Search Results

Search found 31621 results on 1265 pages for '13 10'.

Page 668/1265 | < Previous Page | 664 665 666 667 668 669 670 671 672 673 674 675  | Next Page >

  • [URGENT] IE: ‘nodeType’ is null or not an object

    - by Patrick
    hi, I'm having this issue on my website in IE (6,7,8): ‘nodeType’ is null or not an object The error refers to "f.nodeType" property. Basically f is undefined, so the issue is before, but I cannot fix it. Could you give me some help ? www.donatellabernardi.ch/drupal (from IE developer toolbar debug it appears to be this line that is throwing the error) (autocolumn.min.js line 13 expanded below for readability) function split($putInHere,$pullOutHere,$parentColumn,height){ if($pullOutHere.children().length){ $cloneMe=$pullOutHere.children(":first"); $clone=$cloneMe.clone(true); if($clone.attr("nodeType")==1&&!$clone.hasClass("dontend")){ ^^^^^^^^^^^^^^^^^^^^^^^^^^ Chokes on $putInHere.append($clone); if($clone.is("img")&&$parentColumn.height()<height+20){ $cloneMe.remove(); }else if(!$cloneMe.hasClass("dontsplit")&&$parentColumn.height()<height+20){ $cloneMe.remove(); }else if($clone.is("img")||$cloneMe.hasClass("dontsplit")){ $clone.remove(); }else{ $clone.empty(); if(!columnize($clone,$cloneMe,$parentColumn,height)){ if($cloneMe.children().length){ split($clone,$cloneMe,$parentColumn,height); } } if($clone.get(0).childNodes.length==0){ $clone.remove(); } } } } } Thanks

    Read the article

  • Xcode raises exception when refactoring

    - by Sam Gwydir
    When I run a refactor on my code in xcode, all the files are correctly refactored except one, and when I click to check the changes made in that file, the following 'Internal Error Occurs': Uncaught Exception: Invalid parameter not satisfying: fileName Stack Backtrace: The stack backtrace has been logged to the console. Here is what it spat out in the console: 4/7/10 06:47:30 Xcode[35355] [MT] Uncaught Exception: Invalid parameter not satisfying: fileName Backtrace: 0 0x92842bbd __raiseError (in CoreFoundation) 1 0x914b9509 objc_exception_throw (in libobjc.A.dylib) 2 0x92842908 +[NSException raise:format:arguments:] (in CoreFoundation) 3 0x98801dc3 -[NSAssertionHandler handleFailureInMethod:object:file:lineNumber:description:] (in Foundation) 4 0x98db0f8e -[NSDocument(NSDeprecated) initWithContentsOfFile:ofType:] (in AppKit) 5 0x0075c07e -[PBXTextFileDocument initWithContentsOfFile:ofType:] (in DevToolsInterface) 6 0x007dc5be -[PBXFileDocument initWithFileReference:usingType:] (in DevToolsInterface) 7 0x00b1c0f8 -[XCRefactoringFileChangeSet(XCRefactoringModule_HelperMethods) referencedTextFileDocument] (in DevToolsInterface) 8 0x00b1d1f4 -[XCRefactoringEditableExistingTextFileChangeSet populateComparator:] (in DevToolsInterface) 9 0x00ab19b7 -[XCRefactoringModuleFileItem populateComparator:previewFinished:] (in DevToolsInterface) 10 0x00aa4606 -[XCRefactoringModule(MasterListDelegate) outlineViewSelectionDidChange:] (in DevToolsInterface) 11 0x987381cb _nsnote_callback (in Foundation) 12 0x927ca3f9 __CFXNotificationPost (in CoreFoundation) 13 0x927c9e2a _CFXNotificationPostNotification (in CoreFoundation) 14 0x9872d098 -[NSNotificationCenter postNotificationName:object:userInfo:] (in Foundation) 15 0x9873a475 -[NSNotificationCenter postNotificationName:object:] (in Foundation) 16 0x98af1de2 -[NSTableView _enableSelectionPostingAndPost] (in AppKit) 17 0x98bd11d0 -[NSTableView mouseDown:] (in AppKit) 18 0x98bcfeea -[NSOutlineView mouseDown:] (in AppKit) 19 0x007596c3 -[PBXExtendedOutlineView mouseDown:] (in DevToolsInterface) 20 0x98b6e548 -[NSWindow sendEvent:] (in AppKit) 21 0x00757a06 -[XCWindow sendEvent:] (in DevToolsInterface) 22 0x98a871af -[NSApplication sendEvent:] (in AppKit) 23 0x006f6dec -[PBXExtendedApplication sendEvent:] (in DevToolsInterface) 24 0x98a1ac4f -[NSApplication run] (in AppKit) 25 0x98a12c85 NSApplicationMain (in AppKit) 26 0x0000eee1 27 0x000021a5 If you would like to take a look at the project I'm working on, here is a link to download my xcodeproject: Tea Timer.zip To recreate my problem, open Timer.h, attempt to refactor timeField to minuteField, use the preview function of refactor and then select Timer.m, to look at the changes supposedly made within. It will then raise this error without editing the file.

    Read the article

  • [NSCFNumber _isNaturallyRTL]: unrecognized selector sent to instance 0x605ac10

    - by Risma
    my app got crashed an showed that keyword. There is no error and warning. can some body help me?? this is stack that showed : Call stack at first throw: ( 0 CoreFoundation 0x012ccbe9 __exceptionPreprocess + 185 1 libobjc.A.dylib 0x014215c2 objc_exception_throw + 47 2 CoreFoundation 0x012ce6fb -[NSObject(NSObject) doesNotRecognizeSelector:] + 187 3 CoreFoundation 0x0123e366 ___forwarding___ + 966 4 CoreFoundation 0x0123df22 _CF_forwarding_prep_0 + 50 5 UIKit 0x0042d35e -[UITextField setText:] + 53 6 Koder232_risma_edited 0x0006427a -[FilePropertiesViewController viewWillAppear:] + 442 7 UIKit 0x003c4d52 -[UIView(Hierarchy) _willMoveToWindow:withAncestorView:] + 207 8 UIKit 0x003cfa2b -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 378 9 UIKit 0x003cfa5c -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 427 10 UIKit 0x003cfa5c -[UIView(Hierarchy) _makeSubtreePerformSelector:withObject:withObject:copySublayers:] + 427 11 UIKit 0x003c6b36 -[UIView(Internal) _addSubview:positioned:relativeTo:] + 370 12 UIKit 0x003c514f -[UIView(Hierarchy) addSubview:] + 57 13 UIKit 0x006ad8ae -[UIPopoverView presentFromRect:inView:contentSize:backgroundStyle:animated:] + 1920 14 UIKit 0x006a0a4c -[UIPopoverView presentFromRect:inView:animated:] + 236 15 UIKit 0x006d9b20 -[UIPopoverController presentPopoverFromRect:inView:permittedArrowDirections:animated:] + 1046 16 Koder232_risma_edited 0x0001f90f -[codeViewController arrangeTabWithTypeGesture:andNumtag:] + 4683 17 Koder232_risma_edited 0x0001e68f -[codeViewController setTap2:] + 99 18 UIKit 0x0061e9c7 -[UIGestureRecognizer _updateGestureWithEvent:] + 727 19 UIKit 0x0061a9d6 -[UIGestureRecognizer _delayedUpdateGesture] + 47 20 UIKit 0x00620fa5 _UIGestureRecognizerUpdateObserver + 584 21 UIKit 0x0062118a _UIGestureRecognizerUpdateGesturesFromSendEvent + 51 22 UIKit 0x003bc6b4 -[UIWindow _sendGesturesForEvent:] + 1292 23 UIKit 0x003b7f87 -[UIWindow sendEvent:] + 105 24 UIKit 0x0039b37a -[UIApplication sendEvent:] + 447 25 UIKit 0x003a0732 _UIApplicationHandleEvent + 7576 26 GraphicsServices 0x0191fa36 PurpleEventCallback + 1550 27 CoreFoundation 0x012ae064 __CFRUNLOOP_IS_CALLING_OUT_TO_A_SOURCE1_PERFORM_FUNCTION__ + 52 28 CoreFoundation 0x0120e6f7 __CFRunLoopDoSource1 + 215 29 CoreFoundation 0x0120b983 __CFRunLoopRun + 979 30 CoreFoundation 0x0120b240 CFRunLoopRunSpecific + 208 31 CoreFoundation 0x0120b161 CFRunLoopRunInMode + 97 32 GraphicsServices 0x0191e268 GSEventRunModal + 217 33 GraphicsServices 0x0191e32d GSEventRun + 115 34 UIKit 0x003a442e UIApplicationMain + 1160 35 Koder232_risma_edited 0x00002680 main + 102 36 Koder232_risma_edited 0x00002611 start + 53 37 ??? 0x00000001 0x0 + 1 )

    Read the article

  • asp.net mvc formcollection

    - by mazhar
    public ActionResult Edit(int id, FormCollection formValues) { 07. 08. // Retrieve existing dinner 09. Dinner dinner = dinnerRepository.GetDinner(id); 10. 11. // Update dinner with form posted values 12. dinner.Title = Request.Form["Title"]; 13. dinner.Description = Request.Form["Description"]; 14. dinner.EventDate = DateTime.Parse(Request.Form["EventDate"]); 15. dinner.Address = Request.Form["Address"]; 16. dinner.Country = Request.Form["Country"]; 17. dinner.ContactPhone = Request.Form["ContactPhone"]; 18. 19. // Persist changes back to database 20. dinnerRepository.Save(); 21. 22. // Perform HTTP redirect to details page for the saved Dinner 23. return RedirectToAction("Details", new { id = dinner.DinnerID }); 24.} formValues is not used in any form, what is the used of it.

    Read the article

  • Ruby array index method not working returning NIL value

    - by Rails beginner
    Here is the error: => ["Mænd med navnet Kim", "30.094", "29.946", "-148", "Kvinder med navnet Kim", "341", "345", "4", "Mænd med navnet Kim Hansen", "1.586", "1.573", "-13", "Kvin der med navnet Kim Hansen", "5", "5", "0", "Mænd og kvinder med efternavnet Hans en", "226.040", "223.478", "-2.562"] irb(main):094:0> irb(main):095:0* @tester.index("Mænd med navnet Kim") => nil irb(main):096:0> @tester.index("Kvinder med navnet Kim") => 4 irb(main):097:0> @tester.index("Mænd med navnet Kim Hansen") => nil irb(main):098:0> @tester.index("Kvinder med navnet Kim Hansen") => 12 irb(main):099:0> @tester.index("Mænd og kvinder med efternavnet Hansen") => nil irb(main):100:0> Example tried Gsub method: <ap(&:text).map{|d| d.delete "'"}.map{|d| d.gsub("æ", "#844"} irb(main):113:1> ) SyntaxError: (irb):112: syntax error, unexpected '}', expecting ')' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds/console.rb:44:in `start' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds/console.rb:8:in `start' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds.rb:23:in `<top (required)>' from script/rails:6:in `require' from script/rails:6:in `<main>' <ap(&:text).map{|d| d.delete "'"}.map{|d| d.gsub("æ", "#844")} Encoding::CompatibilityError: incompatible encoding regexp match (CP850 regexp w ith UTF-8 string) from (irb):114:in `gsub' from (irb):114:in `block in irb_binding' from (irb):114:in `map' from (irb):114 from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds/console.rb:44:in `start' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds/console.rb:8:in `start' from C:/Ruby193/lib/ruby/gems/1.9.1/gems/railties-3.0.9/lib/rails/comman ds.rb:23:in `<top (required)>' from script/rails:6:in `require' from script/rails:6:in `<main>'

    Read the article

  • What Is The Proper Location For One-Offs In VCS Repos?

    - by Joe Clark
    I have recently started using Mercurial as our VCS. Over the years, I have used RCS, CVS, and - for the last 5 years - SVN. Back 13 years ago, when I primarily used CVS and RCS, large projects went into CVS and one-offs were edited in place on the specific server and stored in RCS. This worked well as the one-offs were usually specific to the server and the servers were backed up nightly. Jump forward a decade and a lot of the one-off scripts became less centralized - they might be needed on any server at some random time. This was also OK, because now I was a begrudging SVN user. Everything (except for docs) got dumped into one repo. Jump to 2010. Now I am using Mercurial and am putting large projects in their own repo again. But what to do with the one-offs? The options as I see them: A repo for each script. It seems a bit cluttered to create a repo for every one page script that might get ran once a year. RCS Not an option. There are many possible servers that might need a specific script. Continuing to use SVN just for one-offs. No. There no advantage I see over the next option. Create a repo in Mercurial named "one-offs". This seems the most workable. The last option seems the best to me - however; is there a best practice regarding this? You also might be wondering if these scripts are truly one-offs if they will be reused. Some of them may be reused 6 months or a year from now - some, never. However, nearly all of them involve several man-hours of work due to either complex logic or extensive error checking. Simply discarding them is not efficient.

    Read the article

  • C# Textbox validation should only accept integer values, but allows letters as well

    - by sonny5
    if (textBox1.Text != "") // this forces user to enter something { // next line is supposed to allow only 0-9 to be entered but should block all... // ...characters and should block a backspace and a decimal point from being entered.... // ...but it is also allowing characters to be typed in textBox1 if(!IsNumberInRange(KeyCode,48,57) && KeyCode!=8 && KeyCode!=46) // 46 is a "." { e.Handled=true; } else { e.Handled=false; } if (KeyCode == 13) // enter key { TBI1 = System.Convert.ToInt32(var1); // converts to an int Console.WriteLine("TBI1 (var1 INT)= {0}", var1); Console.WriteLine("TBI1= {0}", TBI1); } if (KeyCode == 46) { MessageBox.Show("Only digits...no dots please!"); e.Handled = !char.IsDigit(e.KeyChar) && !char.IsControl(e.KeyChar); } } else { Console.WriteLine("Cannot be empty!"); } // If I remove the outer if statement and skip checking for an empty string, then // it prevents letters from being entered in the textbox. I need to do both, prevent an // empty textbox AND prevent letters from being entered. // thanks, Sonny5

    Read the article

  • Jquery button.click bug?

    - by Chris
    I have the following home-grown jquery plugin: (function($) { $.fn.defaultButton = function(button) { var field = $(this); var target = $(button); if (field.attr('type').toLowerCase() != 'text') return; field.keydown(function (e) { if ((e.which || e.keyCode) == 13) { console.log('enter'); target.click(); return false; } }); } })(jQuery); I'm using it like so: $('#SignUpForm input').defaultButton('#SignUpButton'); $('#SignUpButton').click(function(e) { console.log('click'); $.ajax({ type: 'post', url: '<%=ResolveUrl("~/WebServices/ForumService.asmx/SignUp")%>', contentType: 'application/json; charset=utf-8', dataType: 'json', data: JSON.stringify({ email: $('#SignUpEmail').val(), password: $('#SignUpPassword').val() }), success: function(msg) { $.modal.close(); } }); }); The first time, it works. The second time, nothing happens. I see enter and click the first time in the firebug log, but the second time I only see the enter message. It's almost like the button's click handler is being unregistered somehow. Any thoughts?

    Read the article

  • How to handle custom Java exception in Flex app.

    - by mico
    Hello, we are using BlazeDS as a proxy between Flex and Java. The approach is the same as in (http://www.flexpasta.com/index.php/2008/05/16/exception-handling-with-blazeds-and-flex/) Java exception declaration: public class FlexException extends RuntimeException { private String name = 'John'; public FlexException(String message) { super(message); } public String getName() { return name; } } Then, we are throwing it: public void testMethod(String str) throws Exception { throw new FlexException("Custom exception"); } Flex part: private function faultHandler(event:FaultEvent):void { var errorMessage:ErrorMessage = event.message as ErrorMessage; trace("error++"); } and remote object is instantiated here: <mx:RemoteObject id="mySample" destination="mySample" channelSet="{cs1}" fault="faultHandler(event)" /> But in event.fault I get "Server.Processing" and event.faultString equals "There was an unhandled failure on the server. Custom exception" How can I receive the data is specified in exception props ? BlazeDS log is similar to the log that was mentioned in the comment [BlazeDS] 11:28:13.906 [DEBUG] Serializing AMF/HTTP response Version: 3 (Message #0 targetURI=/2/onStatus, responseUR|-) (Typed Object #0 ‘flex.messaging.messages.ErrorMessage’) headers = (Object #1) rootCause = null body = null correlationId = “2F1126D7-5658-BE40-E27C-7B43F3C5DCDD” faultDetail = null faultString = “Login required before authorization can proceed.” clientId = “C4F0E77C-3208-ECDD-1497-B8D070884830? timeToLive = 0.0 destination = “books” timestamp = 1.204658893906E12 extendedData = null faultCode = “Client.Authentication” messageId = “C4F0E77C-321E-6FCE-E17D-D9F1C16600A8? So the quesion is why rootClause is null? How can I get that Exception object not just a string 'Custom exception'?

    Read the article

  • How to use Struts2-jQuery Plugin with sitemesh

    - by fayway
    Hi I have this error when I try to include the tag (http://code.google.com/p/struts2-jquery/wiki/HeadTag) in a sitemesh decorator main.jsp (decorator) <%@ taglib uri="http://www.opensymphony.com/sitemesh/decorator" prefix="decorator" %> <%@ taglib prefix="s" uri="/struts-tags"%> <%@ taglib prefix="sj" uri="/struts-jquery-tags"%> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> <title>My Project- <decorator:title /></title> <sj:head compressed="false" jqueryui="true"></sj:head> </head> <body> <!-- head --> .... Tomcat Error exception java.lang.RuntimeException: org.apache.jasper.JasperException: An exception occurred processing JSP page /decorators/main.jsp at line 11 8: <head> 9: <meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> 10: <title>My Project- <decorator:title /></title> 11: <sj:head compressed="false" jqueryui="true"></sj:head> 12: </head> 13: <body> 14: <!-- head --> Stacktrace: com.opensymphony.sitemesh.webapp.decorator.BaseWebAppDecorator.render(BaseWebAppDecorator.java:39) com.opensymphony.sitemesh.webapp.SiteMeshFilter.doFilter(SiteMeshFilter.java:84) Please any idea ? Thanks in advance

    Read the article

  • I set up better-edit-in-place but still cannot edit in place in Rails

    - by Angela
    I installed the plugin better-edit-in-place (http://github.com/nakajima/better-edit-in-place) but I dont' seem to be able to make it work. When I use firebug, it is rendering the value to be edited correctly: <span rel="/emails/1" id="email_1_days" class="editable">7</span> And it is showing the full javascript which should work on class editable: var Editable = Class.create({ 5 initialize: function(element, options) { 6 this.element = $(element); 7 Object.extend(this, options); 8 9 // Set default values for options 10 this.editField = this.editField || {}; 11 this.editField.type = this.editField.type || 'input'; 12 this.onLoading = this.onLoading || Prototype.emptyFunction; 13 this.onComplete = this.onComplete || Prototype.emptyFunction; 14 15 this.field = this.parseField(); 16 this.value = this.element.innerHTML; 17 18 this.setupForm(); 19 this.setupBehaviors(); 20 }, 21 22 // In order to parse the field correctly, it's necessary that the element 23 // you want to edit in place for have an id of (model_name)_(id)_(field_name). 24 // For example, if you want to edit the "caption" field in a "Photo" model, 25 // your id should be something like "photo_#{@photo.id}_caption". 26 // If you want to edit the "comment_body" field in a "MemberBlogPost" model, 27 // it would be: "member_blog_post_#{@member_blog_post.id}_comment_body" 28 parseField: function() { 29 var matches = this.element.id.match(/(.*)_\d*_(.*)/); 30 this.modelName = matches[1]; 31 this.fieldName = matches[2]; 32 if (this.editField.foreignKey) this.fieldName += '_id'; 33 return this.modelName + '[' + this.fieldName + ']'; 34 }, But when I point my mouse at the element, no in-place-editing action!

    Read the article

  • Heroku and Refinerycms: Application failed to start ~ attachment_fu problem

    - by John Deely
    Ok so I'm trying to get Refinerycms working with Heroku, and I'm new at all of this. I've set up an amazon s3 account and added keys and ids to the amazon_s3.yml files. When launched on Heroku at gart.heroku.com I get the following error: App failed to start /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu/backends/s3_backend.rb:187:in read': No such file or directory - /disk1/home/slugs/141557_e8490b3_d5eb/mnt/config/amazon_s3.yml (Errno::ENOENT) from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu/backends/s3_backend.rb:187:inincluded' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu.rb:123:in include' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/vendor/plugins/attachment_fu/lib/technoweenie/attachment_fu.rb:123:inhas_attachment' from /disk1/home/slugs/141557_e8490b3_d5eb/mnt/app/models/image.rb:13 from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:in gem_original_require' from /usr/local/lib/ruby/site_ruby/1.8/rubygems/custom_require.rb:31:inrequire' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.5/lib/active_support/dependencies.rb:158:in require' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-2.3.5/lib/active_support/dependencies.rb:265:inrequire_or_load' ... 42 levels... from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:in instance_eval' from /usr/local/lib/ruby/gems/1.8/gems/rack-1.0.1/lib/rack/builder.rb:29:ininitialize' from /home/heroku_rack/heroku.ru:1:in `new' from /home/heroku_rack/heroku.ru:1 The s3_backend.rb line 187 contains: @@s3_config = @@s3_config = YAML.load(ERB.new(File.read(@@s3_config_path)).result)[RAILS_ENV].symbolize_keys Any help would be great!

    Read the article

  • Compute the Length of Largest substring that starts and ends with the same substring

    - by Deepak
    Hi People, Below is the Problem Statement: PS: Given a string and a non-empty substring sub, compute recursively the largest substring which starts and ends with sub and return its length. Examples: strDist("catcowcat", "cat") ? 9 strDist("catcowcat", "cow") ? 3 strDist("cccatcowcatxx", "cat") ? 9 Below is my Code: (Without recursion)//since i found it hard to implement with recursion. public int strDist(String str, String sub){ int idx = 0; int max; if (str.isEmpty()) max = 0; else max=1; while ((idx = str.indexOf(sub, idx)) != -1){ int previous=str.indexOf(sub, idx); max = Math.max(max,previous); idx++; } return max; } Its working for few as shown below but returns FAIL for others. Expected This Run strDist("catcowcat", "cat") ? 9 6 FAIL strDist("catcowcat", "cow") ? 3 3 OK strDist("cccatcowcatxx", "cat") ? 9 8 FAIL strDist("abccatcowcatcatxyz", "cat") ? 12 12 OK strDist("xyx", "x") ? 3 2 FAIL strDist("xyx", "y") ? 1 1 OK strDist("xyx", "z") ? 0 1 FAIL strDist("z", "z") ? 1 1 OK strDist("x", "z") ? 0 1 FAIL strDist("", "z") ? 0 0 OK strDist("hiHellohihihi", "hi") ? 13 11 FAIL strDist("hiHellohihihi", "hih") ? 5 9 FAIL strDist("hiHellohihihi", "o") ? 1 6 FAIL strDist("hiHellohihihi", "ll") ? 2 4 FAIL Could you let me whats wrong with the code and how to return the largest substring that begins and ends with sub with its respective length.

    Read the article

  • iPhone app crashes on start-up, in stack-trace only messages from built-in frameworks

    - by Aleksejs
    My app some times crashes at start-up. In stack-trace only messages from built-in frameworks. An excerpt from a crash log: OS Version: iPhone OS 3.1.3 (7E18) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGBUS) Exception Codes: KERN_PROTECTION_FAILURE at 0x000e6000 Crashed Thread: 0 Thread 0 Crashed: 0 CoreGraphics 0x339305d8 argb32_image_mark_RGB32 + 704 1 CoreGraphics 0x338dbcd4 argb32_image + 1640 2 libRIP.A.dylib 0x320d99f0 ripl_Mark 3 libRIP.A.dylib 0x320db3ac ripl_BltImage 4 libRIP.A.dylib 0x320cc2a0 ripc_RenderImage 5 libRIP.A.dylib 0x320d5238 ripc_DrawImage 6 CoreGraphics 0x338d7da4 CGContextDelegateDrawImage + 80 7 CoreGraphics 0x338d7d14 CGContextDrawImage + 364 8 UIKit 0x324ee68c compositeCGImageRefInRect 9 UIKit 0x324ee564 -[UIImage(UIImageDeprecated) compositeToRect:fromRect:operation:fraction:] 10 UIKit 0x32556f44 -[UINavigationBar drawBackButtonBackgroundInRect:withStyle:pressed:] 11 UIKit 0x32556b00 -[UINavigationItemButtonView drawRect:] 12 UIKit 0x324ecbc4 -[UIView(CALayerDelegate) drawLayer:inContext:] 13 QuartzCore 0x311cacfc -[CALayer drawInContext:] 14 QuartzCore 0x311cab00 backing_callback 15 QuartzCore 0x311ca388 CABackingStoreUpdate 16 QuartzCore 0x311c978c -[CALayer _display] 17 QuartzCore 0x311c941c -[CALayer display] 18 QuartzCore 0x311c9368 CALayerDisplayIfNeeded 19 QuartzCore 0x311c8848 CA::Context::commit_transaction(CA::Transaction*) 20 QuartzCore 0x311c846c CA::Transaction::commit() 21 QuartzCore 0x311c8318 +[CATransaction flush] 22 UIKit 0x324f5e94 -[UIApplication _reportAppLaunchFinished] 23 UIKit 0x324a7a80 -[UIApplication _runWithURL:sourceBundleID:] 24 UIKit 0x324f8df8 -[UIApplication handleEvent:withNewEvent:] 25 UIKit 0x324f8634 -[UIApplication sendEvent:] 26 UIKit 0x324f808c _UIApplicationHandleEvent 27 GraphicsServices 0x335067dc PurpleEventCallback 28 CoreFoundation 0x323f5524 CFRunLoopRunSpecific 29 CoreFoundation 0x323f4c18 CFRunLoopRunInMode 30 UIKit 0x324a6c00 -[UIApplication _run] 31 UIKit 0x324a5228 UIApplicationMain 32 Journaler 0x000029ac main (main.m:14) 33 Journaler 0x00002948 start + 44 File main.m is simple as possible: #import <UIKit/UIKit.h> int main(int argc, char *argv[]) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; int retVal = UIApplicationMain(argc, argv, nil, nil); // line 14 [pool release]; return retVal; } What my cause the app to crash?

    Read the article

  • FLEX: how to dynamically add LineSeries to CartesianChart

    - by Patrick
    hi, the LineSeries is not dynamically added to my CartesianChart... What's wrong in this code: ... private function chartComplete():void { var ls:LineSeries = new LineSeries(); ls.styleName = 'timeline'; ls.dataProvider = "{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}"; ls.yField = 'popularity'; //ls.s = "{new Stroke(0xCC33CC, 2)}"; AllChart.series[0] = ls; } ... <mx:CartesianChart id="AllChart" width="100%" height="100" creationComplete="chartComplete();"> <mx:horizontalAxis><mx:CategoryAxis id="horiz1" dataProvider="['1','2','3','4','5','6','7','8','9','10','11','23','13','14','15','16','17','18','19','20','21','22','23','24','25','26','27','28','29','30','31']"/></mx:horizontalAxis> <mx:horizontalAxisRenderers><mx:AxisRenderer axis="{horiz1}"/></mx:horizontalAxisRenderers> <mx:verticalAxis><mx:LinearAxis id="vert1" /></mx:verticalAxis> <mx:verticalAxisRenderers><mx:AxisRenderer axis="{vert1}"/></mx:verticalAxisRenderers> <mx:series> <mx:AreaSeries id="timeArea" styleName="timeArea" name="A" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(2).yearPopularity}" areaStroke="{new Stroke(0x0033CC, 2)}" areaFill="{new SolidColor(0x0033CC, 0.5)}" /> </mx:series> </mx:CartesianChart> I can only see the TimeLine if I added it with MXML: <mx:LineSeries styleName="timeLine" dataProvider="{dataManager.tagViewTimelineModel.tags.getItemAt(0).yearPopularity}" yField="popularity" stroke="{new Stroke(0xCC33CC, 2)}" /> But I need to update the view, and add N lines so I cannot do it with MXML. thanks

    Read the article

  • Project Euler 7 Scala Problem

    - by Nishu
    I was trying to solve Project Euler problem number 7 using scala 2.8 First solution implemented by me takes ~8 seconds def problem_7:Int = { var num = 17; var primes = new ArrayBuffer[Int](); primes += 2 primes += 3 primes += 5 primes += 7 primes += 11 primes += 13 while (primes.size < 10001){ if (isPrime(num, primes)) primes += num if (isPrime(num+2, primes)) primes += num+2 num += 6 } return primes.last; } def isPrime(num:Int, primes:ArrayBuffer[Int]):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(num) for (i <- primes){ if(i <= r ){ if (num % i == 0) return false; } } return true; } Later I tried the same problem without storing prime numbers in array buffer. This take .118 seconds. def problem_7_alt:Int = { var limit = 10001; var count = 6; var num:Int = 17; while(count < limit){ if (isPrime2(num)) count += 1; if (isPrime2(num+2)) count += 1; num += 6; } return num; } def isPrime2(n:Int):Boolean = { // if n == 2 return false; // if n == 3 return false; var r = Math.sqrt(n) var f = 5; while (f <= r){ if (n % f == 0) { return false; } else if (n % (f+2) == 0) { return false; } f += 6; } return true; } I tried using various mutable array/list implementations in Scala but was not able to make solution one faster. I do not think that storing Int in a array of size 10001 can make program slow. Is there some better way to use lists/arrays in scala?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • GCC emits extra code for boost::shared_ptr dereference

    - by Checkers
    I have the following code: #include <boost/shared_ptr.hpp> struct Foo { int a; }; static int A; void func_shared(const boost::shared_ptr<Foo> &foo) { A = foo->a; } void func_raw(Foo * const foo) { A = foo->a; } I thought the compiler would create identical code, but for shared_ptr version an extra seemingly redundant instruction is emitted. Disassembly of section .text: 00000000 <func_raw(Foo*)>: 0: 55 push ebp 1: 89 e5 mov ebp,esp 3: 8b 45 08 mov eax,DWORD PTR [ebp+8] 6: 5d pop ebp 7: 8b 00 mov eax,DWORD PTR [eax] 9: a3 00 00 00 00 mov ds:0x0,eax e: c3 ret f: 90 nop 00000010 <func_shared(boost::shared_ptr<Foo> const&)>: 10: 55 push ebp 11: 89 e5 mov ebp,esp 13: 8b 45 08 mov eax,DWORD PTR [ebp+8] 16: 5d pop ebp 17: 8b 00 mov eax,DWORD PTR [eax] 19: 8b 00 mov eax,DWORD PTR [eax] 1b: a3 00 00 00 00 mov ds:0x0,eax 20: c3 ret I'm just curious, is this necessary, or it is just an optimizer's shortcoming? Compiling with g++ 4.1.2, -O3 -NDEBUG.

    Read the article

  • Add fields to Django ModelForm that aren't in the model

    - by Cyclic
    I have a model that looks like: class MySchedule(models.Model): start_datetime=models.DateTimeField() name=models.CharField('Name',max_length=75) With it comes its ModelForm: class MyScheduleForm(forms.ModelForm): startdate=forms.DateField() starthour=forms.ChoiceField(choices=((6,"6am"),(7,"7am"),(8,"8am"),(9,"9am"),(10,"10am"),(11,"11am"), (12,"noon"),(13,"1pm"),(14,"2pm"),(15,"3pm"),(16,"4pm"),(17,"5pm"), (18,"6pm" startminute=forms.ChoiceField(choices=((0,":00"),(15,":15"),(30,":30"),(45,":45")))),(19,"7pm"),(20,"8pm"),(21,"9pm"),(22,"10pm"),(23,"11pm"))) class Meta: model=MySchedule def clean(self): starttime=time(int(self.cleaned_data.get('starthour')),int(self.cleaned_data.get('startminute'))) return self.cleaned_data try: self.instance.start_datetime=datetime.combine(self.cleaned_data.get("startdate"),starttime) except TypeError: raise forms.ValidationError("There's a problem with your start or end date") Basically, I'm trying to break the DateTime field in the model into 3 more easily usable form fields -- a date picker, an hour dropdown, and a minute dropdown. Then, once I've gotten the three inputs, I reassemble them into a DateTime and save it to the model. A few questions: 1) Is this totally the wrong way to go about doing it? I don't want to create fields in the model for hours, minutes, etc, since that's all basically just intermediary data, so I'd like a way to break the DateTime field into sub-fields. 2) The difficulty I'm running into is when the startdate field is blank -- it seems like it never gets checked for non-blankness, and just ends up throwing up a TypeError later when the program expects a date and gets None. Where does Django check for blank inputs, and raise the error that eventually goes back to the form? Is this my responsibility? If so, how do I do it, since it doesn't evaluate clean_startdate() since startdate isn't in the model. 3) Is there some better way to do this with inheritance? Perhaps inherit the MyScheduleForm in BetterScheduleForm and add the fields there? How would I do this? (I've been playing around with it for over an hours and can't seem to get it) Thanks! [Edit:] Left off the return self.cleaned_data -- lost it in the copy/paste originally

    Read the article

  • Programming Technique: How to create a simple card game

    - by Shyam
    Hi, As I am learning the Ruby language, I am getting closer to actual programming. So I was thinking of creating a simple card game. My question isn't Ruby orientated, but I do know want to learn how to solve this problem with a genuine OOP approach. In my card game I want to have four players. Using a standard deck with 52 cards, no jokers/wildcards. In the game I won't use the Ace as a dual card, it is always the highest card. So, the programming problems I wonder about are the following: How can I sort/randomize the deck of cards? There are four types, each having 13 values. Eventually there can be only unique values, so picking random values could generate duplicates. How can I implement a simple AI? As there are tons of card games, someone would have figured this part out already, so references would be great. I am a truly Ruby nuby, and my goal here is to learn to solve problems, so pseudo code would be great, just to understand how to solve the problem programmatically. I apologize for my grammar and writing style if it's unclear, for it is not my native language. Also pointers to sites where such challenges are explained, would be a great resource! Thank you for your comments, answers and feedback!

    Read the article

  • How to migrate project from RCS to git? (SOLVED)

    - by Norman Ramsey
    I have a 20-year-old project that I would like to migrate from RCS to git, without losing the history. All web pages suggest that the One True Path is through CVS. But after an hour of Googling and trying different scripts, I have yet to find anything that successfully converts my RCS project tree to CVS. I'm hoping the good people at Stackoverflow will know what actually works, as opposed to what is claimed to work and doesn't. (I searched Stackoverflow using both the native SO search and a Google search, but if there's a helpful answer in the database, I missed it.) UPDATE: The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export was repaired on 14 April 2009, and this version seems to work for me. This tool converts straight to git with no intermediate CVS. Thanks Giuseppe and Jakub!!! Things that did not work that I still remember: The rcs-to-cvs script that ships in the contrib directory of the CVS sources The rcs-fast-export tool at http://git.oblomov.eu/rcs-fast-export in versions before 13 April 2010 The rcs2cvs script found in a document called "CVS-RCS- HOW-TO Document for Linux"

    Read the article

  • Why do I get "file is not of required architecture" when I try to build my app on an iphone?

    - by Dale
    My app seemingly runs fine in the simulator but the first time I hooked a phone up to my system and had it build for it I got a huge error log with things like: Build SCCUI of project SCCUI with configuration Debug CompileXIB HandleAlert.xib cd /Users/gdbriggs/Desktop/SCCUI setenv IBC_MINIMUM_COMPATIBILITY_VERSION 3.1 setenv PATH "/Developer/Platforms/iPhoneOS.platform/Developer/usr/bin:/Developer/usr /bin:/usr/bin:/bin:/usr/sbin:/sbin" /Developer/usr/bin/ibtool --errors --warnings --notices --output-format human-readable-text --compile /Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos/SCCUI.app/HandleAlert.nib /Users/gdbriggs/Desktop/SCCUI/HandleAlert.xib /* com.apple.ibtool.document.warnings */ /Users/gdbriggs/Desktop/SCCUI/HandleAlert.xib:13: warning: UITextView does not support data detectors when the text view is editable. Ld build/Debug-iphoneos/SCCUI.app/SCCUI normal armv6 cd /Users/gdbriggs/Desktop/SCCUI setenv IPHONEOS_DEPLOYMENT_TARGET 3.1 setenv MACOSX_DEPLOYMENT_TARGET 10.5 setenv PATH "/Developer/Platforms/iPhoneOS.platform/Developer/usr/bin:/Developer/usr/bin:/usr/bin:/bin:/usr/sbin:/sbin" /Developer/Platforms/iPhoneOS.platform/Developer/usr/bin/gcc-4.2 -arch armv6 -isysroot /Developer/Platforms/iPhoneOS.platform/Developer/SDKs/iPhoneOS3.1.sdk -L/Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos -F/Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos -F/Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks -filelist /Users/gdbriggs/Desktop/SCCUI/build/SCCUI.build/Debug-iphoneos/SCCUI.build/Objects-normal/armv6/SCCUI.LinkFileList -mmacosx-version-min=10.5 -dead_strip -miphoneos-version-min=3.1 -framework Foundation -framework UIKit -framework CoreGraphics -framework MessageUI -o /Users/gdbriggs/Desktop/SCCUI/build/Debug-iphoneos/SCCUI.app/SCCUI ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/Foundation.framework/Foundation, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/UIKit.framework/UIKit, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/CoreGraphics.framework/CoreGraphics, file is not of required architecture ld: warning: in /Developer/Platforms/iPhoneSimulator.platform/Developer/SDKs/iPhoneSimulator3.1.sdk/System/Library/Frameworks/MessageUI.framework/MessageUI, file is not of required architecture Undefined symbols: "_OBJC_CLASS_$_UIDevice", referenced from: __objc_classrefs__DATA@0 in SCAuthenticationHandler.o "_OBJC_CLASS_$_NSString", referenced from: __objc_classrefs__DATA@0 in CCProxy.o __objc_classrefs__DATA@0 in AlertSummaryViewController.o __objc_classrefs__DATA@0 in HomeLevelController.o __objc_classrefs__DATA@0 in SCAuthenticationHandler.o __objc_classrefs__DATA@0 in SCRequestHandler.o "_UIApplicationMain", referenced from: _main in main.o "_objc_msgSend", referenced from: _main in main.o _main in main.o _main in main.o -[SCCUIAppDelegate applicationDidFinishLaunching:] in and it just keeps going. At / near the bottom it says: ld: symbol(s) not found collect2: ld returned 1 exit status What am I doing wrong?

    Read the article

  • understanding valgrind output

    - by sbsp
    Hi, i made a post earlier asking about checking for memory leaks etc, i did say i wasnt to familiar with the terminal in linux but someone said to me it was easy with valgrind i have managed to get it running etc but not to sure what the output means. Glancing over, all looks good to me but would like to run it past you experience folk for confirmation if possible. THe output is as follows ^C==2420== ==2420== HEAP SUMMARY: ==2420== in use at exit: 2,240 bytes in 81 blocks ==2420== total heap usage: 82 allocs, 1 frees, 2,592 bytes allocated ==2420== ==2420== LEAK SUMMARY: ==2420== definitely lost: 0 bytes in 0 blocks ==2420== indirectly lost: 0 bytes in 0 blocks ==2420== possibly lost: 0 bytes in 0 blocks ==2420== still reachable: 2,240 bytes in 81 blocks ==2420== suppressed: 0 bytes in 0 blocks ==2420== Reachable blocks (those to which a pointer was found) are not shown. ==2420== To see them, rerun with: --leak-check=full --show-reachable=yes ==2420== ==2420== For counts of detected and suppressed errors, rerun with: -v ==2420== ERROR SUMMARY: 0 errors from 0 contexts (suppressed: 13 from 8) Is all good here? the only thing concerning me is the still reachable part. Is that ok? Thanks everyone

    Read the article

  • SharpPcap issue

    - by Eyla
    This is my first time to use SharpPcap library. I created new project with VC# 2008 and I added SharpPcap as a reference to my project. I post a sample code to get interface of my pc but I'm getting this error: Error 1 The type or namespace name 'PcapDeviceList' could not be found (are you missing a using directive or an assembly reference?) C:\Users\Ali\Documents\Visual Studio 2008\Projects\Pcap\Pcap\Form1.cs 28 13 Pcap please advice to solve this problem. here is my code: using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; using SharpPcap; using SharpPcap.Packets; using SharpPcap.Protocols; using SharpPcap.Util; namespace Pcap { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { /* Retrieve the device list */ PcapDeviceList devices = SharpPcap.GetAllDevices(); /*If no device exists, print error */ if (devices.Count < 1) { Console.WriteLine("No device found on this machine"); return; } int i = 0; /* Scan the list printing every entry */ foreach (PcapDevice dev in devices) { /* Description */ label1.Text = "{0}) {1}" + i + dev.PcapDescription +"\n"+ /* Name */ "\tName:\t{0}" + dev.PcapName+"\n"+ /* IP Address */ "\tIP Address: \t\t{0}"+ dev.PcapIpAddress+"\n"+ /* Is Loopback */ "\tLoopback: \t\t{0}"+ dev.PcapLoopback; i++; } } } }

    Read the article

  • crash when linking swc with Alchemy

    - by paleozogt
    I have a project I'm trying to compile with alchemy. It will compile .o and .a files, but when trying to create a .swc, it will fail. It appears to crash with this error: g++ -swc -o mylib.swc my-flex-interface.cpp mylib.a Cannot yet select: 0x279c810: ch,flag = AVM2ISD::CALL - A call instruction 0x279c7a0, 0x29c4350 0 llc 0x00636dfe _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 6078 1 llc 0x006373a2 _ZNSt8_Rb_treeIN4llvm3sys4PathES2_St9_IdentityIS2_ESt4lessIS2_ESaIS2_EE13insert_uniqueERKS2_ + 7522 2 libSystem.B.dylib 0x9530942b _sigtramp + 43 3 ??? 0xffffffff 0x0 + 4294967295 4 libSystem.B.dylib 0x953968e5 raise + 26 5 libSystem.B.dylib 0x953ac99c abort + 93 6 llc 0x002f4fe0 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel6Emit_7ERKN4llvm9SDOperandEj + 0 7 llc 0x002f8e1b _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectCodeEN4llvm9SDOperandE + 2219 8 llc 0x002fa193 _ZN98_GLOBAL__N__Volumes_data_dev_FlaCC_llvm_2.1_lib_Target_AVM2_AVM2ISelDAGToDAG.cpp_00000000_F04616B616AVM2DAGToDAGISel10SelectRootEN4llvm9SDOperandE + 819 9 llc 0x002e6a2c _ZN4llvm19X86_64TargetMachineD0Ev + 65116 10 llc 0x003de4ca _ZN4llvm11StoreSDNodeD1Ev + 1610 11 llc 0x0040d3fe _ZN4llvm11StoreSDNodeD1Ev + 193918 12 llc 0x0040f92e _ZN4llvm11StoreSDNodeD1Ev + 203438 13 llc 0x005d1926 _ZN4llvm12FunctionPassD1Ev + 20998 14 llc 0x005d1f3a _ZN4llvm12FunctionPassD1Ev + 22554 15 llc 0x005d20c5 _ZN4llvm12FunctionPassD1Ev + 22949 16 llc 0x00002e44 0x0 + 11844 17 llc 0x00001f36 0x0 + 7990 18 ??? 0x00000006 0x0 + 6 make[2]: *** [src/app/alchemy/sonic.swc] Error 6 make[1]: *** [src/app/alchemy/CMakeFiles/alchemy.dir/all] Error 2 make: *** [all] Error 2 I'm not familiar enough with LLVM (which Alchemy uses under the hood) to figure out what this error means. Any ideas?

    Read the article

< Previous Page | 664 665 666 667 668 669 670 671 672 673 674 675  | Next Page >