Search Results

Search found 18409 results on 737 pages for 'large projects'.

Page 67/737 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • How to use R-Tree for plotting large number of map markers on google maps

    - by Eeyore
    After searching SO and multiple articles I haven't found a solution to my problem. What I am trying to achieve is to load 20,000 markers on Google Maps. R-Tree seems like a good approach but it's only helpful when searching for points within the visible part of the map. When the map is zoomed out it will return all of the points and...crash the browser. There is also the problem with dragging the map and at the end of dragging re-running the query. I would like to know how I can use R-Tree and be able to achieve the all of the above.

    Read the article

  • Sharing user controls acrros multiple websites

    - by Jasper
    Hello, I am currently working on a project which involves three different websites with a lot of common functionality. At the moment the common functionality is placed in a different website full of user controls. The problem is sharing the user controls across the multiple websites. Looking around on SO and other websites, the only solution seems the be using virtual directories. As this is a workable solution (we us this at the moment) it doesn't seem as a "clean" solution. Which "best practices" exist on sharing common functionality (including the GUI/HTML) between different site? Is it (for example) possible to create a single Web Application project and deploy subdirectories (each with their own web.config) to different production environments?

    Read the article

  • Are there any MVP Frameworks projects out there?

    - by Greg Malcolm
    MVC is used a number of popular frameworks. To name just a few, Ruby on Rails, ASP.NET MVC, Monorail, Spring MVC. Are there any equivalent frameworks using any variant of MVP? Most of the examples I've found online seem to be custom implementations of the pattern rather than reusable frameworks. Suggestions need not be specific to any particular programming language, my interest is mostly academic.

    Read the article

  • Does Python work in larger teams?

    - by Kugel
    I read this post last night and it got me thinking. I like python and "batteries", pypi and such. But I've only done python solo. Never tried it in a team. Are the points that Ted mentions valid? If they are how do teams cope with them? Does Python work in teams or even large teams? Or it kills productivity? I personally see the problems he mentions when I come back to my old code. Even when working with other modules sometimes I need to peek inside. I would like to hear people with experience on this.

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • Python 3.1 - Memory Error during sampling of a large list

    - by jimy
    The input list can be more than 1 million numbers. When I run the following code with smaller 'repeats', its fine; def sample(x): length = 1000000 new_array = random.sample((list(x)),length) return (new_array) def repeat_sample(x): i = 0 repeats = 100 list_of_samples = [] for i in range(repeats): list_of_samples.append(sample(x)) return(list_of_samples) repeat_sample(large_array) However, using high repeats such as the 100 above, results in MemoryError. Traceback is as follows; Traceback (most recent call last): File "C:\Python31\rnd.py", line 221, in <module> STORED_REPEAT_SAMPLE = repeat_sample(STORED_ARRAY) File "C:\Python31\rnd.py", line 129, in repeat_sample list_of_samples.append(sample(x)) File "C:\Python31\rnd.py", line 121, in sample new_array = random.sample((list(x)),length) File "C:\Python31\lib\random.py", line 309, in sample result = [None] * k MemoryError I am assuming I'm running out of memory. I do not know how to get around this problem. Thank you for your time!

    Read the article

  • Indexing large DB's with Lucene/PHP

    - by thebluefox
    Afternoon chaps, Trying to index a 1.7million row table with the Zend port of Lucene. On small tests of a few thousand rows its worked perfectly, but as soon as I try and up the rows to a few tens of thousands, it times out. Obviously, I could increase the time php allows the script to run, but seeing as 360 seconds gets me ~10,000 rows, I'd hate to think how many seconds it'd take to do 1.7million. I've also tried making the script run a few thousand, refresh, and then run the next few thousand, but doing this clears the index each time. Any ideas guys? Thanks :)

    Read the article

  • Flex - weird display behavior on large number of Canvas

    - by itarato
    Hi, I have a Flex app (SDK 3.5 - FP10) that does mindmap trees. Every node is a Canvas (I'm using Canvas specific properties so I needed it). It has a shadow effect, background color and some small ui element on it (like icons, texts...). It works perfectly until it goes over ~700 nodes (Canvas). Over that number it shows grey rectangles: http://yfrog.com/bhw2pj . If I turn off the DropShadowFilter effect for the Canvas, they are also gone, so I assume it's a DropShadowFilter problem: http://yfrog.com/2d9y8j . The effect is simple: private static var _nodeDropShadow:DropShadowFilter = new DropShadowFilter(1, 45, 0x888888, 1, 1, 1); _backgroundComp.filters = _nodeDropShadow; Is it possible that Flex can't handle that much? Thanks in advance

    Read the article

  • Cache for large read only database recommendation

    - by paddydub
    I am building site on with Spring, Hibernate and Mysql. The mysql database contains information on coordinates and locations etc, it is never updated only queried. The database contains 15000 rows of coordinates and 48000 rows of coordinate connections. Every time a request is processed, the application needs to read all these coordinates which is taking approx 3-4 seconds. I would like to set up a cache, to allow quick access to the data. I'm researching memcached at the moment, can you please advise if this would be my best option?

    Read the article

  • Interesting C projects that upgraded your skill level.

    - by JDQ
    I've been (thus far) unable to write a project in C that would be meaningful on any level. For a first project, I've thought of many, but done none. What was the project that changed your skill-level from noob to "coder" the most? Maybe I can take some tips and work on something similar? I was thinking of a toy language, but well, I wouldn't know how to go about that. This might be closed, but oh well :)

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • Combining features from other projects in an ASP.NET MVC application

    - by Katie D
    Hello, I am writing an ASP.NET MVC application that combines a set of features from existing applications. The new application is suppose to use UI features and logic created (especially for this purpose) in the existing applications. For that reason I wanted to create in the existing applications some kind of a "blackbox" that I will be able to drop in my new application along with a matching connection string, and it will work independently, binding data on it's own. I thought about using partial views, but I am having trouble with passing the model data to it, since the controller of the new application should not know about the model of the existing applications. I can not use ASP.NET WebForms, since my application should be a "postback-less" application, and ASP.NET AJAX toolkit or frameworks alike are out of the question. Any help would be greatly appreciated. Thank you, Katie

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • Large tables of static data with DBGhost

    - by Paulo Manuel Santos
    We are thinking of restructuring our database development and deployment processes by using DBGhost, we want to move away from the central development database and bring the database to the source control. One of the problems we have is a big table with static data (containing translated language strings), it has close to 200K rows. I know that our best solution is to move these stings into resource files, but until we implement that, will DbGhost be able to maintain all this static data and generate our development and deployment databases in a short time? And if not is there a good alternative to filling up this table whenever we need to?

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Copying eclipse projects through command line?

    - by Richie
    Hi, Does anyone know if it is possible to copy an existing project into a new, created workspace on the fly? I can create the workspace already through command line. I am thinking I either need to copy the whole project into another workspace (possible through command line?) or create a new project and copy the .classpath and .project folders. Any help is appreciated. Thanks, Richie

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

  • filesize of large files in c

    - by endeavormac
    How can I get the filesize of a file in C when the filesize is greater than 4gb? ftell returns a 4 byte signed long, limiting it to two bytes. stat has a variable of type off_t which is also 4 bytes (not sure of sign), so at most it can tell me the size of a 4gb file. What if the file is larger than 4 gb?

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >