Search Results

Search found 5842 results on 234 pages for 'break'.

Page 67/234 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • how to find end of scroll value for HorizontalScrollView

    - by DroidCoder
    i need to implement following scenario, here i have two horizontalScrollViews the upper scrollView is a main menu and lower scrollView is a submenu. when i scroll main menu,the menu which comes under center arrow will show its submenu in lower scrollview and from the lower scrollview, the submenu which comes under center arrow shows the screen for that sub-menu. here's my requirement: i've implemented it using HorizontalScrollViews and ViewFlipper and also it works but it will give correct result only when i scroll it slowly and not when scroll fast. i've used onTouch() method with a ACTION_UP event,so when i release finger from screen it will gives me getScrollX() position at that point but here i need getScrollX() position when scroll is finished/stop. here's my code:- @Override public boolean onTouch(View v, MotionEvent event) { switch (v.getId()) { case R.id.mHorizontalScrollViewMain: if (event.getAction() == KeyEvent.ACTION_UP) { Log.d("test", " " + hsvUpperTab.getScrollX() + " , "+ mViewFlipper.getChildCount()); getUpperTabScrolled(hsvUpperTab.getScrollX()); } break; case R.id.mHorizontalScrollViewSub: if (event.getAction() == KeyEvent.ACTION_UP) { Log.d("test1", " " + hsvLowerTab.getScrollX()); getLowerTabScrolled(hsvLowerTab.getScrollX()); } default: break; } return false; }

    Read the article

  • Should I expect Comet to be this slow?

    - by Chad Johnson
    I have the following in a Rails controller: def poll records = [] start_time = Time.now.to_i while records.length == 0 do records = Something.uncached{Something.find(:all, :conditions => { :some_condition => false})} if records.length > 0 break end sleep 1 if Time.now.to_i - start_time >= 20 break end end responseData = [] records.each do |record| responseData << { 'something' => record.some_value } # Flag message as received. record.some_condition = true record.save end render :text => responseData.to_json end and then I have Javascript performing an AJAX request. The request sits there for 20 seconds or until the controller method finds a record in the database, waiting. That works. function poll() { $.ajax({ url: '/my_controller/poll', type: 'GET', dataType: 'json', cache: false, data: 'time=' + new Date().getTime(), success: function(response) { // show response here }, complete: function() { poll(); }, error: function() { alert('error'); poll(); } }); } When I have 5 - 10 tabs open in my browser, my web application becomes super slow. Is this to be expected? Or is there some obvious improvement(s) I can make?

    Read the article

  • Image re sizing not working after rotation in Html5 canvas

    - by Deepu the Don
    In my HTML 5 + Javascript application, we can drag, re size and rotate image in Html 5 canvas. But after doing rotation, re sizing is not working. (I think it i related to finding dx,dy,not sure). Please help me to fix the code given below. Thanks in advance. <!doctype html> <html> <head> <style> #canvas{ border:red dashed #ccc; } </style> <script type="text/javascript" src="http://code.jquery.com/jquery.min.js"></script> <script> $(function(){ var canvas=document.getElementById("canvas"),ctx=canvas.getContext("2d"),canvasOffset=$("#canvas").offset(); var offsetX=canvasOffset.left,offsetY=canvasOffset.top,startX,startY,isDown=false,pi2=Math.PI*2; var resizerRadius=8,rr=resizerRadius*resizerRadius,draggingResizer={x:0,y:0},imageX=50,imageY=50; var imageWidth,imageHeight,imageRight,imageBottom,draggingImage=false,startX,startY,doRotation=false; var r=0,rotImg = new Image(); rotImg.src="rotation.jpg"; var img=new Image(); img.onload=function(){ imageWidth=img.width; imageHeight=img.height; imageRight=imageX+imageWidth; imageBottom=imageY+imageHeight; w=img.width/2; h=img.height/2; draw(true,false); } img.src="https://dl.dropboxusercontent.com/u/139992952/stackoverflow/facesSmall.png"; function draw(withAnchors,withBorders){ ctx.fillStyle="black"; ctx.clearRect(0,0,canvas.width,canvas.height); ctx.save(); ctx.translate(imageX,imageY); ctx.translate(imageWidth/2,imageHeight/2); ctx.rotate(r); ctx.translate(-imageX,-imageY); ctx.translate(-imageWidth/2,-imageHeight/2); ctx.drawImage(img,0,0,img.width,img.height,imageX,imageY,imageWidth,imageHeight); ctx.restore(); if(withAnchors){ drawDragAnchor(imageX,imageY); drawDragAnchor(imageRight,imageY); drawDragAnchor(imageRight,imageBottom); drawDragAnchor(imageX,imageBottom); } if(withBorders){ ctx.save(); ctx.translate(imageX,imageY); ctx.translate(imageWidth/2,imageHeight/2); ctx.rotate(r); ctx.translate(-imageX,-imageY); ctx.translate(-imageWidth/2,-imageHeight/2); ctx.beginPath(); ctx.moveTo(imageX,imageY); ctx.lineTo(imageRight,imageY); ctx.lineTo(imageRight,imageBottom); ctx.lineTo(imageX,imageBottom); ctx.closePath(); ctx.stroke(); ctx.restore(); } ctx.fillStyle="blue"; ctx.save(); ctx.translate(imageX,imageY); ctx.translate(imageWidth/2,imageHeight/2); ctx.rotate(r); ctx.translate(-imageX,-imageY); ctx.translate(-imageWidth/2,-imageHeight/2); ctx.beginPath(); ctx.moveTo(imageRight+15,imageY-10); ctx.lineTo(imageRight+45,imageY-10); ctx.lineTo(imageRight+45,imageY+20); ctx.lineTo(imageRight+15,imageY+20); ctx.fill(); ctx.closePath(); ctx.restore(); } function drawDragAnchor(x,y){ ctx.save(); ctx.translate(imageX,imageY); ctx.translate(imageWidth/2,imageHeight/2); ctx.rotate(r); ctx.translate(-imageX,-imageY); ctx.translate(-imageWidth/2,-imageHeight/2); ctx.beginPath(); ctx.arc(x,y,resizerRadius,0,pi2,false); ctx.closePath(); ctx.fill(); ctx.restore(); } function anchorHitTest(x,y){ var dx,dy; dx=x-imageX; dy=y-imageY; if(dx*dx+dy*dy<=rr){ return(0); } // top-right dx=x-imageRight; dy=y-imageY; if(dx*dx+dy*dy<=rr){ return(1); } // bottom-right dx=x-imageRight; dy=y-imageBottom; if(dx*dx+dy*dy<=rr){ return(2); } // bottom-left dx=x-imageX; dy=y-imageBottom; if(dx*dx+dy*dy<=rr){ return(3); } return(-1); } function hitImage(x,y){ return(x>imageX && x<imageX+imageWidth && y>imageY && y<imageY+imageHeight); } function handleMouseDown(e){ startX=parseInt(e.clientX-offsetX); startY=parseInt(e.clientY-offsetY); draggingResizer= anchorHitTest(startX,startY); draggingImage= draggingResizer<0 && hitImage(startX,startY); doRotation = draggingResizer<0 && !draggingImage && ctx.isPointInPath(startX,startY); } function handleMouseUp(e){ draggingResizer=-1; draggingImage=false; doRotation=false; draw(true,false); } function handleMouseOut(e){ handleMouseUp(e); } function handleMouseMove(e){ mouseX=parseInt(e.clientX-offsetX); mouseY=parseInt(e.clientY-offsetY); if(draggingResizer>-1){ switch(draggingResizer){ case 0: //top-left imageX=mouseX; imageWidth=imageRight-mouseX; imageY=mouseY; imageHeight=imageBottom-mouseY; break; case 1: //top-right imageY=mouseY; imageWidth=mouseX-imageX; imageHeight=imageBottom-mouseY; break; case 2: //bottom-right imageWidth=mouseX-imageX; imageHeight=mouseY-imageY; break; case 3: //bottom-left imageX=mouseX; imageWidth=imageRight-mouseX; imageHeight=mouseY-imageY; break; } if(imageWidth<25) imageWidth=25; if(imageHeight<25) imageHeight=25; imageRight=imageX+imageWidth; imageBottom=imageY+imageHeight; draw(true,true); }else if(draggingImage){ imageClick=false; var dx=mouseX-startX; var dy=mouseY-startY; imageX+=dx; imageY+=dy; imageRight+=dx; imageBottom+=dy; startX=mouseX; startY=mouseY; draw(false,true); }else if(doRotation){ var dx=mouseX-imageX; var dy=mouseY-imageY; r=Math.atan2(dy,dx); draw(false,true); } } $("#canvas").mousedown(function(e){handleMouseDown(e);}); $("#canvas").mousemove(function(e){handleMouseMove(e);}); $("#canvas").mouseup(function(e){handleMouseUp(e);}); $("#canvas").mouseout(function(e){handleMouseOut(e);}); }); </script> </head> <body> <canvas id="canvas" width=800 height=500></canvas> </body> </html>

    Read the article

  • Dev-C++ and Detours compiling error

    - by Julio
    Hello. As title says I'm trying to compile with Dev-C++ a simple DLL using Detours, but I get this error: syntax error before token '&' on this lines: DetourAttach(&(PVOID &)trueMessageBox, hookedMessageBox) DetourDetach(&(PVOID &)trueMessageBox, hookedMessageBox) The complete code is #include <windows.h> #include <detours.h> #pragma comment( lib, "Ws2_32.lib" ) #pragma comment( lib, "detours.lib" ) #pragma comment( lib, "detoured.lib" ) int (WINAPI * trueMessageBox)(HWND hWnd, LPCSTR lpText, LPCSTR lpCaption, UINT uType) = MessageBox; int WINAPI hookedMessageBox(HWND hWnd, LPCSTR lpText, LPCSTR lpCaption, UINT uType) { LPCSTR lpNewCaption = "You've been hijacked"; int iReturn = trueMessageBox(hWnd, lpText, lpNewCaption, uType); return iReturn; } BOOL WINAPI DllMain( HINSTANCE, DWORD dwReason, LPVOID ) { switch ( dwReason ) { case DLL_PROCESS_ATTACH: DetourTransactionBegin(); DetourUpdateThread( GetCurrentThread() ); DetourAttach(&(PVOID &)trueMessageBox, hookedMessageBox) DetourTransactionCommit(); break; case DLL_PROCESS_DETACH: DetourTransactionBegin(); DetourUpdateThread( GetCurrentThread() ); DetourDetach(&(PVOID &)trueMessageBox, hookedMessageBox) DetourTransactionCommit(); break; } return TRUE; }

    Read the article

  • Why notify listeners in a content provider query method?

    - by cbrulak
    Vegeolla has this blog post about content providers and the snippet below (at the bottom) with this line: cursor.setNotificationUri(getContext().getContentResolver(), uri); I'm curious as to why one would want to notify listeners about a query operation. Am I missing something? Thanks @Override public Cursor query(Uri uri, String[] projection, String selection, String[] selectionArgs, String sortOrder) { // Uisng SQLiteQueryBuilder instead of query() method SQLiteQueryBuilder queryBuilder = new SQLiteQueryBuilder(); // Check if the caller has requested a column which does not exists checkColumns(projection); // Set the table queryBuilder.setTables(TodoTable.TABLE_TODO); int uriType = sURIMatcher.match(uri); switch (uriType) { case TODOS: break; case TODO_ID: // Adding the ID to the original query queryBuilder.appendWhere(TodoTable.COLUMN_ID + "=" + uri.getLastPathSegment()); break; default: throw new IllegalArgumentException("Unknown URI: " + uri); } SQLiteDatabase db = database.getWritableDatabase(); Cursor cursor = queryBuilder.query(db, projection, selection, selectionArgs, null, null, sortOrder); // Make sure that potential listeners are getting notified cursor.setNotificationUri(getContext().getContentResolver(), uri); return cursor; }

    Read the article

  • Getting a UDP socket program in Python to accept messages from a Syslog client?

    - by Elvar
    I'm trying to write a Syslog listener and so far so good on getting it to accept incoming messages through TCP but I also want UDP to function. This is the UDP server code I'm using, which works using a python client app. I also have another app which also works just using the python client app. # Server program # UDP VERSION from socket import * # Set the socket parameters host = "localhost" port = 514 buf = 1024 addr = (host,port) # Create socket and bind to address UDPSock = socket(AF_INET,SOCK_DGRAM) UDPSock.bind(addr) # Receive messages while 1: data,addr = UDPSock.recvfrom(buf) if not data: print "Client has exited!" break else: print "\nReceived message '", data,"'" # Close socket UDPSock.close() Using this code I can send to the server and have it display the code. # Client program from socket import * # Set the socket parameters host = "localhost" port = 514 buf = 1024 addr = (host,port) # Create socket UDPSock = socket(AF_INET,SOCK_DGRAM) def_msg = "===Enter message to send to server==="; print "\n",def_msg # Send messages while (1): data = raw_input('>> ') if not data: break else: if(UDPSock.sendto(data,addr)): print "Sending message '",data,"'....." # Close socket UDPSock.close() I have tried the Kiwi Syslog Message Generator and Snare to send syslog messages to the UDP server and nothing comes up. Could someone help me understand?

    Read the article

  • Why won't this println command start a new line?

    - by David
    Here's the relevant code: public static void printBoarders (Territory x) { int t = 0 ; int n = 0 ; for (int i = 0; i<x.borders.length; i++) { if (x.borders[i] == -1) t = i ; } for (int j = 0; j<x.borders.length; j++) { if (x.borders[j] == 1) n++ ; } Territory.translate (t) ; System.out.print (" has " + n + " borders: ") ; Territory.translate (x.borders) ; System.out.println (" ") ; } When I run this, I get everything on one line without a line break. Why isn't the System.out.println (" ") ; creating a line break? Here is an example of what the output winds up being: Northwest Territory, Alberta, Kamchatka, hidavid-names-macbook-pro:~ davidname$ EDIT: the problem was that this method was never being invoked. A different one which i was replacing was. All is well.

    Read the article

  • What to do when ServerSocket throws IOException and keeping server running

    - by s5804
    Basically I want to create a rock solid server. while (keepRunning.get()) { try { Socket clientSocket = serverSocket.accept(); ... spawn a new thread to handle the client ... } catch (IOException e) { e.printStackTrace(); // NOW WHAT? } } In the IOException block, what to do? Is the Server socket at fault so it need to be recreated? For example wait a few seconds and then serverSocket = ServerSocketFactory.getDefault().createServerSocket(MY_PORT); However if the server socket is still OK, then it is a pity to close it and kill all previously accepted connections that are still communicating. EDIT: After some answers, here my attempt to deal with the IOException. Would the implementation be guaranteeing keeping the server up and only re-create server socket when only necessary? while (keepRunning.get()) { try { Socket clientSocket = serverSocket.accept(); ... spawn a new thread to handle the client ... bindExceptionCounter = 0; } catch (IOException e) { e.printStackTrace(); recreateServerSocket(); } } private void recreateServerSocket() { while (keepRunning) { try { logger.info("Try to re-create Server Socket"); ServerSocket socket = ServerSocketFactory.getDefault().createServerSocket(RateTableServer.RATE_EVENT_SERVER_PORT); // No exception thrown, then use the new socket. serverSocket = socket; break; } catch (BindException e) { logger.info("BindException indicates that the server socket is still good.", e); bindExceptionCounter++; if (bindExceptionCounter < 5) { break; } } catch (IOException e) { logger.warn("Problem to re-create Server Socket", e); e.printStackTrace(); try { Thread.sleep(30000); } catch (InterruptedException ie) { logger.warn(ie); } } } }

    Read the article

  • PHP: Need help with simple XML

    - by Jack
    I am beginner in PHP. I am trying to parse this xml file. <relationship> <target> <following type="boolean">true</following> <followed_by type="boolean">true</followed_by> <screen_name>xxxx</screen_name> <id type="integer">xxxx</id> </target> <source> <notifications_enabled nil="true"/> <following type="boolean">true</following> <blocking nil="true"/> <followed_by type="boolean">true</followed_by> <screen_name>xxxx</screen_name> <id type="integer">xxxxx</id> </source> </relationship> I need to get the value of the field 'following type="boolean" ' for the target and here's my code - $xml = simplexml_load_string($response); foreach($xml->children() as $child) { if ($child->getName() == 'target') { foreach($child->children() as $child_1) if ( $child_1->getName() == 'following') { $is_my_friend = (bool)$child_1; break; } break; } } but I am not getting the correct output. I think the ' type="boolean" ' part of the field is creating problems. Please help.

    Read the article

  • How can a link within a WebView load another layout using javascript?

    - by huffmaster
    So I have 2 layout files (main.xml, featured.xml) and both each have a single WebView. When the application starts "main.xml" loads a html file into it's WebView. In this html file I have a link that calls javascript that runs code in the Activity that loaded the html. Once back in this Activity code though I try running setContentView(R.layout.featured) but it just bombs out on me. If I debug it just dies without any real error and if I run it the application just Force closes. Am I going about this correctly or should I be doing something differently? final private int MAIN = 1; final private int FEATURED = 2; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); webview = (WebView) findViewById(R.id.wvMain); webview.getSettings().setJavaScriptEnabled(true); webview.getSettings().setSupportZoom(false); webview.addJavascriptInterface(new EHJavaScriptInterface(), "eh"); webview.loadUrl("file:///android_asset/default.html"); } final class EHJavaScriptInterface { EHJavaScriptInterface() { } public void loadLayout(final String lo) { int i = Integer.parseInt(lo.trim()); switch (i) { /****** THIS IS WHERE I'M BOMBING OUT *********/ case FEATURED: setContentView(R.layout.featured);break; case MAIN: setContentView(R.layout.main);break; } } }

    Read the article

  • Cant run application (C#) through cmd

    - by user301639
    Hey, I cant execute application through cmd, when the application trying to read the argument which was sent to it (text file), it fails... when i'm truing to execute it through the IDE (vs2008), it works ok... that's what i did in the main method : static void Main(string[] args) { int choice = 0; if (args.Length == 0) choice = 1; else choice = 2; switch(choice) { case 1: { string[] text = Directory.GetFiles("allText"); Console.WriteLine(DateTime.Now.ToString()); foreach (string fileName in text) { string substring = fileName.Substring(8); ReadData_Logic rd_l = new ReadData_Logic(substring); rd_l.runThreadsAndDecrypt(); rd_l.printKey(substring.Substring(0, fileName.Length - 15).Insert(0, "encryptedKey\\") + "_result.txt"); } Console.WriteLine(DateTime.Now.ToString()); } break; case 2: { Console.WriteLine(DateTime.Now.ToString()); string fileName = args[0]; Console.WriteLine(fileName); **<--- for debug, here i do see the correct file name** ReadData_Logic rd_l = new ReadData_Logic(fileName); rd_l.runThreadsAndDecrypt(); rd_l.printKey(fileName + "_result.txt"); Console.WriteLine(DateTime.Now.ToString()); } break; } } what wrong with the code ? thanks

    Read the article

  • Chrome extension sendRequest from async callback not working?

    - by Eugene
    Can't figure out what's wrong. onRequest not triggered on call from async callback method, the same request from content script works. The sample code below. background.js ============= ... makeAsyncRequest(); ... chrome.extension.onRequest.addListener(function(request, sender, sendResponse) { switch (request.id) { case "from_content_script": // This works console.log("from_content_script"); sendResponse({}); // clean up break; case "from_async": // Not working! console.log("from_async"); sendResponse({}); // clean up break; } }); methods.js ========== makeAsyncRequest = function() { ... var xhr = new XMLHttpRequest(); xhr.onreadystatechange = function() { if (xhr.readyState == 4) { ... // It works console.log("makeAsyncRequest callback"); chrome.extension.sendRequest({id: "from_async"}, function(response) { }); } } ... }; UPDATE: manifest configuration file. Don't no what's wrong here. { "name": "TestExt", "version": "0.0.1", "icons": { "48": "img/icon-48-green.gif" }, "description": "write it later", "background_page": "background.html", "options_page": "options.html", "browser_action": { "default_title": "TestExt", "default_icon": "img/icon-48-green.gif" }, "permissions": [ "tabs", "http://*/*", "https://*/*", "file://*/*", "webNavigation" ] }

    Read the article

  • Should java try blocks be scoped as tightly as possible?

    - by isme
    I've been told that there is some overhead in using the Java try-catch mechanism. So, while it is necessary to put methods that throw checked exception within a try block to handle the possible exception, it is good practice performance-wise to limit the size of the try block to contain only those operations that could throw exceptions. I'm not so sure that this is a sensible conclusion. Consider the two implementations below of a function that processes a specified text file. Even if it is true that the first one incurs some unnecessary overhead, I find it much easier to follow. It is less clear where exactly the exceptions come from just from looking at statements, but the comments clearly show which statements are responsible. The second one is much longer and complicated than the first. In particular, the nice line-reading idiom of the first has to be mangled to fit the readLine call into a try block. What is the best practice for handling exceptions in a funcion where multiple exceptions could be thrown in its definition? This one contains all the processing code within the try block: void processFile(File f) { try { // construction of FileReader can throw FileNotFoundException BufferedReader in = new BufferedReader(new FileReader(f)); // call of readLine can throw IOException String line; while ((line = in.readLine()) != null) { process(line); } } catch (FileNotFoundException ex) { handle(ex); } catch (IOException ex) { handle(ex); } } This one contains only the methods that throw exceptions within try blocks: void processFile(File f) { FileReader reader; try { reader = new FileReader(f); } catch (FileNotFoundException ex) { handle(ex); return; } BufferedReader in = new BufferedReader(reader); String line; while (true) { try { line = in.readLine(); } catch (IOException ex) { handle(ex); break; } if (line == null) { break; } process(line); } }

    Read the article

  • issue to solve the geo tagging in android

    - by sundar
    I am a new guy in Android. How to implement the Geo-tag for images? I have tried by myself but not getting expected result. My code is like: @Override protected Dialog onCreateDialog(int id) { jpgDialog = null;; switch(id){ case ID_JPGDIALOG: Context mContext = this; jpgDialog = new Dialog(mContext); jpgDialog.setContentView(R.layout.jpgdialog); exifText = (TextView) jpgDialog.findViewById(R.id.text); geoText = (TextView)jpgDialog.findViewById(R.id.geotext); bmImage = (ImageView)jpgDialog.findViewById(R.id.image); bmOptions = new BitmapFactory.Options(); bmOptions.inSampleSize = 2; Button okDialogButton = (Button)jpgDialog.findViewById(R.id.okdialogbutton); okDialogButton.setOnClickListener(okDialogButtonOnClickListener); mapviewButton = (Button)jpgDialog.findViewById(R.id.mapviewbutton); mapviewButton.setOnClickListener(mapviewButtonOnClickListener); break; default: break; } return jpgDialog; } Please help me how to proceed?

    Read the article

  • How to reload a tableView i.e call the viewDidLoad method if a condition is met

    - by Kquane Ingram
    The problem is this i need a way to basically erase all the entry data a user placed into my arrays if a condition is met. Im new to Objective-C and iOS programming, but i believed the solution might be in calling the viewDidLoad method, thus it would virtually refresh the applications with the values of the array reset to default. If there is any other logical way of doing this i would appreciate the help. In short i need to refresh the arrays as they were when the application first launched and the user did not select anything. This is the part where i need it to refresh. if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must begin anew. Edit* I need to recall the - (void)viewDidLoad method here is more of the code. -(IBAction)button:(id)sender{ int i = 0; int sum = 0; int gradeEarned; int creditHours = 3; for ( i=0;i<8 ; i++) { if ([[points objectAtIndex:i] tag]==GradeA.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeA]; } if ([[points objectAtIndex:i]tag]==GradeB.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; } if ([[points objectAtIndex:i]tag]==GradeC.intValue){ [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; } if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must restart. } } while ( i<[gradeRecieved count]) { if ([gradeRecieved objectAtIndex:i] == GradeA ) { [finArray replaceObjectAtIndex:i withObject:GradeA]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeB ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeC ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; i++; continue; } }

    Read the article

  • Why do InterruptedExceptions clear a thread's interrupted status?

    - by Hanno Fietz
    If a thread is interrupted while inside Object.wait() or Thread.join(), it throws an InterruptedException, which resets the thread's interrupted status. I. e., if I have a loop like this inside a Runnable.run(): while (!this._workerThread.isInterrupted()) { // do something try { synchronized (this) { this.wait(this._waitPeriod); } } catch (InterruptedException e) { if (!this._isStopping()) { this._handleFault(e); } } } the thread will continue to run after calling interrupt(). This means I have to explicitly break out of the loop by checking for my own stop flag in the loop condition, rethrow the exception, or add a break. Now, this is not exactly a problem, since this behaviour is well documented and doesn't prevent me from doing anything the way I want. However, I don't seem to understand the concept behind it: Why is a thread not considered interrupted anymore once the exception has been thrown? A similar behaviour also occurs if you get the interrupted status with interrupted() instead of isInterrupted(), then, too, the thread will only appear interrupted once. Am I doing something unusual here? For example, is it more common to catch the InterruptedException outside the loop? (Even though I'm not exactly a beginner, I tagged this "beginner", because it seems like a very basic question to me, looking at it.)

    Read the article

  • what does this attempted trojan horse code do?

    - by bstullkid
    It looks like this just sends a ping, but whats the point of that when you can just use ping? /* WARNING: this is someone's attempt at writing a malware trojan. Do not compile and *definitely* don't install. I added an exit as the first line to avoid mishaps - msw */ int main (int argc, char *argv[]) { exit(1); unsigned int pid = 0; char buffer[2]; char *args[] = { "/bin/ping", "-c", "5", NULL, NULL }; if (argc != 2) return 0; args[3] = strdup(argv[1]); for (;;) { gets(buffer); /* FTW */ if (buffer[0] == 0x6e) break; switch (pid = fork()) { case -1: printf("Error Forking\n"); exit(255); case 0: execvp(args[0], args); exit(1); default: break; } } return 255; }

    Read the article

  • How can I handle dynamic calculated attributes in a model in Django?

    - by bullfish
    In Django I calculate the breadcrumb (a list of fathers) for an geographical object. Since it is not going to change very often, I am thinking of pre calculating it once the object is saved or initialized. 1.) What would be better? Which solution would have a better performance? To calculate it at _init_ or to calculate it when the object is saved (the object takes about 500-2000 characters in the DB)? 2.) I tried to overwrite the _init_ or save() methods but I don't know how to use attributes of the just saved object. Accessing *args, **kwargs did not work. How can I access them? Do I have to save, access the father and then save again? 3.) If I decide to save the breadcrumb. Whats the best way to do it? I used http://www.djangosnippets.org/snippets/1694/ and have crumb = PickledObjectField(). Thats the method to calculate the attribute crumb() def _breadcrumb(self): breadcrumb = [ ] x = self while True: x = x.father try: if hasattr(x, 'country'): breadcrumb.append(x.country) elif hasattr(x, 'region'): breadcrumb.append(x.region) elif hasattr(x, 'city'): breadcrumb.append(x.city) else: break except: break breadcrumb.reverse() return breadcrumb Thats my save-Method: def save(self,*args, **kwargs): # how can I access the father ob the object? father = self.father # does obviously not work father = kwargs['father'] # does not work either # the breadcrumb gets calculated here self.crumb = self._breadcrumb(father) super(GeoObject, self).save(*args,**kwargs) Please help me out. I am working on this for days now. Thank you.

    Read the article

  • C++ Switch won't compile with externally defined variable used as case

    - by C Nielsen
    I'm writing C++ using the MinGW GNU compiler and the problem occurs when I try to use an externally defined integer variable as a case in a switch statement. I get the following compiler error: "case label does not reduce to an integer constant". Because I've defined the integer variable as extern I believe that it should compile, does anyone know what the problem may be? Below is an example: test.cpp #include <iostream> #include "x_def.h" int main() { std::cout << "Main Entered" << std::endl; switch(0) { case test_int: std::cout << "Case X" << std::endl; break; default: std::cout << "Case Default" << std::endl; break; } return 0; } x_def.h extern const int test_int; x_def.cpp const int test_int = 0; This code will compile correctly on Visual C++ 2008. Furthermore a Montanan friend of mine checked the ISO C++ standard and it appears that any const-integer expression should work. Is this possibly a compiler bug or have I missed something obvious? Here's my compiler version information: Reading specs from C:/MinGW/bin/../lib/gcc/mingw32/3.4.5/specs Configured with: ../gcc-3.4.5-20060117-3/configure --with-gcc --with-gnu-ld --with-gnu-as --host=mingw32 --target=mingw32 --prefix=/mingw --enable-threads --disable-nls --enable-languages=c,c++,f77,ada,objc,java --disable-win32-registry --disable-shared --enable-sjlj-exceptions --enable-libgcj --disable-java-awt --without-x --enable-java-gc=boehm --disable-libgcj-debug --enable-interpreter --enable-hash-synchronization --enable-libstdcxx-debug Thread model: win32 gcc version 3.4.5 (mingw-vista special r3)

    Read the article

  • Sliding & hiding multiple panels in jQuery.

    - by lloydphillips
    I have a table with multiple rows in each row is a select list and based on the selection (when the onchange event is fired) panels appear containing additional data below the row.I currently have code like this: var allPnls = '.inv-dtl-comnts-add,.inv-dtl-comnts-update'; $(document).ready(function(){ hideAll(); //select action change $(".inv-dtl-ddlaction").change(onSelectChange); $(".btn-cancel").click(function(event){ slideAll(); $(".inv-dtl-ddlaction").val('[Select an Action]'); return false; }); }); function onSelectChange(event){ //find out which select item was clicked switch($(this).val()) { case 'View/Add Comment': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-add").slideToggle("fast"); }); break; case 'Change Status': $(this).closest(".row").children(allPnls).slideUp("fast", function(){ $(this).closest(".row").children(".inv-dtl-comnts-update").slideToggle("fast"); }); break; default: //code to be executed if n is different from case 1 and 2 } } function hideAll(){ $(allPnls).hide(); } function slideAll(){ $(allPnls).slideUp("fast"); } So I'm hiding all the panels when the page loads and if a panel is already open I want to slide it shut before reopening the new panel. This works with the postback. With just one panel in the selection it worked great but with two panels the sliding up happens twice (it seems to slide down unopened panels before sliding them back up again). How can I adjust this so that I can get all panels listed in the variable allPnls to slide shut ONLY if they are already open? Is there a better way of sliding the panels shut and then having a callback to have the slideToggle work? Lloyd

    Read the article

  • Toggle two divs and classes

    - by kuswantin
    I have two links with classes (login-form and register-form) relevant to their target forms ID, they want to toggle. I have also a predefined 'slideToggle' function to toggle better. This is what I have tried so far: $('#userbar a').click(function() { var c = $(this).attr('class'); $('#userbar a').removeClass('active'); $(this).toggleClass('active'); $('#register-form,#login-form').hide(); //bad, causing flashy $('#' + c).slideToggle('slow'); return false; }); With this I have trouble with the flashy window, and to correctly toggle the active classes when another link is clicked, the other link should not have active class anymore. Additional problem is the link is dead on serial clicks. I have another try, longer one: $('#userbar a').click(function() { var c = $(this).attr('class'); switch (c) { case 'login-form': $('#' + c).slideToggle('slow'); $(this).toggleClass('active'); $('#register-form').hide(); break; case 'register-form': $('#' + c).slideToggle('slow'); $(this).toggleClass('active'); $('#login-form').hide(); break; } return false; }); This one is worse than the first :( Any suggestion to correct the behavior? What I want is when a link with class login-form is click, so toggle the form with ID login-form, and hide the register-form if open. Any help would be very much appreciated. Thanks.

    Read the article

  • How to write this function as a pL/pgSQl function ?

    - by morpheous
    I am trying to implement some business logic in a PL/pgSQL function. I have hacked together some pseudo code that explains the type of business logic I want to include in the function. Note: This function returns a table, so I can use it in a query like: SELECT A.col1, B.col1 FROM (SELECT * from some_table_returning_func(1, 1, 2, 3)) as A, tbl2 as B; The pseudocode of the pl/PgSQL function is below: CREATE FUNCTION some_table_returning_func(uid int, type_id int, filter_type_id int, filter_id int) RETURNS TABLE AS $$ DECLARE where_clause text := 'tbl1.id = ' + uid; ret TABLE; BEGIN switch (filter_type_id) { case 1: switch (filter_id) { case 1: where_clause += ' AND tbl1.item_id = tbl2.id AND tbl2.type_id = filter_id'; break; //other cases follow ... } break; //other cases follow ... } // where clause has been built, now run query based on the type ret = SELECT [COL1, ... COLN] WHERE where_clause; IF (type_id <> 1) THEN return ret; ELSE return select * from another_table_returning_func(ret,123); ENDIF; END; $$ LANGUAGE plpgsql; I have the following questions: How can I write the function correctly to (i.e. EXECUTE the query with the generated WHERE clause, and to return a table How can I write a PL/pgSQL function that accepts a table and an integer and returns a table (another_table_returning_func) ?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Creating reusable chunks of Linq to SQL

    - by tia
    Hi, I am trying to break up horrible linq to sql queries to make them a bit more readable. Say I want to return all orders for product which in the previous year had more than 100 orders. So, original query is: from o in _context.Orders where (from o1 in _context.Orders where o1.Year == o.Year - 1 && o1.Product == o.Product select o1).Count() > 100 select o; Messy. What I'd like to be able to do is to be able to break it down, eg: private IEnumerable<Order> LastSeasonOrders(Order order) { return (from o in _context.Orders where o.Year == order.Year - 1 && o.Product == order.Product select o); } which then lets me change the original query to: from o in _context.Orders where LastSeasonOrders(o).Count() > 100 select o; This doesn't seem to work, as I get method Blah has no supported translation to SQL when the query is run. Any quick tips on the correct way to achieve this?

    Read the article

  • [Delphi] How would you refactor this code?

    - by Al C
    This hypothetical example illustrates several problems I can't seem to get past, even though I keep trying!! ... Suppose the original code is a long event handler, coded in the UI, triggered when a user clicks a cell in a grid. Expressed as pseudocode it's: if Condition1=true then begin //loop through every cell in row, //if aCell/headerCellValue>1 then //color aCell red end else if Condition2=true then begin //do some other calculation adding cell and headerCell values, and //if some other product>2 then //color the whole row green end else show an error message I look at this and say "Ah, refactor to the strategy pattern! The code will be easier to understand, easier to debug, and easier to later extend!" I get that. And I can easily break the code into multiple procedures. The problem is ultimately scope related. Assume the pseudocode makes extensive use of grid properties, values displayed in cells, maybe even built-in grid methods. How do you move all that to another unit, without referencing the grid component in the UI--which would break all the "rules" about loose coupling that make OOP valuable? ... I'm really looking forward to responses. Thanks, as always -- Al C.

    Read the article

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >