrievedArray gets added through an NSXMLParser (i.e. through external web service API). There is a separate XMLParser.m file, where I do all the parsing and fill the array. The parsing is done on a separate thread. - (void) run: (id) param { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; NSXMLParser *parser = [[NSXMLParser alloc] initWithContentsOfURL: [self URL]]; [parser setDelegate: self]; [parser parse]; [parser release]; NSString *tmpURLStr = [[self URL]absoluteString]; NSRange range_srch_book = [tmpURLStr rangeOfString:@"v1/books"]; if (range_srch_book.location != NSNotFound) [delegate performSelectorOnMainThread:@selector(parseDidComplete_srch_book) withObject:nil waitUntilDone:YES]; [pool release]; } - (void) parseXMLFile: (NSURL *) url { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; [self setURL: url]; NSThread* myThread = [[NSThread alloc] initWithTarget:self selector:@selector(run:) object: nil]; [retrievedArray removeAllObjects]; [myThread start]; [pool release]; } There seems to be some synchronization issues if the user types very quickly (It seems to be working fine if the user types slowly)....So there are 2 views in which the content of an object in this shared array item is displayed; List and Detail. If user types fast and clicks on A in List view, he is shown B in detail view...That is the main issue. I have tried literally all the solutions I could think of, but am still unable to fix the issue. Please suggest some suitable fixes.

    Read the article

  • why this sql code dont work

    - by magy
    <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=windows-1256"> <title>??? ?????? ???? ????</title> </head> <body> <table width="100%" border="1"> <tr> <td>name</td> <td>number</td> <td>math</td> <td>arab</td> <td>history</td> <td>geo</td> </tr> <?php require_once "conf.php"; $sql2=("SELECT * FROM student WHERE snum = $ss"); $rs2 = mysql_query($sql2) or die(mysql_error()); $num = mysql_num_rows($rs2); $ss= $_POST["ss"]; if (empty($ss)) { echo "please write your search words";} else if ($num < 1 ) { echo "not found any like "; }else { $sql=("SELECT * FROM student WHERE snum = $ss "); $rs = mysql_query($sql) or die(mysql_error()); while($data=mysql_fetch_array($rs)){ $name=$data["sname"]; $number=$data["snum"]; $math=$data["math"]; $arab=$data["arab"]; $history=$data["history"]; $geo=$data["geo"]; echo" <tr> <td>$name</td> <td>$number</td> <td>$math</td> <td>$arab</td> <td>$history</td> <td>$geo</td> </tr> "; } }; ?> </table> </body> </html>

    Read the article

  • Android Bluetooth Fails to Pair

    - by CaseyB
    I am having a problem getting my devices to pair in Android. If I go into the settings and pair them manually I can get them to connect using the following code: Server // Make sure the device it discoverable mServerSocket = mAdapter.listenUsingRfcommWithServiceRecord("Moo Productions Bluetooth Server", mUUID); mState = State.ACCEPTING; BluetoothSocket socket = mServerSocket.accept(); mServerSocket.close(); connected(socket); Client Set<BluetoothDevice> pairedDevices = mAdapter.getBondedDevices(); BluetoothSocket socket = null; // Search the list of paired devices for the right one for(BluetoothDevice device : pairedDevices) { try { mState = State.SEARCHING; socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); connected(socket); break; } catch (IOException e) { socket = null; continue; } } But if the devices hadn't already been paired it gets out of the foreach without connecting to a valid socket. In that case I start discovering. // If that didn't work, discover if(socket == null) { mState = State.SEARCHING; mReceiver = new SocketReceiver(); mContext.registerReceiver(mReceiver, new IntentFilter(BluetoothDevice.ACTION_FOUND)); mAdapter.startDiscovery(); } // ... Later ... private class SocketReceiver extends BroadcastReceiver { @Override public void onReceive(Context context, Intent intent) { if(BluetoothDevice.ACTION_FOUND.equals(intent.getAction())) { try { // Get the device and try to open a socket BluetoothDevice device = intent.getParcelableExtra(BluetoothDevice.EXTRA_DEVICE); BluetoothSocket socket = device.createRfcommSocketToServiceRecord(mUUID); mState = State.CONNECTING; socket.connect(); // This is our boy, so stop looking mAdapter.cancelDiscovery(); mContext.unregisterReceiver(mReceiver); connected(socket); } catch (IOException ioe) { ioe.printStackTrace(); } } } } But it will never find the other device. I never get a pairing dialog and when I step through I see that it discovers the correct device, but it fails to connect with this exception java.io.IOException: Service discovery failed. Any ideas as to what I'm missing?

    Read the article

  • Scalable Database Tagging Schema

    - by Longpoke
    EDIT: To people building tagging systems. Don't read this. It is not what you are looking for. I asked this when I wasn't aware that RDBMS all have their own optimization methods, just use a simple many to many scheme. I have a posting system that has millions of posts. Each post can have an infinite number of tags associated with it. Users can create tags which have notes, date created, owner, etc. A tag is almost like a post itself, because people can post notes about the tag. Each tag association has an owner and date, so we can see who added the tag and when. My question is how can I implement this? It has to be fast searching posts by tag, or tags by post. Also, users can add tags to posts by typing the name into a field, kind of like the google search bar, it has to fill in the rest of the tag name for you. I have 3 solutions at the moment, but not sure which is the best, or if there is a better way. Note that I'm not showing the layout of notes since it will be trivial once I get a proper solution for tags. Method 1. Linked list tagId in post points to a linked list in tag_assoc, the application must traverse the list until flink=0 post: id, content, ownerId, date, tagId, notesId tag_assoc: id, tagId, ownerId, flink tag: id, name, notesId Method 2. Denormalization tags is simply a VARCHAR or TEXT field containing a tab delimited array of tagId:ownerId. It cannot be a fixed size. post: id, content, ownerId, date, tags, notesId tag: id, name, notesId Method 3. Toxi (from: http://www.pui.ch/phred/archives/2005/04/tags-database-schemas.html, also same thing here: http://stackoverflow.com/questions/20856/how-do-you-recommend-implementing-tags-or-tagging) post: id, content, ownerId, date, notesId tag_assoc: ownerId, tagId, postId tag: id, name, notesId Method 3 raises the question, how fast will it be to iterate through every single row in tag_assoc? Methods 1 and 2 should be fast for returning tags by post, but for posts by tag, another lookup table must be made. The last thing I have to worry about is optimizing searching tags by name, I have not worked that out yet. I made an ASCII diagram here: http://pastebin.com/f1c4e0e53

    Read the article

  • Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

    - by Ian Leslie
    I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

    Read the article

  • Dynamic Multiple Choice (Like a Wizard) - How would you design it? (e.g. Schema, AI model, etc.)

    - by henry74
    This question can probably be broken up into multiple questions, but here goes... In essence, I'd like to allow users to type in what they would like to do and provide a wizard-like interface to ask for information which is missing to complete a requested query. For example, let's say a user types: "What is the weather like in Springfield?" We recognize the user is interested in weather, but it could be Springfield, Il or Springfield in another state. A follow-up question would be: What Springfield did you want weather for? 1 - Springfield, Il 2 - Springfield, Wi You can probably think of a million examples where a request is missing key data or its ambiguous. Make the assumption the gist of what the user wants can be understood, but there are missing pieces of data required to complete the request. Perhaps you can take it as far back as asking what the user wants to do and "leading" them to a query. This is not AI in the sense of taking any input and truly understanding it. I'm not referring to having some way to hold a conversation with a user. It's about inferring what a user wants, checking to see if there is an applicable service to be provided, identifying the inputs needed and overlaying that on top of what's missing from the request, then asking the user for the remaining information. That's it! :-) How would you want to store the information about services? How would you go about determining what was missing from the input data? My thoughts: Use regex expressions to identify clear pieces of information. These will be matched to the parameters of a service. Figure out which parameters do not have matching data and look up the associated question for those parameters. Ask those questions and capture answers. Re-run the service passing in the newly captured data. These would be more free-form questions. For multiple choice, identify the ambiguity and search for potential matches ranked in order of likelihood (add in user history/preferences to help decide). Provide the top 3 as choices. Thoughts appreciated. Cheers, Henry

    Read the article

  • RAD Visual Web Application Creator/ Builder/ Designer for PHP

    - by inhoue
    Hi all, I want to see if any of you know a (free and open source will be ideal) tool/ app that can help build a php web application very quickly without investing too much time on writing codes, preferring drag and drop/ point and click work-flow designer for logic design (see Agile from Outsystems below). Plus, visual designer for the business logic is great since it can help a developer visualize the logic better. There are a lot of GUI builders, form builders out there, but I am looking for one app for the entire web application development process. My goal is to find an application that a team of developers can use together and use the build-in code of the app as much as possible. E.g. the app will provide a modular just for handle user login or a shopping cart; a developer just need to drag and drop the modular to the logic designer and the code will be generated. This way the functionality will be in a module and code will always be standard across developers. So if a new developer get on-board, he will just need to use the system and get up and running quickly. To explain this better: there is a lot php frameworks, e.g. cakephp, CodeIgniter, etc which I can use to help coding, but still I need to create (code) the GUI, writing quite a bit of codes. I am looking for a tool/ app that is a little more high level than those frameworks. Here is 2 examples apps I found during my google search which they have visual logic designer and gui builder in one single app. Also a single click deployment (but I need it to be php apps or at least I can deploy the (php) code to a LAMP/ WAMP server): Wavemaker: for JAVA Agile from Outsystems: for JAVA or .net (This one is really good, with work-flow drag and drop logic designer!) Talend: it is just an ETL tool, but the concept is what I want to bring up. Drag and drop, point and click logic design. Custom code can be added if it is needed, but the drag and drop process already finished the structure and most of the coding of the web app one needs to build. I want to list Adobe Flex, but it is more like a GUI designer + IDE, not exactly what I want to describe here. The drag and drop/ work-flow logic designer is a key for the app. I could go for the CMS route by learning how to extend them, but it is not that flexible for me and is a long learning curve. Anybody came across this type of app before? Or any idea of how can I find those apps? I googled them for long time, I don't see any of them for php and just few (just 2) for Java. Thanks in advance!

    Read the article

  • Configuring a html page from an original demo page

    - by Wold
    I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

    Read the article

  • Best practices for displaying large number of images as thumbnails in c#

    - by andySF
    I got to a point where it's very difficult to get answers by debugging and tracing object, so i need some help. What I'm trying to do: A history form for my screen capture pet project. The history must list all images as thumbnails (ex: picasa). What I've done: I created a HistoryItem:UserControl. This history item has a few buttons, a check box, a label and a picture box. The buttons are for delete/edit/copy image. The check box is used for selecting one or more images and the label is for some info text. The picture box is getting the image from a public property that is a path and a method creates a proportional thumbnail to display it when the control has been loaded. This user control has two public events. One for deleting the image and one for bubbling the events for mouse enter and mouse leave trough all controls. For this I use EventBroadcastProvider. The bubbling is useful because wherever I move the mouse over the control, the buttons appear. The dispose method has been extended and I manually remove the events. All images are loaded by looping a xml file that contains the path of all images. For each image in this XML I create a new HitoryItem that is added (after a little coding to sort and limit the amount of images loaded) to a flow layout panel. The problem: When I lunch the history form, and the flow layout panel is populated with my HistoryItem custom control, my memory usage increases drastically.From 14Mb to around 100MB with 100 images loaded. By closing the history form and disposing whatever I could dispose and even trying to call GC.Collect() the memory increase remain. I search for any object that could not be disposed properly like an image or event but wherever I used them they are disposed. The problem seams to be from multiple sources. One is that the events for bubbling are not disposing properly, and the other is from the picture box itself. All of this i could see by commenting all the code to a limited version when only the custom control without any image processing and even events is loaded. Without the events the memory consumption is reduced by axiomatically 20%. So my real question is if this logic, flow layout panels and custom controls with picture boxes, is the best solution for displaying large amounts of images as thumbnails. Thank you!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • My mental block - struggling to learn Objective C

    - by iqessar
    Hello people, this would be my first question after signing up! Anyway heres my question, I did Java at university and I was always told I am a good programmer. However I never pursued it as a career - I went into support and management instead. Im pretty much bored with my job, I have therefore started to learn Objective C so that I can develop apps for the iphone. I am currently watching several different Videos / Books. My problem is that when I go through the Apple documentation, although I understand most of it, sometimes I stumble. I believe that because you/we have the Apple documentation (i.e. Framework references) , everything should be clear, and therefore you should have no need to refer to a book or video (in order to learn how to use a particular class). But I alway do refer to a book and video and subsequently feel guilty as I believe the framework reference should be enough. (I therefore feel I am not up to being a programmer) I also believe that you shouldn't need example code in order to learn how to use a particular class because Apple provides documentation for each class, but AGAIN I find my self googling example code and I find my answer like that - again I feel guilty for doing this. Am I right in saying that Apple documentation is simply not clear? and that its ok to refer to a video/book or google? or forums for that matter? I have proffesional programmers who tell me that I am worrying too much and that I should get on with it and use all the resources that I have. I just cant seem to get round this mental block that I have in my head. When I start a programming project I am able to use the excellent search skills that I have to find the code I need, copy and paste it (yes I do understand it) BUT then I feel guilty telling myself that why didn't you think up the code yourself???? Therefore your not a real programmer, your just good at googling. Currently I am going through 20+ books so that I can learn most of the frameworks, syntax etc to develop iphone apps. I believe if I do this, then when I think of a project I can make it quickly. Should I read a few books, like 2-3 and then just start a project /app , and if I get stuck just google it and get the code I need? Can anybody please answer my questions?

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • session management: problem displaying username in the header

    - by aeonsleo
    hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

    Read the article

  • Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

    - by Vatsala
    Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

< Previous Page | 620 621 622 623 624 625 626 627 628 629 630 631  | Next Page >