Search Results

Search found 17924 results on 717 pages for 'order'.

Page 664/717 | < Previous Page | 660 661 662 663 664 665 666 667 668 669 670 671  | Next Page >

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Implementing hoverIntent for Drop Down Menu (coming from click_event)

    - by stormeTrooper
    I've just recently started programming, I was hoping for some help. I have a drop down menu that was originally activated by click_event, however I want to now implement hoverIntent in order to make the menu drop. The issue I am having now is being able to use the menu, because whenever I invoke the menu now, once I leave the area that activates the menu, the menu closes. If you could explain to me like I'm five, I'd appreciate it, thanks :) The code I am using as follows: JavaScript: function setupUserConfigMenu() { $('.user_profile_btn').hoverIntent( function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }, function (event) { $('#user_settings_dropdown').animate({height:['toggle', 'swing'] }, 225); }) } HTML: <li> <a href="<%= "#" %>" class="user_profile_btn" title="Your profile page"><%= truncate(current_user.full_name || current_user.name, :length => 28) %> <div class="arrow_down"></div></a> <ul id="user_settings_dropdown"> <li> <a href="<%= current_user.get_url(true) %>"> <%= image_tag current_user.get_thumb_url, :size => "30x30" %> <div> <%= truncate(current_user.full_name || current_user.name, :length => 40) %> <br> View profile </div> </a> </li> <div class="grey_line"></div> <li class="settings_list_item"> <%= link_to "Settings", edit_user_registration_path %> </li> <li class="settings_list_item"> <%= link_to "About", "/about" %> </li> <li class="settings_list_item"> <%= link_to "Logout", destroy_user_session_path, :method => :delete %> </li> </ul> </li>

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • Grid sorting with persistent master sort

    - by MikeWyatt
    I have a UI with a grid. Each record in the grid is sorted by a "master" sort column, let's call it a page number. Each record is a story in a magazine. I want the user to be able to drag and drop a record to a new position in the grid and automatically update the page number field to reflect the updated position. Easy enough, right? Now imagine that I also want to have the grid sortable by any other column (story title, section, author name, etc.). How does the drag and drop operation work now? Revert to page number sort during or after the drag and drop operation? This could confuse the user (why did my sort just change?). It would also result in arbitrary row positioning. Would the story now be before the row that was after it when the user dropped it? Or, would it be after the row that was before it? Those rows may now be widely separated after the master order sort. Disable the drag and drop feature if the grid isn't currently sorted by the page number? This would be easy, but the user might wonder why he can't drag and drop at certain times. Knowing to first sort by page number may not be very intuitive. Let the user rearrange his rows, but not make any changes to the page number? Require the user to enter a "Arrange Stories" mode, in which the grid sort is temporarily switched to page number and drag and drop is enabled? They would then exit the mode, and the previous sort would be reapplied. The big difference between this and the second option is that it would be more explicit than simply clicking on a column header. Any other ideas, or reasons why one of the above is the way to go? EDIT I'd like to point out that any of the above is technically possible, and easy to implement. My question is design-related. What is the most intuitive way to solve this problem, from the user's perspective?

    Read the article

  • Trying to integrate CakePHP and jQuery

    - by user198003
    Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

    Read the article

  • Spring transaction management breaks hibernate cascade

    - by TimmyJ
    I'm having a problem where the addition of spring's transaction management to an application causes Hibernate to throw the following error: org.hibernate.HibernateException: A collection with cascade="all-delete-orphan" was no longer referenced by the owning entity instance: org.fstrf.masterpk.domain.ReportCriteriaBean.treatmentArms org.hibernate.engine.Collections.processDereferencedCollection(Collections.java:96) org.hibernate.engine.Collections.processUnreachableCollection(Collections.java:39) org.hibernate.event.def.AbstractFlushingEventListener.flushCollections(AbstractFlushingEventListener.java:218) org.hibernate.event.def.AbstractFlushingEventListener.flushEverythingToExecutions(AbstractFlushingEventListener.java:77) org.hibernate.event.def.DefaultFlushEventListener.onFlush(DefaultFlushEventListener.java:26) org.hibernate.impl.SessionImpl.flush(SessionImpl.java:1000) org.springframework.orm.hibernate3.SpringSessionSynchronization.beforeCommit(SpringSessionSynchronization.java:135) org.springframework.transaction.support.TransactionSynchronizationUtils.triggerBeforeCommit(TransactionSynchronizationUtils.java:72) org.springframework.transaction.support.AbstractPlatformTransactionManager.triggerBeforeCommit(AbstractPlatformTransactionManager.java:905) org.springframework.transaction.support.AbstractPlatformTransactionManager.processCommit(AbstractPlatformTransactionManager.java:715) org.springframework.transaction.support.AbstractPlatformTransactionManager.commit(AbstractPlatformTransactionManager.java:701) org.springframework.transaction.interceptor.TransactionAspectSupport.commitTransactionAfterReturning(TransactionAspectSupport.java:321) org.springframework.transaction.interceptor.TransactionInterceptor.invoke(TransactionInterceptor.java:116) org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:171) org.springframework.aop.framework.JdkDynamicAopProxy.invoke(JdkDynamicAopProxy.java:204) $Proxy92.saveNewReportCriteria(Unknown Source) org.fstrf.masterpk.domain.logic.MasterPkFacade.saveNewReportCriteria(MasterPkFacade.java:134) org.fstrf.masterpk.controllers.ReportCriteriaController.setupReportType(ReportCriteriaController.java:302) sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) java.lang.reflect.Method.invoke(Method.java:585) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.doInvokeMethod(HandlerMethodInvoker.java:413) org.springframework.web.bind.annotation.support.HandlerMethodInvoker.invokeHandlerMethod(HandlerMethodInvoker.java:134) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.invokeHandlerMethod(AnnotationMethodHandlerAdapter.java:310) org.springframework.web.servlet.mvc.annotation.AnnotationMethodHandlerAdapter.handle(AnnotationMethodHandlerAdapter.java:297) org.springframework.web.servlet.DispatcherServlet.doDispatch(DispatcherServlet.java:875) org.springframework.web.servlet.DispatcherServlet.doService(DispatcherServlet.java:809) org.springframework.web.servlet.FrameworkServlet.processRequest(FrameworkServlet.java:571) org.springframework.web.servlet.FrameworkServlet.doPost(FrameworkServlet.java:511) javax.servlet.http.HttpServlet.service(HttpServlet.java:710) javax.servlet.http.HttpServlet.service(HttpServlet.java:803) org.jboss.web.tomcat.filters.ReplyHeaderFilter.doFilter(ReplyHeaderFilter.java:96) I'm using Spring 2.5 and annotations to implement this management. Here is the class containing the saveNewReportCriteria method (which, as can be seen by the stack trace, is causing the error) @Transactional( propagation = Propagation.REQUIRED, isolation = Isolation.DEFAULT, readOnly = false) public class HibernateReportCriteriaDao implements ReportCriteriaDao{ private HibernateTemplate hibernateTemplate; public Integer saveNewReportCriteria(ReportCriteriaBean reportCriteria) { hibernateTemplate.save(reportCriteria); List<Integer> maxIdList = hibernateTemplate.find("SELECT max(id) from ReportCriteriaBean"); logger.info("ID of newly saved list is: " + maxIdList.get(0)); return maxIdList.get(0); } public void setHibernateTemplate(HibernateTemplate hibernateTemplate) { this.hibernateTemplate = hibernateTemplate; } } Then I added the following sections to my configuration files to tell spring that I am using annotation driven transaction management: <bean id="actgDataSource" class="org.springframework.jndi.JndiObjectFactoryBean"> <property name="jndiName" value="jdbc/actg" /> <property name="resourceRef" value="true" /> </bean> <bean id="transactionManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="actgDataSource" /> </bean> <tx:annotation-driven/> I'm pretty sure that the de-referencing error is being caused due to the proxy class that Spring AOP creates and uses in order to handle transaction management, but I have no idea how I'd go about fixing it.

    Read the article

  • Intent filter for browsing XML (specifically rss) in android

    - by Leif Andersen
    I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

    Read the article

  • Memory allocation and release for UIImage in iPhone?

    - by rkbang
    Hello all, I am using following code in iPhone to get smaller cropped image as follows: - (UIImage*) getSmallImage:(UIImage*) img { CGSize size = img.size; CGFloat ratio = 0; if (size.width < size.height) { ratio = 36 / size.width; } else { ratio = 36 / size.height; } CGRect rect = CGRectMake(0.0, 0.0, ratio * size.width, ratio * size.height); UIGraphicsBeginImageContext(rect.size); [img drawInRect:rect]; UIImage *tempImg = [UIGraphicsGetImageFromCurrentImageContext() retain]; UIGraphicsEndImageContext(); return [tempImg autorelease]; } - (UIImage*)imageByCropping:(UIImage *)imageToCrop toRect:(CGRect)rect { //create a context to do our clipping in UIGraphicsBeginImageContext(rect.size); CGContextRef currentContext = UIGraphicsGetCurrentContext(); //create a rect with the size we want to crop the image to //the X and Y here are zero so we start at the beginning of our //newly created context CGFloat X = (imageToCrop.size.width - rect.size.width)/2; CGFloat Y = (imageToCrop.size.height - rect.size.height)/2; CGRect clippedRect = CGRectMake(X, Y, rect.size.width, rect.size.height); //CGContextClipToRect( currentContext, clippedRect); //create a rect equivalent to the full size of the image //offset the rect by the X and Y we want to start the crop //from in order to cut off anything before them CGRect drawRect = CGRectMake(0, 0, imageToCrop.size.width, imageToCrop.size.height); CGContextTranslateCTM(currentContext, 0.0, drawRect.size.height); CGContextScaleCTM(currentContext, 1.0, -1.0); //draw the image to our clipped context using our offset rect //CGContextDrawImage(currentContext, drawRect, imageToCrop.CGImage); CGImageRef tmp = CGImageCreateWithImageInRect(imageToCrop.CGImage, clippedRect); //pull the image from our cropped context UIImage *cropped = [UIImage imageWithCGImage:tmp];//UIGraphicsGetImageFromCurrentImageContext(); CGImageRelease(tmp); //pop the context to get back to the default UIGraphicsEndImageContext(); //Note: this is autoreleased*/ return cropped; } I am using following line of code in cellForRowAtIndexPath to update the image of the cell: cell.img.image = [self imageByCropping:[self getSmallImage:[UIImage imageNamed:@"goal_image.png"]] toRect:CGRectMake(0, 0, 36, 36)]; Now when I add this table view and pop it from navigation controller, I see a memory hike.I see no leaks but memory keeps climbing. Please note that the images changes for each row and I am creating the controller using lazy initialization that is I create or alloc it whenever I need it. I saw on internet many people facing the same issue, but very rare good solutions. I have multiple views using the same way and I see almost memory raised to 4MB within 20-25 view transitions. What is the good solution to resolve this issue. tnx.

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Tag Cloud JS + Flash. Actual Tags In Cloud Not Clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("some/swfObject/url", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); } </script>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Java threads not working correctly with linkedlist

    - by user69514
    Hi I am working on the sleeping barber problem. with the addition of having priority customer when they arrive they go in the front of the line and they are the next ones to get a haircut. I'm using a linkedlist and if I see a priority customer I put him in the beginning of the list, if the customer is not priority he goes to the end of the list. then I call the wantHaircut method getting the first element of the list. my problem is that the customer are being processed in the order they arrive, and the priority customer have to wait. here is the code where it all happens. any ideas what I am doing wrong? thanks public void arrivedBarbershop(Customer c){ if(waiting < numChairs && c.isPriority()){ System.out.println("Customer " + c.getID() + ": is a priority customer - SITTING -"); mutex.up(); customer_list.addFirst(c); } else if(waiting >= numChairs && c.isPriority()){ System.out.println("Customer " + c.getID() + ": is a priority customer - STANDING -"); mutex.up(); customer_list.addFirst(c); } else if(waiting < numChairs && !c.isPriority()){ waiting++; System.out.println("Customer " + c.getID() + ": arrived, sitting in the waiting room"); customer_list.addLast(c); customers.up(); // increment waiting customers } else if(waiting >= numChairs && !c.isPriority()) { System.out.println("Customer " + c.getID() + ": went to another barber because waiting room was full - " + waiting + " waiting"); mutex.up(); } if(!customer_list.isEmpty()){ this.wantHairCut(customer_list.removeFirst()); } } public void wantHairCut(Customer c) { mutex.up(); barber.down(); // waits for being allowed in barber chair System.out.println("Customer " + c.getID() + ": getting haircut"); try { /** haircut takes between 1 and 2 seconds **/ Thread.sleep(Barbershop.randomInt(1, 2) * 1000); } catch (InterruptedException e) { } System.out.println("Barber: finished cutting customer " + c.getID() + "'s hair"); c.gotHaircut = true; cutting.up(); // signals cutting has finished /** customer must pay now **/ this.wantToCashout(c); }

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Zend Framework decorator subform add a class tag to DD wrapper tag

    - by Samuele
    I have this form: class Request_Form_Prova extends Zend_Form { public function init() { $this->setMethod('post'); $SubForm_Step = new Zend_Form_SubForm(); $SubForm_Step->setAttrib('class','Step'); $this->addSubform($SubForm_Step, 'Chicco'); $PrivacyCheck = $SubForm_Step->createElement('CheckBox', 'PrivacyCheck'); $PrivacyCheck->setLabel('I have read and I agre bla bla...') ->setRequired(true) ->setUncheckedValue(''); $PrivacyCheck->getDecorator('Label')->setOption('class', 'inline'); $SubForm_Step->addElement($PrivacyCheck); $SubForm_Step->addElement('submit', 'submit', array( 'ignore' => true, 'label' => 'OK', )); } } That generate this HTML: <form enctype="application/x-www-form-urlencoded" method="post" action=""> <dl class="zend_form"> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> <dt id="Chicco-PrivacyCheck-label"><label for="Chicco-PrivacyCheck" class="inline required">I have read and I agre bla bla...</label></dt> <dd id="Chicco-PrivacyCheck-element"> <input type="hidden" name="Chicco[PrivacyCheck]" value=""><input type="checkbox" name="Chicco[PrivacyCheck]" id="Chicco-PrivacyCheck" value="1"> </dd> <dt id="submit-label">&nbsp;</dt> <dd id="submit-element"> <input type="submit" name="Chicco[submit]" id="Chicco-submit" value="OK"> </dd> </dl> </fieldset> </dd> </dl> </form> How can I add a class="Test" to the <dd id="Chicco-element"> elemnt? In order to have it like that: <dd id="Chicco-element" class="Test"> I thought something like that but it don't work: $SubForm_Step->getDecorator('DdWrapper')->setOption('class', 'Test'); OR $SubForm_Step->getDecorator('DtDdWrapper')->setOption('class', 'Test'); How can I do it? And last question: How can I wrap that DD and DT element of a SubForm in another DL element? Like that: ( second line ) <dl class="zend_form"> <dl> <dt id="Chicco-label">&nbsp;</dt> <dd id="Chicco-element"> <fieldset id="fieldset-Chicco" class="Step"> <dl> .......

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • Sandbox "Sorry — your last action could not be completed"

    - by aron
    My site was working fine with PayPal's sandbox, and then all of a sudden it stopped. Now I get the wonderful error Sandbox "Sorry — your last action could not be completed" This is my HTML: <body onload="document.Paypal.submit();"> <!-- item_number should get passed back --> <form name="Paypal" method="post" action="https://www.sandbox.paypal.com cgi-bin/webscr" id="Paypal"> <div> <input type="hidden" name="__VIEWSTATE" id="__VIEWSTATE" value="/wEPDwUKLTkyNTEyNzc0NGRk0LKGvSMTla6LgHpbOsdk7iC0iXE=" /> </div> <div> <input type="hidden" name="__EVENTVALIDATION" id="__EVENTVALIDATION" value="/wEWCALKhatPArLPtrsEAreImG4CweeH+AkCgMPhowcC+NaM4gQC+Y2VqwoCouzSnwEVXI9UvQxqI2UcdQ4SmcSWqfEZNw==" /> </div> <input type="hidden" name="cmd" value="_cart" /> <input type="hidden" name="upload" value="1" /> <!-- The following is for itemized PayPal data instead of the aggregated version --> <input type="hidden" name="item_name_1" value="LEADING SKILLS 4/10/2012 6:00 PM Section: Members " /> <input type="hidden" name="amount_1" value="250.00" /> <input type="hidden" name="quantity_1" value="2" /> <input type="hidden" name="handling_cart" value="7.00" /> <input type="hidden" name="tax_cart" value="35.00" /> <!-- STANDARD DATA --> <input name="business" type="hidden" id="business" value="[email protected]" /> <input name="invoice" type="hidden" id="invoice" value="TS-1E8B59A0-B" /> <input type="hidden" name="no_note" value="0" /> <input name="currency_code" type="hidden" id="currency_code" value="USD" /> <input name="shipCountry" type="hidden" id="shipCountry" /> <input type="hidden" name="return" value="http://rockclimbing.venueblue.com/Gateway/paypal/Complete.aspx?id=db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="cancel_returnUrl" type="hidden" id="cancel_returnUrl" value="http://rockclimbing.venueblue.com/ShoppingCart.aspx" /> <input type="hidden" name="cn" value="How did you hear about us?" /> <input name="custom" type="hidden" id="custom" value="db86c0bf-beb8-4e37-b495-bed1d3e7e6f3" /> <input name="notify_url" type="hidden" id="notify_url" value="http://rockclimbing.venueblue.com/Gateway/Paypal/IPN.aspx" /> <input type="submit" value="Submit Payment Info" style="display:none;" /> Processing Order.... </form> </body> Anyone have a clue what happened?

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • Mac Safari randomly recreating cookie when I refresh my login screen. Very bizarre

    - by mcintyre321
    We have found an issue in our app where Safari on the Mac randomly recreates a login cookie from a logged off session. I have a fiddler archive with this behaviour here. Note that some stuff has been removed from this to make it easier to get, but nothing which sets a cookie or anything has been taken out - only repetitions of requests 3-8. I'll talk you through the running order Request 1: user logs out via call to /logout.aspx - Set-Cookie returned setting cookie expiry date to 1999 Requests 2-8: user refreshes login page sending calls to root or /res/en-US/s.js - no cookie is sent to server or received back, and access is denied. I have cut out a lot of requests of this nature from the log as they are boring Request 9: request for /res/en-US/s.js - Hv3 authentication cookie has mysteriously reappeared! Wat. There was NO set-cookie! WTFF! Request 10+ : now the cookie has reappeared, the site logs the user in AGAIN The cookie, when examined in Safari looks like <dict> <key>Created</key> <real>259603523.26834899</real> <key>Domain</key> <string>.mysite.dev</string> <key>Expires</key> <date>2010-03-24T16:05:22Z</date> <key>HttpOnly</key> <string>TRUE</string> <key>Name</key> <string>.Hv3</string> <key>Path</key> <string>/</string> </dict> One thing to note is that in Safari, the cookie domain is .mysite.dev not mysite.dev (which is the cookie domain specified in web.config) - however, given that access is denied in requests 2-8, it looks like the cookie has expired OK. If you look in the list of cookies in the browser during 2-8, the .Hv3 cookie is not there. Is this our bug or Safari's? What can I do to stop it happening?

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • Problems with MYSQL database

    - by shinjuo
    I have a database that worked fine until I decided to add a log onto the page. here is what I have now: <body> <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { require("serverInfo.php"); mysql_query("UPDATE `cardLists` SET `AmountLeft` = `AmountLeft` + ".mysql_real_escape_string($_POST['Add'])." WHERE `cardID` = '".mysql_real_escape_string($_POST['Cards'])."'"); echo "\"" .$_POST['Add'] ."\" has been added to the inventory amount for the card \"". $_POST['Cards']. "\""; mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); } ?> <form action="<?php echo $_SERVER['PHP_SELF']; ?>" method="post"> <?php require("serverInfo.php"); ?> <?php $res = mysql_query("SELECT * FROM cardLists order by cardID") or die(mysql_error()); echo "<select name = 'Cards'>"; while($row=mysql_fetch_assoc($res)) { echo "<option value=\"$row[cardID]\">$row[cardID]</option>"; } echo "</select>"; ?> Amount to Add: <input type="text" name="Add" maxlength="8" /> Changes Made By: <select name="Person"> <option value="justin">Justin</option> <option value="chris">Chris</option> <option value="matt">Matt</option> <option value="dan">Dan</option> <option value="tim">Tim</option> <option value="amanda">Amanda</option> </select> <input type="submit" name ="submit" onClick= "return confirm( 'Are you sure you want to add this amount?');"> </form> <br /> <input type="button" name="main" value="Return To Main" onclick="window.location.href='index.php';" /> </body> </html> it works fine until I added the: mysql_query("INSERT INTO `log` (`changes`, `amount`, `cardID`, `person`, Date)VALUES('ADDED','$_POST['Add']','$_POST['Cards']', '$_POST['Person']', NOW())"); mysql_close($link); Can anyone see what is going on?

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Optimize slow ranking query

    - by Juan Pablo Califano
    I need to optimize a query for a ranking that is taking forever (the query itself works, but I know it's awful and I've just tried it with a good number of records and it gives a timeout). I'll briefly explain the model. I have 3 tables: player, team and player_team. I have players, that can belong to a team. Obvious as it sounds, players are stored in the player table and teams in team. In my app, each player can switch teams at any time, and a log has to be mantained. However, a player is considered to belong to only one team at a given time. The current team of a player is the last one he's joined. The structure of player and team is not relevant, I think. I have an id column PK in each. In player_team I have: id (PK) player_id (FK -> player.id) team_id (FK -> team.id) Now, each team is assigned a point for each player that has joined. So, now, I want to get a ranking of the first N teams with the biggest number of players. My first idea was to get first the current players from player_team (that is one record top for each player; this record must be the player's current team). I failed to find a simple way to do it (tried GROUP BY player_team.player_id HAVING player_team.id = MAX(player_team.id), but that didn't cut it. I tried a number of querys that didn't work, but managed to get this working. SELECT COUNT(*) AS total, pt.team_id, p.facebook_uid AS owner_uid, t.color FROM player_team pt JOIN player p ON (p.id = pt.player_id) JOIN team t ON (t.id = pt.team_id) WHERE pt.id IN ( SELECT max(J.id) FROM player_team J GROUP BY J.player_id ) GROUP BY pt.team_id ORDER BY total DESC LIMIT 50 As I said, it works but looks very bad and performs worse, so I'm sure there must be a better way to go. Anyone has any ideas for optimizing this? I'm using mysql, by the way. Thanks in advance Adding the explain. (Sorry, not sure how to format it properly) id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY t ALL PRIMARY NULL NULL NULL 5000 Using temporary; Using filesort 1 PRIMARY pt ref FKplayer_pt77082,FKplayer_pt265938,new_index FKplayer_pt77082 4 t.id 30 Using where 1 PRIMARY p eq_ref PRIMARY PRIMARY 4 pt.player_id 1 2 DEPENDENT SUBQUERY J index NULL new_index 8 NULL 150000 Using index

    Read the article

< Previous Page | 660 661 662 663 664 665 666 667 668 669 670 671  | Next Page >