Search Results

Search found 55281 results on 2212 pages for 'j set'.

Page 635/2212 | < Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >

  • Example of user-defined integrity rule in database systems?

    - by Pavel
    Hey everyone. I'm currently preparing for my exams and would like to know some examples of user-defined integrity rule in database systems. As far as I understand, it means that I can set up certain conditions for the columns and when data is inserted it needs to fulfill these conditions. For example: if I set up a rule that an ID needs to consist of 5 integers ONLY then when I insert a row with ID which is made up of integers and some chars then it won't accept it and return an error. Could someone confirm and give me some opinion on that? Thank you very much in advance!

    Read the article

  • Will iPhone App with future "Availability Date" show up in "New Releases" on that day?

    - by Heiko Weible
    I plan to submit my first iPhone game "The Twiggles" to the iPhone app store today. Like many people suggest, I want to set the "Availability Date" to a date way in the future and change it later. But there are two different opinions on what to do once the app is approved: A: Some people say, I have to quickly change the "Availability Date" to the date the app is approved by Apple right after I get the "app approved" mail. Otherwise it won't show up in the "New Releases" list. B: Some people say, this is not necessary (or maybe no longer necessary). I can set the "Availability Date" to some date in the future (for example, next weekend). The app will be released on that day and will show up in the "New Releases" list on that day. Who is right?

    Read the article

  • PHP class that changes an image and reloads the page not displaying new image in Internet Explorer

    - by Stuart
    I have a class that runs a function when the image is clicked on to display an additional image. This function produces a linked div tag that reloads the page with a set of variables that then produces another image. The image is set as a background image on a large div tag behind the linked div tags to give the same effect as an image map but without using an image map or a SVG. This works perfectly in Chrome and Firefox but will not display the new image in Internet Explorer until you F5 the page again with the get variables in the URL? Does anyone know how to fix this issue so that it works in IE the same as the other browsers? Many thanks.

    Read the article

  • OS X Terminal: Meta key + alt functionality at the same time

    - by abababa22
    Is there a way to use "alt/option" key as a meta key but still be able to use the key to make some characters which need it? For example in my local keyboard layout: @ is alt-2 \ is alt-shift-7 | is alt-7 etc. So if I set alt as meta key, I can't make those characters. On the other hand using "press esc, release esc, press a key" to make meta key sequences makes my hands hurt. Any emacs users with international keyboards who have solved this, please give any tips you might have! :) edit: It appears that I can set alt as meta key and then add these kind of settings in inputrc: "\e2": "@" This works in bash shell but it still won't work with emacs though, so no good.

    Read the article

  • Can I use accepts_nested_attributes_for with checkboxes in a _form to select potential 'links' from a list

    - by Ryan
    In Rails 3: I have the following models: class System has_many :input_modes # name of the table with the join in it has_many :imodes, :through => :input_modes, :source => 'mode', :class_name => "Mode" has_many :output_modes has_many :omodes, :through => :output_modes, :source => 'mode', :class_name => 'Mode' end class InputMode # OutputMode is identical belongs_to :mode belongs_to :system end class Mode ... fields, i.e. name ... end That works nicely and I can assign lists of Modes to imodes and omodes as intended. What I'd like to do is use accepts_nested_attributes_for or some other such magic in the System model and build a view with a set of checkboxes. The set of valid Modes for a given System is defined elsewhere. I'm using checkboxes in the _form view to select which of the valid modes is actually set in imodes and omodes . I don't want to create new Modes from this view, just select from a list of pre-defined Modes. Below is what I'm currently using in my _form view. It generates a list of checkboxes, one for each allowed Mode for the System being edited. If the checkbox is ticked then that Mode is to be included in the imodes list. <% @allowed_modes.each do |mode| %> <li> <%= check_box_tag :imode_ids, mode.id, @system.imodes.include?(modifier), :name => 'imode_ids[]' %> <%= mode.name %> </li> <% end %> Which passes this into the controller in params: { ..., "imode_ids"=>["2", "14"], ... } In the controller#create I extract and assign the Modes that had their corresponding checkboxes ticked and add them to imodes with the following code: @system = System.new(params[:system]) # Note the the empty list that makes sure we clear the # list if none of the checkboxes are ticked if params.has_key?(:imode_ids) imodes = Mode.find(params[:imode_ids]) else imodes = [] end @system.imodes = imodes Once again that all works nicely but I'll have to copy that cludgey code into the other methods in the controller and I'd much prefer to use something more magical if possible. I feel like I've passed off the path of nice clean rails code and into the forest of "hacking around" rails; it works but I don't like it. What should I have done?

    Read the article

  • Fluent-NHibernate: How does one translate composite-element tag to fnh?

    - by epitka
    How do we express this in FNH? <class name="Order" .... > .... <set name="PurchasedItems" table="purchase_items" lazy="true"> <key column="order_id"> <composite-element class="Purchase"> <property name="PurchaseDate"/> <property name="Price"/> <property name="Quantity"/> <many-to-one name="Item" class="Item"/> <!-- class attribute is optional --> </composite-element> </set>

    Read the article

  • jQuery/JavaScript: Trigger when preloaded

    - by user317563
    Hello there, jQuery has the .ready() function, but I am unsure whether this is what I need: I set a default background image in CSS (imange 1 out of 4), once document is loaded (images and all, not only DOM); I want to start preloading background image 2 out of 4. Once that is loaded, I want to fade image 1 into image 2. Then I want to preload the next image (3 out of 4), once that is loaded, I want to fade from background image 2 into image 3, and finally preload image 4. Once image 4 is loaded, i would like to fade image 3 into image 4. After that, I want to cycle between the images with a set time interval. What strategy would I use to solve this? .load() function? Thank you for your time. Kind regards,Marius

    Read the article

  • How can I create an enum using numbers?

    - by Jordan S
    Is it possible to make an enum using just numbers in C#? In my program I have a variable, Gain, that can only be set to 1, 2, 4, and 8. I am using a propertygrid control to display and set this value. If I were to create an enum like this... private enum GainValues {One, Two, Four, Eight} and I made my gain variable of type GainValues then the drop-down list in the propertygrid would only show the available values for the gain variable. The problem is I want the gain values to read numerically an not as words. But I can not create an enum like this: private enum GainValues {1,2,4,8} So is there another way of doing this? Perhaps creating a custom type?

    Read the article

  • Show parts of the result of an SQL statement using PHP

    - by mouthpiec
    I have an SQL query which returns a set of data (around 40-50 tuples). I would like to display the results 5 at a time on an HTML page using PHP. I already managed to have the right SELECT statement, but i am having problems to display the results 5 by 5 using a "more" button. Can you please help? Note that every time i call the query, the data is being randomized, so it is not possible to set limits and call the query again. I have to find the method to store the results somewhere, and then show them 5 by 5.

    Read the article

  • Memory leak in Mozilla when unloading stylesheets

    - by KaptajnKold
    I'm working with Mozilla v1.7.12 on a constrained device (a Motorola set-top box) trying to resolve some memory leaks. When I dynamically load a stylesheet which refers to some large images, I can see that the amount of consumed memory increases in correspondance with the size of the images. This is what I would expect. Then, when I remove the stylesheet from the DOM, I would expect the memory to be freed. However, this does not happen. This is a problem, because the web application I'm working on needs to be able to dynamically load and and unload stylesheets potentially many times in the lifetime of the page. My question therefore is this: Is what I'm seeing expected behavior or is it a known bug? Is there a way to work around this? I should point out that I've set the expires header to -1 on all the images in the stylesheet.

    Read the article

  • change selects value onchange of another select

    - by Syom
    i start learning jquery few days ago, and i like it very much. but now i have a problem, that can't solve alone. i have two selects <select id="select1"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> <select id="select2"> <option value="1">1day</option> <option value="2">2day</option> <option value="3">3day</option> </select> i need to set #select2 the same value with #select1, when #select1 changes i've red some questions about select tag here, but i need to set "selected" attribute to that option, which have the same value. how can i do it? Thanks

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Issue with a JPA query

    - by boyd4715
    I am trying to execute the following JPA query: public static final String UPDATE_INVENTORY_CUSTOMER_FOR_AMS_MAPPING = "UPDATE Inventory inventory SET" + " inventory.customer.id = :" + DataAccessConstants.PARAM_CUSTOMER_ID + " ,inventory.lastUpdateUserId = :" + DataAccessConstants.PARAM_USER_ID + " where inventory.amsConsignorName = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_NAME + " and inventory.amsConsignorOrgCd = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_ORG_CD + " and inventory.amsConsignorTypeName = :" + DataAccessConstants.PARAM_AMS_CONSIGNOR_TYPE + " and inventory.status.code in (:" + DataAccessConstants.PARAM_STATUS + ")"; but it is seeing the following: update ATL_INVENTORY, set CONSIGNOR_ID=?, LAST_UPDATE_USER_ID=? where AMS_CONSIGNOR_NAME=? and AMS_CONSIGNOR_ORG_CD=? and AMS_CONSIGNOR_TYPE_NAME=? and (CODE in (? , ? , ? , ?)) Any ideal as to why there is a comma after the table name?

    Read the article

  • Can't modify XNA Vector components

    - by Matt H
    I have a class called Sprite, and ballSprite is an instance of that class. Sprite has a Vector2 property called Position. I'm trying to increment the Vector's X component like so: ballSprite.Position.X++; but it causes this error: Cannot modify the return value of 'WindowsGame1.Sprite.Position' because it is not a variable Is it not possible to set components like this? The tooltip for the X and Y fields says "Get or set ..." so I can't see why this isn't working.

    Read the article

  • Forward email to Tumblr

    - by Fenrir
    I am trying to filter/forward emails from a gmail account to a tumblr blog. I have created the tumblr blog and set it up to receive emails via a tumblr email address as seen here: http://www.tumblr.com/docs/en/email_publishing#can The problem is that, as stated by the tumblr email set-up page: "What if I’m having trouble with email publishing? A few tips: Send posts directly to your mobile posting email address. You cannot email another email address and then forward the email from there." This appears to make filtering emails from a gmail account impossible. Anyone know of work around for this?

    Read the article

  • DataGridView - DefaultCellStyle, rows and columns propriority

    - by angelPL
    Hi! In C#, in DataGridView I want to set the BackColor property for the first row and first column. And the cell from first row and first column, should have property from first column, not row - but it does. For example: (table 3 x 3); 'X' - property for first row, 'Y' - property for first column, 'a' - default property should be: Y X X Y a a Y a a but is: X X X Y a a Y a a There is no matter which property I set first: dataGridView1.Rows[0].DefaultCellStyle.BackColor = Color.Lavender; dataGridView1.Columns[0].DefaultCellStyle.BackColor = Color.Beige; or: dataGridView1.Columns[0].DefaultCellStyle.BackColor = Color.Beige; dataGridView1.Rows[0].DefaultCellStyle.BackColor = Color.Lavender; Sorry for my english...

    Read the article

  • Gmock setting out parameter

    - by user1135541
    Have a gmock method, and during test, need to set the out parameter to variable address. So that the out parameter of dequeue, which is data points to variable ch; MOCK_METHOD1(dequeue, void(void* data)); char ch = 'm'; void* a = (void*)&ch; EXPECT_CALL(FQO, dequeue(_)) .WillOnce(/*here I need to set argument to a*/); I tried to figure out side effects: https://code.google.com/p/googlemock/wiki/V1_7_CheatSheet#Side_Effects but keep getting an error.

    Read the article

  • Left outer joins that don't return all the rows from T1

    - by Summer
    Left outer joins should return at least one row from the T1 table if it matches the conditions. But what if the left outer join performs a join successfully, then finds that another criterion is not satisfied? Is there a way to get the query to return a row with T1 values and T2 values set to NULL? Here's the specific query, in which I'm trying to return a list of candidates, and the user's support for those candidates IF such support exists. SELECT c.id, c.name, s.support FROM candidates c LEFT JOIN support s on s.candidate_id = c.id WHERE c.office_id = 5059 AND c.election_id = 92 AND (s.user_id = 2 OR s.user_id IS NULL) --This line seems like the problem ORDER BY c.last_name, c.name The query joins the candidates and support table, but finds that it's a different user who supported this candidate (user_id=3, say). Then the candidate disappears entirely from the result set.

    Read the article

  • NoSuchMethodException while using JAVA Reflection

    - by Appps
    Hi I'm trying to use reflection to invoke a method and update the setter value of that method. But I'm getting NoSuchMethodException while ivoking that method. com.test.Test.setAddress1(java.lang.Double) .But I've this method defined in my Class. Is the problem with my code. Can someone please help me? Thanks in advance. I've my code below. Class[] doubleArrayParamTypes = new Class[ 1 ]; doubleArrayParamTypes[ 0 ] = Double.class; Class class=Class.forName( "com.test.Test"); Object voObject = class.newInstance(); String data="TestData"; performMapping(class,"setAddress1",doubleArrayParamTypes ,voObject,data); /* Reflection to set the data */ private void performMapping(Class class,String methodName,Class[] clazz,Object voObject,Object data) { class.getMethod( "set" + methodName, clazz ).invoke( voObject, data ); }

    Read the article

  • MVC Display Template for Generic Type

    - by Kyle
    I am trying to use the model ListModel as a generic list model. I would like to enter on the page @Html.DisplayForModel() However the MVC is not correctly finding the templated file "ListModel.cshtml". It must work differently for generic models. What should I name the templated file in order for it to correctly be located? public class ListModel<T> { public IEnumerable<T> Models {get;set;} public string NextPage {get;set;} } I would expect it to look for "Shared/DisplayTemplates/ListModel.ascx" but it doesn't. Does anyone know?

    Read the article

  • Any Problems Using Samba as a Windows Domain Controller?

    - by maxam
    We're looking to run a Windows domain using Samba+OpenLDAP on Ubuntu as a domain controller. The documentation out there is a bit spotty and out of date, especially when it comes to installation, which features are supported, and how well. Once this is set up, we hope to be able to use integrated authentication of our IIS sites (including Sharepoint) against the domain controller. Anyone out there who has done this already? Anything specific we should watch out for? Or is it not worth the hassle of trying to set up?

    Read the article

  • R looking for the wrong java version

    - by Veit
    Hi, I installed/uninstalled java jre/jdk now many times and finally installed the older version 1.6.0_17 which is now located at "C:\Program Files\Java\jre6\bin". Now after all if I call 'java -version' within R i can see that R is looking for Java at the old path which is now wrong. The question is: Why is R looking for Java at the wrong path even so the windows path is set correctly? There are no double entrys within the windows path as far as I can see and I restarted R as well as Windows more then once since then. Any Ideas where R takes the wrong path from? On windows shell: $set [..] OS=Windows_NT Path=C:\Program Files\Java\jre6\bin; [..] $ java -version java version "1.6.0_17" Java(TM) SE Runtime Environment (build 1.6.0_17-b04) Java HotSpot(TM) 64-Bit Server VM (build 14.3-b01, mixed mode) within R: $system("java -version") Error: could not open `C:\Program Files (x86)\Java\jre6\lib\i386\jvm.cfg'

    Read the article

  • WinXP Parallels Guest with OS X host -- communication between the two?

    - by Justin
    The setup: Windows XP guest OS running inside Parallels 5 on a OS X 10.6.2 host. I have a win32 application that runs in windows that communicates with other programs by sending out keystrokes to the program in focus. I can run this software inside parallels just fine, but I need a way for it to communicate (via keystrokes) with native OS X applications. For instance, the windows software sends out a continuous stream of a's and w's, based on the program input from an external source. On the other side, I have a Mac version of VLC media player with hotkeys set up for a and w for the two functions I would like to manipulate from the windows software. How can I set up a link between the guest and host OS's with Parallels that lets a windows program send keystrokes to a mac program?

    Read the article

  • Deserialize Xml with empty elements in C#

    - by user204086
    Trying to deserialize some xml snippits into objects. The problem is that I'm getting an invalid format on every empy element tag. I can deserialize the object no problem when all of the elements have values. Or the empty elements are ommitted. Xml Snippit: <foo><propOne>1</propOne><propTwo /></foo> C# Class: [Serialilbe()] public class foo { public foo(){} [XmlElementAttribute(IsNullable = true)] public int? propOne {get;set;} [XmlElementAttribute(IsNullable = true)] public int? propTwo {get;set;} } Is there a setting on the class I can make to adjust the parsing? or Is there an easy way I can apply xsl to remove these elements? or Should I use regEx to remove the empty elements be fore desrializing? or an even better way?

    Read the article

< Previous Page | 631 632 633 634 635 636 637 638 639 640 641 642  | Next Page >