Search Results

Search found 35142 results on 1406 pages for 'latest version'.

Page 628/1406 | < Previous Page | 624 625 626 627 628 629 630 631 632 633 634 635  | Next Page >

  • C++ : integer constant is too large for its type

    - by user38586
    I need to bruteforce a year for an exercise. The compiler keep throwing this error: bruteforceJS12.cpp:8:28: warning: integer constant is too large for its type [enabled by default] My code is: #include <iostream> using namespace std; int main(){ unsigned long long year(0); unsigned long long result(318338237039211050000); unsigned long long pass(1337); while (pass != result) { for (unsigned long long i = 1; i<= year; i++) { pass += year * i * year; } cout << "pass not cracked with year = " << year << endl; ++year; } cout << "pass cracked with year = " << year << endl; } Note that I already tried with unsigned long long result(318338237039211050000ULL); I'm using gcc version 4.8.1 EDIT: Here is the corrected version using InfInt library http://code.google.com/p/infint/ #include <iostream> #include "InfInt.h" using namespace std; int main(){ InfInt year = "113"; InfInt result = "318338237039211050000"; InfInt pass= "1337"; while (pass != result) { for (InfInt i = 1; i<= year; i++) { pass += year * i * year; } cout << "year = " << year << " pass = " << pass << endl; ++year; } cout << "pass cracked with year = " << year << endl; }

    Read the article

  • Subversion freaking out on me!

    - by Malfist
    I have two copies of a site, one is the production copy, and the other is the development copy. I recently added everything in the production to a subversion repository hosted on our linux backup server. I created a tag of the current version and I was done. I then copied the development copy overtop of the production copy (on my local machine where I have everything checked out). There are only 10-20 files changed, however, when I use tortoise SVN to do a commit, it says every file has changed. The diff file generated shows subversion removing everything, and replacing it with the new version (which is the exact same). What is going on? How do I fix it? An example diff: Index: C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html =================================================================== --- C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (revision 5) +++ C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (working copy) @@ -1,4 +1,4 @@ -<html> -<body bgcolor="#FFFFFF"> -</body> +<html> +<body bgcolor="#FFFFFF"> +</body> </html> \ No newline at end of file

    Read the article

  • Should TcpClient be used for this scenario?

    - by Martín Marconcini
    I have to communicate with an iPhone. I have its IP Address and the port (obtained via Bonjour). I need to send a header that is “0x50544833” (or similar, It’s an HEX number), then the size of the data (below) and then the data itself. The data is just a string that looks like this: <?xml version="1.0" encoding="utf-8"?> <!DOCTYPE plist SYSTEM "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>clientName</key> <string>XXX</string> <key>clientService</key> <string>0be397e7-21f4-4d3c-89d0-cdf179a7e14d</string> <key>registerCode</key> <string>0000</string> </dict> </plist> The requirement also says that I must send the data in little endian format (which I think is the default for Intel anyway). So it would be: hex_number + size of data + string_with_the_above_xml. I need to send that to the iPhone and read the response. What would be, according to your experience, the best way to send this data (and read the response)?

    Read the article

  • Java applet wont run

    - by Courtney
    I am trying to get a Java applet to run properly when linked to an HTML page in Dreamweaver CC. I'm new to all this so please bear with me here. First I saved this code to a .java file //Triangle.java import java.awt.*; import java.applet.Applet; public class Triangle extends Applet { public void paint (Graphics g){ int bottomX=80; int bottomY=200; int base=100; int height=100; g.drawLine(bottomX,bottomY,bottomX+base,bottomY); g.drawLine(bottomX+base,bottomY,bottomX+base/2,bottomY-height); g.drawLine(bottomX+base/2,bottomY-height, bottomX,bottomY); } } I then compiled it entering javac Triangle.java After that, I inserted it into a Dreamwever page using: <html> <applet code=Triangle.class width=400 height=400 > </applet> </html> Now when I try and open the page in Chrome I get an error reading: UnsupportedClassVersionError Triangle: Unsupported major.minor version 52.0 This, as I have read, is an issue with using two incompatible Java versions? In my Java Control Panel it says I am using version 1.8.0_20 and my JDK is jdk1.8.0_20. Does anyone see anything super obvious that I am doing wrong here?

    Read the article

  • RMagick transparent_color deprecated? What's the alternative?

    - by user315975
    I'm developing an app that does a fair amount of generating transparent pngs on the fly. These are used as overlays, to show areas of interest in a graphic, so they have to have transparent backgrounds. I am developing in Ruby on Rails, deploying on Heroku. What works fine in development is not working in production. I get this error when I call a drawing routine using RMagick: NotImplementedError (the `transparent_color=' method is not supported by ImageMagick 6.2.4): /usr/local/lib/ruby/gems/1.8/gems/rmagick-1.15.17/lib/RMagick.rb:1691:in `transparent_color=' I'm using RMagick version 2.12.1 on the development machine, but I'm not exactly certain how to discover the version of ImageMagick that it's running, so I'm not sure if this is a case of my local code being behind or ahead. I'm hoping behind, because perhaps then there'll be a replacement for this call. Does anyone know what the fix is here? What's required to generate a transparent background, if not the call I'm using? I can't find this in the documentation: in fact, it was on a third-party site that I found mention of this capability.

    Read the article

  • Cannot display converted value inside xml field

    - by zurna
    PS: My bad, there was not an error. I forgot to upload the latest version to the server... I have multimedias and images table. I save images in multimedias table with their images table id numbers. Then whenever I need image's url, with a simple function I get it from images table. The problem I am having is when I try to display image's url inside ImageURL, it just does not happen. This is very annoying. xml output <?xml version='1.0' encoding='windows-1254' ?> <rows><row id='1'> <MultimediaTitle>Hagi Goals</MultimediaTitle> /FLPM/media/images/5Y2K4T5V_sm.jpg <ImageURL><![CDATA[]]></ImageURL> <Videos> <VideoID id='1'><VideoURL>/FLPM/media/videos/0H7T9C0F.flv</VideoURL></VideoID> <VideoID id='2'><VideoURL>/FLPM/media/videos/9L6X9G9J.flv</VideoURL></VideoID> </Videos> </row> </rows>

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Cannot create a new VS data connection in Server Explorer

    - by Seventh Element
    I have a local instance of SQL Server 2008 express edition running on my development PC. I'm trying to create a new data connection through Visual Studio Server Explorer. The steps are the following: Right click the "Data Connections" node = Choose Data Source. I select "Microsoft SQL Server" as the data source. The "Add Connection" dialog window appears. I select my local server instance = "Test connection" works fine. I select "AdventureWorks" as the database name = "Test connection" works fine. Next I hit the "Ok" button = Error message: "This server version is not supported. Only servers up to MS SQL Server 2005 are supported." I'm using Visual Studio 2008 Professional Edition. The target framework of the application is ".NET framework 3.5". I have a reference to System.Data (framework v2.0) and cannot find another version of the assembly on my system. Am I referencing the wrong assembly? How can I fix this problem?

    Read the article

  • select nodes from a line of xml code with sql

    - by wondergoat77
    I have a table that stores a huge line/entire document of xml like this: <?xml version="1.0" encoding="utf-16"?> <RealQuestResponse xmlns:xsi="http://www.w3.org /2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <Success>true</Success> <Subject> <AmbiguousMatches /> <Assessment> <LandValue>0</LandValue> <ImprovementsValue>0</ImprovementsValue> <TotalValue>0</TotalValue> </Assessment> <RecentSales /> <Warnings> <Score>0</Score> <TrusteesDeedRatio>0</Tr........etc Is there a way to pull any of these fields out of the xml? it is stored in a column in a table called AutomatedRequests That table looks like this: requestid Provider Date Success Response 1 test 1/2/2012 Y <?xml version..... <---this is the xml code stored> Ive seen a couple ways but nothing like this Id basically like something like select xmlnode1, xmlnode2, xmlnode3 from automatedrequests have tried this but not working: select xml.query('RealQuestResponse/Bedrooms/*') from automatedRequests where orderid = 1266162

    Read the article

  • Can anyone explain this strange behaviour?

    - by partizan
    Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false! this is not the expected result } } So, what do you think about this?

    Read the article

  • How Best to Replace Ugly Queries and Dynamic PL/SQL with C#?

    - by Mike
    Hi, I write a lot of one-off Oracle SQL queries (in Toad), and sometimes they can get complex, involving lots of unions, joins, and subqueries, and sometimes requiring dynamic SQL. That is, sometimes SQL queries require set based processing along with significant procedural processing. This is what PL/SQL is custom made for, but as a language it does not begin to compare to C#. Now and then I convert a PL/SQL procedure to C#, and am always amazed at how much cleaner and easier to both read and write the C# version is. The C# program might for example construct a SQL query string piece by piece and/or run several queries and process them as needed. The C# version is usually much faster as well, which must mean that I'm not very good at PL/SQL either. I do not currently have access to LINQ. My question is, how best to package all these little C# programs, which are really just mini reports, that is, replacements for ugly SQL queries? Right now I'm actually using NUnit to hold them, and calling each report a [Test], even though they aren't really tests. NUnit just happens to provide a convenient packaging framework.

    Read the article

  • Converting string to a simple type

    - by zespri
    .Net framework contains a great class named Convert that allows conversion between simple types, DateTime type and String type. Also the class support conversion of the types implementing IConvertible interface. The class has been implemented in the very first version of .Net framework. There were a few things in the first .Net framework that were not done quite right. For example .Parse methods on simple types would throw an exception if the string couldn't be parsed and there would be no way to check if exception is going to be thrown in advance. A future version of .Net Framework removed this deficiency by introducing the TryParse method that resolved this problem. The Convert class dates back to time of the old Parse method, so the ChangeType method on this class in implemented old style - if conversion can't be performed an exception is thrown. Take a look at the following code: public static T ConvertString<T>(string s, T @default) { try { return (T)Convert.ChangeType(s, typeof(T), CultureInfo.InvariantCulture); } catch (Exception) { return @default; } } This code basically does what I want. However I would pretty much like to avoid the ugly try/catch here. I'm sure, that similar to TryParse, there is a modern method of rewriting this code without the catch-all. Could you suggest one?

    Read the article

  • Why is UseCompatibleTextRendering needed here?

    - by HotOil
    Hi, I think I'm missing something fundamental. Please tell me what it is, if you can. I have developed a little C++ WinForms app using VS2008. So it is built using .NET 3.5 SP1. My development box is Win7, if that matters. The default value of UseCompatibleTextRendering property in WinForms controls is false in this version of VStudio. And this should not matter to me, I don't think. I don't have any custom-drawn text or controls. The app looks good running on my Win7 box. If I package it up (dragging along .NET 3.5) and install it on one of our WinXP desktops, the buttons and labels don't look good; the text is chopped off in them. If I set UseCompatibleTextRendering to true and then run it on the XP boxes, the text fits into the buttons and labels. My question is: Why? The installation puts .Net 3.5 on the XP boxes, so the app should be able to find and use the right version of WinForms, right? I should note that before I put my app + .NET 3.5 on these boxes, they have no .NET at all. They do not get automatic Microsoft updates; our IT guy gates the patches and upgrades. [ This sort of thing has happened before with apps I create.. they look/work great on the Engineering machines, because we maintain those and they mostly have up-to-date stuff. When they are run on the corporate boxes, they usually don't run and need the VCredist installed. ] Back to the question at hand: The text looks better with the UseCompatibleTextRendering set to false, so I'd rather keep it that way, if I can. I'd like to understand what might be missing on those XP boxes that is making the text not fit. Thanks S

    Read the article

  • How to provide i18n service for developer and end user

    - by user247245
    Many android applications have quite poor i18n-support, and for an understandable reason, as it adds much work for the developer. From a both intuitive and cultural point of view it would be a good thing if end-users could translate the apps themself, and OTA share the translation, without reinstalling the app itself. In concept; as wikipedia, some add content easily, others only use what's there. It's of course important that the service is as easy as possible to use, both for app-developers, and people willing to transcribe. To keep it simple, this is the solution I'm concidering; Developer perspective: Developer uses a customized setContentView when open activities/layouts that will seach for thanslations of xml-entries. (below) The customized version is provided as a free downloadable library/class..., turning the i18n feature to more or less a one liner. User perspective: User downloads app without any translation As app launches, it checks locale running at phone, and will look for a translated xml-file at shared space in SD. If no or old transcribed xml (above), try to download new from internet-service (ansync). This is all done by library above, no need for intents. Translator perspective: Separate app to provide translations for any app using the i18n service above. (Could be just a webapp), with some form of QA on translators/input. QUESTION: Now, for this to work efficiently, it has to be AeasyAP for the developer to even bother, and the most fluent solution would be a customized version of setContentView, that simply loads the translated values from external xml, instead of the ones in the apk. Is this possible at all, and if not, what's your suggested solutions? (And of course, Happy New Year, feliz ano novo, blwyddyn newydd dda, Gott Nytt År, kontan ane nouvo, szczesliwego nowego roku ...) Regards, /T

    Read the article

  • jquery fail to retrieve accurate data from sibling field.

    - by i need help
    wonder what's wrong <table id=tblDomainVersion> <tr> <td>Version</td> <td>No of sites</td> </tr> <tr> <td class=clsversion>1.25</td> <td><a id=expanddomain>3 sites</a><span id=spanshowall></span></td> </tr> <tr> <td class=clsversion>1.37</td> <td><a id=expanddomain>7 sites</a><span id=spanshowall></span></td> </tr> </table> $('#expanddomain').click(function() { //the siblings result incorrect //select first row will work //select second row will no response var versionforselected= $('#expanddomain').parent().siblings("td.clsversion").text(); alert(versionforselected); $.ajax({ url: "ajaxquery.php", type: "POST", data: 'version='+versionforselected, timeout: 900000, success: function(output) { output= jQuery.trim(output); $('#spanshowall').html(output); }, }); });

    Read the article

  • Cast exception being generated when using the same type of object

    - by David Tunnell
    I was previously using static variables to hold variable data that I want to save between postbacks. I was having problems and found that the data in these variables is lost when the appdomain ends. So I did some research and decided to go with ViewStates: static Dictionary<string, linkButtonObject> linkButtonDictonary; protected void Page_Load(object sender, EventArgs e) { if (ViewState["linkButtonDictonary"] != null) { linkButtonDictonary = (Dictionary<string, linkButtonObject>)ViewState["linkButtonDictonary"]; } else { linkButtonDictonary = new Dictionary<string, linkButtonObject>(); } } And here is the very simple class I use: [Serializable] public class linkButtonObject { public string storyNumber { get; set; } public string TaskName { get; set; } } I am adding to linkButtonDictionary as a gridview is databound: protected void hoursReportGridView_OnRowDataBound(Object sender, GridViewRowEventArgs e) { if (e.Row.RowType == DataControlRowType.DataRow) { LinkButton btn = (LinkButton)e.Row.FindControl("taskLinkButton"); linkButtonObject currentRow = new linkButtonObject(); currentRow.storyNumber = e.Row.Cells[3].Text; currentRow.TaskName = e.Row.Cells[5].Text; linkButtonDictonary.Add(btn.UniqueID, currentRow); } } It appears that my previous issues are resolved however a new one has arisin. Sometime when I postback I am getting this error: [A]System.Collections.Generic.Dictionary2[System.String,linkButtonObject] cannot be cast to [B]System.Collections.Generic.Dictionary2[System.String,linkButtonObject]. Type A originates from 'mscorlib, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' in the context 'LoadNeither' at location 'C:\Windows\Microsoft.Net\assembly\GAC_32\mscorlib\v4.0_4.0.0.0__b77a5c561934e089\mscorlib.dll'. Type B originates from 'mscorlib, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' in the context 'LoadNeither' at location 'C:\Windows\Microsoft.Net\assembly\GAC_32\mscorlib\v4.0_4.0.0.0__b77a5c561934e089\mscorlib.dll'. I don't understand how there can be a casting issue when I am using the same class everywhere. What am I doing wrong and how do I fix it?

    Read the article

  • Difference in calling redefined functions in F# and Clojure

    - by Michiel Borkent
    In F#: > let f x = x + 2;; val f : int -> int > let g x = f x;; val g : int -> int > g 10;; val it : int = 12 > let f x = x + 3;; val f : int -> int > g 10;; val it : int = 12 In Clojure: (defn f [x] (+ x 2)) (defn g [x] (f x)) (g 10) ;; => 12 (defn f [x] (+ x 3)) (g 10) ;; => 13 Note that in Clojure the most recent version of f gets called in the last line. In F# however still the old version of f is called. Why is this?

    Read the article

  • How to change name attribut value from twig

    - by taieb baccouch
    I am using Symfony version 2.3 and twig version 1.0. and I'm trying to change the name attribut value. Here is my code : <div class="control-group"> {{ form_label(form.menuTitle, null, {'label_attr': {'class': 'control-label'}}) }} {{ form_errors(form.menuTitle)}} <div class="controls"> <div class="span12"> {{ form_widget(form.menuTitle, {'attr': {'class': 'span6'}}) }} </div> </div> </div> The rendering code : <div class="control-group"> <label class="control-label required" for="smart_contactbundle_contact_menuTitle">Menu title</label> <div class="controls"> <div class="span12"> <input type="text" id="smart_contactbundle_contact_menuTitle" name="smart_contactbundle_contact[menuTitle]" required="required" maxlength="255" class="span6"> </div> </div> </div> I want to change name="smart_contactbundle_contact[menuTitle]" to name="menuTitle"

    Read the article

  • why create CLSID_CaptureGraphBuilder2 instance always failed in a machine

    - by Yigang Wu
    It's a real strange issue, the machine information below is from DXDiag. There is no error reported, but create CLSID_CaptureGraphBuilder2 instance always failed in the machine. It's okay to create CLSID_FilterGraph. Before create CLSID_CaptureGraphBuilder2, I have called CoInitialize and created CLSID_FilterGraph. Only this machine has the error, what dll related with this interface or any function needed to call before to make it work? Thanks in advance. System Information Time of this report: 4/24/2010, 09:46:58 Machine name: TURION Operating System: Windows XP Home Edition (5.1, Build 2600) Service Pack 3 (2600.xpsp_sp3_qfe.100216-1510) Language: Japanese (Regional Setting: Japanese) System Manufacturer: To Be Filled By O.E.M. System Model: MS-7145 BIOS: Default System BIOS Processor: AMD Turion(tm) 64 Mobile Technology MT-30, MMX, 3DNow, ~1.6GHz Memory: 768MB RAM Page File: 376MB used, 1401MB available Windows Dir: C:\WINDOWS DirectX Version: DirectX 9.0c (4.09.0000.0904) DX Setup Parameters: Not found DxDiag Version: 5.03.2600.5512 32bit Unicode DxDiag Notes DirectX Files Tab: No problems found. Display Tab 1: No problems found. Sound Tab 1: No problems found. Sound Tab 2: No problems found. Music Tab: No problems found. Input Tab: No problems found. Network Tab: No problems found.

    Read the article

  • some problem with iOS 4.2.1

    - by bicbac
    Hi, I've been developing an app with MacBook Pro (MBP) so far. Last week one of my friends gave me new macbook air 11"(MBA). so Now I can test my code with more than one machine with the same version of developing tools - Both machine has Xcode (3.2.5) and iOS SDK 4.2.1). After some point my app starts get terminated suddenly(iPhone sumulator), and I was using MBP. I got no error message whatsoever. it just stops. I reckon the crash comes from dealing with memory, like 'release'/ 'double-release'. (I'm not 100% sure though). Anyway I thought there must be some mistake within my code for sure. -Confusion starts from this part.- With my MBA, on the other hand, I don'y see any crash. It just works fine. There is nothing different between MBA & MBP except the h/w specifications. Same code, same versions of XCode and iOS SDK. Is the fact that no crash at MBA suggesting that I have to look somewhere else than the code itself? I red some article and Q&As on iOS4.2.1 and XCode 3.2.5 that the most recent version of XCode doesn't recognize the iOS 4.2.1 since the 4.2.1 came out later the 3.2.5. Is it the reason? I have no idea at this moment what should be the next move. thanks

    Read the article

  • switch statemt functioning improperly and giving error when i put break;

    - by nav
    The following is the code i used in a program - over here the month variable is an integer switch(month) { case 1: case 3: case 5: case 7: case 8: case 10: case 12: return 31; break; case 2: return 28; break; case 4: case 6: case 9: case 11: return 30; break; default: System.out.println("Invalid month."); return 0; } surprisingly, when i use the above switch construct.. it gives an error saying.. code unreachable for statements after each break statement Then i removed all the break statements, and the new code looks like this --- switch(month) { case 1: case 3: case 5: case 7: case 8: case 10: case 12: return 31; case 2: return 28; case 4: case 6: case 9: case 11: return 30; default: System.out.println("Invalid month."); return 0; } Now.. after removing the break statements .. the code worked perfectly well.. My question is... in the switch construct.. it is mandatory to use break.. or else the control flow continued.. and all the conditions are tested and executed!! right??? So why in the world is the previous ** syntactically Right** version giving an error.. and the modified syntactically incorrect version running perfectly well.. Any explanation.. anyone!!

    Read the article

  • Multi-client C# ODBC (Sybase/Oracle/MSSQL) table access question.

    - by Hamish Grubijan
    I am working on a feature that would allow clients pick a unique identifier (ci_name). The code below is a generic version that gets expanded to the right sql depending on the vendor. Hopefully it makes sense. #include "sql.h" create table client_identification ( ci_id TYPE_ID IDENTITY, ci_name varchar(64) not null, constraint ci_pk primary key (ci_name) ); go CREATE_SEQUENCE(ci_id) There will be simple stored procedures for adding, retrieving, and deleting these user records. This will be used by several admins. This will not happen very frequently, but there is still a possibility that something will be added or deleted since the list was initially retrieved. I have not yet decided if I need to detect the case of a double delete, but the user name cannot be created twice - primary key constraint will object. I want to be able to detect this particular case and display something like: "you snooze - you loose." :) I would like to leverage the pk constraint instead of doing some extra sql gymnastics. So, how can I detect this case cleanly, so that it works in MS SQL 2008, Sybase, and Oracle? I hope to do better than catch a general ODBC exception and parse out the text and look for what Sybase, Oracle, and MSSQL would give me back. Oracle is a little different. We actually prepend these variables to the Oracle version of stored procedures because they are not available otherwise: Vret_val out number, Vtran_count in out number, Vmessage_count in out number, Thanks. General helpful tips and comments are welcome, except for naming convention ones ( I do not have a choice here, plus I mangled the actual names a bit).

    Read the article

  • Caching queries in Django

    - by dolma33
    In a django project I only need to cache a few queries, using, because of server limitations, a cache table instead of memcached. One of those queries looks like this: Let's say I have a Parent object, which has a lot of Child objects. I need to store the result of the simple query parent.childs.all(). I have no problem with that, and everything works as expected with some code like key = "%s_children" %(parent.name) value = cache.get(key) if value is None: cache.set(key, parent.children.all(), CACHE_TIMEOUT) value = cache.get(key) But sometimes, just sometimes, the cache.set does nothing, and, after executing cache.set, cache.get(key) keeps returning None. After some test, I've noticed that cache.set is not working when parent.children.all().count() has higher values. That means that if I'm storing inside of key (for example) 600 children objects, it works fine, but it wont work with 1200 children. So my question is: is there a limit to the data that a key could store? How can I override it? Second question: which way is "better", the above code, or the following one? key = "%s_children" %(parent.name) value = cache.get(key) if value is None: value = parent.children.all() cache.set(key, value, CACHE_TIMEOUT) The second version won't cause errors if cache.set doesn't work, so it could be a workaround to my issue, but obviously not a solution. In general, let's forget about my issue, which version would you consider "better"?

    Read the article

  • Kohana Auth Library Deployment

    - by Steve
    My Kohana app runs perfectly on my local machine. When I deployed my app to a server (and adjust the config files appropriately), I can no longer log into the app. I've traced through the app login routine on both my local version and the server version and they both agree with each other all the way through until you get to the auth.php controller logged_in() routine where suddenly, at line 140 - the is_object($this-user) test - the $user object no longer exists!?!?!? The login() function call that calls the logged_in() function successfully passes the following test, which causes a redirect to the logged_in() function. if(Auth::instance()->login($user, $post['password'])) Yes, the password and hash, etc all work perfectly. Here is the offending code: public function logged_in() { if ( ! is_object($this->user)) { // No user is currently logged in url::redirect('auth/login'); } etc... } As the code is the same between my local installation and the server, I reckon it must be some server setting that is messing with me. FYI: All the rest of the code works because I have a temporary backdoor available that allows me to use the application (view pages of tables, etc) without being logged in. Any ideas?

    Read the article

  • Another boost error

    - by user1676605
    On this code I get the enourmous error static void ParseTheCommandLine(int argc, char *argv[]) { int count; int seqNumber; namespace po = boost::program_options; std::string appName = boost::filesystem::basename(argv[0]); po::options_description desc("Generic options"); desc.add_options() ("version,v", "print version string") ("help", "produce help message") ("sequence-number", po::value<int>(&seqNumber)->default_value(0), "sequence number") ("pem-file", po::value< vector<string> >(), "pem file") ; po::positional_options_description p; p.add("pem-file", -1); po::variables_map vm; po::store(po::command_line_parser(argc, argv). options(desc).positional(p).run(), vm); po::notify(vm); if (vm.count("pem file")) { cout << "Pem files are: " << vm["pem-file"].as< vector<string> >() << "\n"; } cout << "Sequence number is " << seqNumber << "\n"; exit(1); ../../../FIXMarketDataCommandLineParameters/FIXMarketDataCommandLineParameters.hpp|98|error: no match for ‘operator<<’ in ‘std::operator<< [with _Traits = std::char_traits](((std::basic_ostream &)(& std::cout)), ((const char*)"Pem files are: ")) << ((const boost::program_options::variable_value*)vm.boost::program_options::variables_map::operator[](((const std::string&)(& std::basic_string, std::allocator (((const char*)"pem-file"), ((const std::allocator&)((const std::allocator*)(& std::allocator()))))))))-boost::program_options::variable_value::as with T = std::vector, std::allocator , std::allocator, std::allocator ’|

    Read the article

< Previous Page | 624 625 626 627 628 629 630 631 632 633 634 635  | Next Page >