Search Results

Search found 10471 results on 419 pages for 'express js'.

Page 68/419 | < Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • JS regular expression to find a substring surrounded by double quotes

    - by 2619
    I need to find a substring surrounded by double quotes, for example, like "test", "te\"st" or "", but not """ neither "\". To achieve this, which is the best way to go for it in the following 1) /".*"/g 2) /"[^"\\]*(?:\\[\S\s][^"\\]*)*"/g 3) /"(?:\\?[\S\s])*?"/g 4) /"([^"\\]*("|\\[\S\s]))+/g I was asked this question yesterday during an interview, and would like to know the answer for future reference.

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • How can I get the Forever to write to a different log file every day?

    - by user1438940
    I have a cluster of production servers running a Node.JS app via Forever. As far as I can tell, my options for log files are as follows: Let Forever do it on its own, in which case it will log to ~/.forever/XXXX.log Specify one specific log file for the entire life of the process What I'd like to do, however, is have it log to a different file every day. eg. 20121027.log, 20121028.log, etc. Is this possible? If so, how can it be done?

    Read the article

  • URL detection with JavaScript

    - by josh
    Hi! I'm using the following script to force a specific page - when loaded for the first time - into a (third-party) iFrame. <script type="text/javascript"> if(window.top==window) { location.reload() } else { } </script> (For clarification: This 'embedding' is done automatically by the third-party system but only if the page is refreshed once - for styling and some other reasons I want it there from the beginning.) Right now, I'm wondering if this script could be enhanced in ways that it's able to detect the current URL of its 'parent' document to trigger a specific action? Let's say the URL of the third-party site is 'http://cgi.site.com/hp/...' and the URL of the iFrame 'http://co.siteeps.com/hp/...'. Is it possible to realize sth. like this with JS: <script type="text/javascript"> if(URL is 'http://cgi.site.com/hp/...') { location.reload() } if(URL is 'http://co.siteeps.com/hp/...') { location.do-not.reload() resp. location.do-nothing() } </script> TIA josh

    Read the article

  • Trouble using ‘this.files’ in GruntJS Tasks

    - by whomba
    Background: So I’m new to writing grunt tasks, so hopefully this isn’t a stupid question. Purpose of my grunt task: Given a file (html / jsp / php / etc) search all the link / script tags, compare the href / src to a key, and replace with the contents of the file. Proposed task configuration: myTask:{ index:{ files:{src:"test/testcode/index.html", dest:"test/testcode/index.html"}, css:[ { file: "/css/some/css/file.css", fileToReplace:"/target/css/file.css" }, { file: "/css/some/css/file2.css", fileToReplace:"/target/css/file2.css" } ], js:[ { file: "/css/some/css/file.css", fileToReplace:”/target/css/file.css" }, { file: "/css/some/css/file2.css", fileToReplace:"/target/css/file2.css" } ] } } Problem: Now, per my understanding, when dealing with files, you should reference the ‘this.files’ object because it handles a bunch of nice things for you, correct? Using intelliJ and the debugger, I see the following when i watch the ‘this.files’ object: http://i.imgur.com/Gj6iANo.png What I would expect to see is src and dest to be the same, not dest ===‘src’ and src === undefined. So, What is it that I am missing? Is there some documentation on ‘this.files’ I can read about? I’ve tried setting the files attribute in the target to a number of other formats per grunts spec, none seem to work (for this script, ideally the src / dest would be the same, so the user would just have to enter it once, but i’m not even getting in to that right now.) Thanks for the help

    Read the article

  • Multiple mesh with one geometry and diferent textures. Error

    - by user1821834
    I have a loop where I create a multiple Mesh with different geometry, because each mesh has one texture: .... var geoCube = new THREE.CubeGeometry(voxelSize, voxelSize, voxelSize); var geometry = new THREE.Geometry(); for( var i = 0; i < voxels.length; i++ ){ var voxel = voxels[i]; var object; color = voxel.color; texture = almacen.textPlaneTexture(voxel.texto,color,voxelSize); //Return the texture with a color and a text for each face of the geometry material = new THREE.MeshBasicMaterial({ map: texture }); object = new THREE.Mesh(geoCube, material); THREE.GeometryUtils.merge( geometry, object ); } //Add geometry merged at scene mesh = new THREE.Mesh( geometry, new THREE.MeshFaceMaterial() ); mesh.geometry.computeFaceNormals(); mesh.geometry.computeVertexNormals(); mesh.geometry.computeTangents(); scene.add( mesh ); .... But now I have this error in the javascript code Three.js Uncaught TypeError: Cannot read property 'map' of undefined In the funcion: function bufferGuessUVType ( material ) { .... } Update: Finally I have removed the merged solution and I can use an unnique geometry for the all voxels. Altough I think that If I use merge meshes the app would have a better performance...

    Read the article

  • Why does Raphael's framerate slow down on this code?

    - by Bob
    So I'm just doing a basic orbit simulator using Raphael JS, where I draw one circle as the "star" and another circle as the "planet". It seems to be working just fine, with the one snag that as the simulation continues, its framerate progressively slows down until the orbital motion no longer appears fluid. Here's the code (note: uses jQuery only to initialize the page): $(function() { var paper = Raphael(document.getElementById('canvas'), 640, 480); var star = paper.circle(320, 240, 10); var planet = paper.circle(320, 150, 5); var starVelocity = [0,0]; var planetVelocity = [20.42,0]; var starMass = 3.08e22; var planetMass = 3.303e26; var gravConstant = 1.034e-18; function calculateOrbit() { var accx = 0; var accy = 0; accx = (gravConstant * starMass * ((star.attr('cx') - planet.attr('cx')))) / (Math.pow(circleDistance(), 3)); accy = (gravConstant * starMass * ((star.attr('cy') - planet.attr('cy')))) / (Math.pow(circleDistance(), 3)); planetVelocity[0] += accx; planetVelocity[1] += accy; planet.animate({cx: planet.attr('cx') + planetVelocity[0], cy: planet.attr('cy') + planetVelocity[1]}, 150, calculateOrbit); paper.circle(planet.attr('cx'), planet.attr('cy'), 1); // added to 'trace' orbit } function circleDistance() { return (Math.sqrt(Math.pow(star.attr('cx') - planet.attr('cx'), 2) + Math.pow(star.attr('cy') - planet.attr('cy'), 2))); } calculateOrbit(); }); It doesn't appear, to me anyway, that any part of that code would cause the animation to gradually slow down to a crawl, so any help solving the problem will be appreciated!

    Read the article

  • Previously working emberjs1.0-pre form on jsfiddle returns "error": "Please use POST request"

    - by brg
    This code ** http://jsfiddle.net/wagenet/ACzaJ/8/ ** was working a few days ago, when i returned to it today, it throws {"error": "Please use POST request"}, when i click add button Also the jsfiddle editor.js always throws exception on this line: function stop(){cc = stop; throw StopIteration;}; Does anyone knows the cause of this issue. Many thanks Update 1 Based on @Peter Wagenet's suggestions below, the form now logs entries or inputs to the console but it doesn't display on the result section of jsfiddle instead what is displayed on jsfiddle result section or page is still this error {"error": "Please use POST request"} ** http://jsfiddle.net/ACzaJ/18/ Update 2 In this fiddle, http://jsfiddle.net/ACzaJ/19/, i have successfully eliminated this error {"error": "Please use POST request"} by adding event.preventDefault(); to the submit action in Todos.TodoFormView. That allows us to use arbitrary view methods as action handlers. The existing issue is that the input to the form, only displays on the console and not on jsfiddle result section, though no error displays on the result section, there is a new error appearing in the console of the updated fiddle: Uncaught Error: Cannot perform operations on a Metamorph that is not in the DOM. Finally solved I needed to comment out App.initialize() for it to work as expected. This the working fiddle ** http://jsfiddle.net/ACzaJ/20/. I don't know why that is so, but my guess is that, App.initialize works with other parts like the router for routing, ApplicationController and ApplicationView with {{outlet}} in the handlebars, which i didn't need for this fiddle. Finally Finally and completely solved This ** http://jsfiddle.net/tQWn8/ works with App.initialize. But you have to declare all those components above and pass the router to App.initialize, like this App..initialize(router). If you don't do this, then you will get the old error Uncaught Error: Cannot perform operations on a Metamorph that is not in the DOM.

    Read the article

  • How to test the expectation on the eventSpy

    - by Lorraine Bernard
    I am trying to test a backbone.model when saving. Here's my piece of code. As you can see from the comment there is a problem with toHaveBeenCalledOnce method. P.S.: I am using jasmine 1.2.0 and Sinon.JS 1.3.4 describe('when saving', function () { beforeEach(function () { this.server = sinon.fakeServer.create(); this.responseBody = '{"id":3,"title":"Hello","tags":["garden","weekend"]}'; this.server.respondWith( 'POST', Routing.generate(this.apiName), [ 200, {'Content-Type': 'application/json'}, this.responseBody ] ); this.eventSpy = sinon.spy(); }); afterEach(function() { this.server.restore(); }); it('should not save when title is empty', function() { this.model.bind('error', this.eventSpy); this.model.save({'title': ''}); expect(this.eventSpy).toHaveBeenCalledOnce(); // TypeError: Object [object Object] has no method 'toHaveBeenCalledOnce' expect(this.eventSpy).toHaveBeenCalledWith(this.model, 'cannot have an empty title'); }); }); console.log(expect(this.eventSpy));

    Read the article

  • Multi-account sync with Dropbox API

    - by Dan
    I'm trying to create a web app that lets users share files with each other through Dropbox. At the moment, Dropbox handles all the sharing, and there's one central Dropbox account running on the web server that shares the folder with the people who want it. I'm trying to change it so people don't have to accept a new folder invitation each time. I'd like to have them authorize my app to access an app folder in their Dropbox account, and all their shared folders would go inside there. Any changes they make would get noticed by the app on the server and synced to everyone else's folders. There's a couple things I'm having trouble figuring out to make this work: Do I need to make repeated calls to /delta for every account? I can't think how else I'd do this, but that sounds like it would quickly turn into thousands of requests a minute just polling for updates. When someone adds a file, do I have to upload it once for each account? That seems like a huge waste of bandwidth. I've looked into using /copy_ref, which I think would add a file to another user's account without my app ever touching it, but my app's web interface also allows users to upload files directly to my server, which would then need to be synced with everyone else's folders. That file isn't on Dropbox's servers yet, so /copy_ref obviously wouldn't work. For a little extra context, my app is written in node.js, and I've been playing with this library to interface with Dropbox, which uses their REST API.

    Read the article

  • how to reapply knockout binding

    - by MikeW
    Currently I have a knockout binding that stripes rows in a list which works fine ko.bindingHandlers.stripe = { update: function (element, valueAccessor, allBindingsAccessor) { var value = ko.utils.unwrapObservable(valueAccessor()); //creates the dependency var allBindings = allBindingsAccessor(); var even = allBindings.evenClass; var odd = allBindings.oddClass; //update odd rows $(element).children(":nth-child(odd)").addClass(odd).removeClass(even); //update even rows $(element).children(":nth-child(even)").addClass(even).removeClass(odd); ; } } Triggered from <button data-bind="click: addWidget" style="display:none">Add Item</button> The problem I have is when reloading data from the server , I call addWidget() manually in the view model the stripe binding handler is not applied - all rows appear as same color, if I click the html button then the binding happens and stripes appear var ViewModel = function() { self.addWidget(); }); Is it possible to reapply this custom binding manually in js? Thanks Edit: The stripe binding gets applied like so <div data-bind="foreach: widgets, stripe: widgets, evenClass: 'light', oddClass: 'dark'">

    Read the article

  • Problem Render backbone collection using Mustache template

    - by RameshVel
    I am quite new to backbone js and Mustache. I am trying to load the backbone collection (Object array) on page load from rails json object to save the extra call . I am having troubles rendering the backbone collection using mustache template. My model & collection are var Item = Backbone.Model.extend({ }); App.Collections.Items= Backbone.Collection.extend({ model: Item, url: '/items' }); and view App.Views.Index = Backbone.View.extend({ el : '#itemList', initialize: function() { this.render(); }, render: function() { $(this.el).html(Mustache.to_html(JST.item_template(),this.collection )); //var test = {name:"test",price:100}; //$(this.el).html(Mustache.to_html(JST.item_template(),test )); } }); In the above view render, i can able to render the single model (commented test obeject), but not the collections. I am totally struck here, i have tried with both underscore templating & mustache but no luck. And this is the Template <li> <div> <div style="float: left; width: 70px"> <a href="#"> <img class="thumbnail" src="http://placehold.it/60x60" alt=""> </a> </div> <div style="float: right; width: 292px"> <h4> {{name}} <span class="price">Rs {{price}}</span></h4> </div> </div> </li> and my object array kind of looks like this

    Read the article

  • Javascript force GC collection? / Forcefully free object?

    - by plash
    I have a js function for playing any given sound using the Audio interface (creating a new instance for every call). This works quite well, until about the 32nd call (sometimes less). This issue is directly related to the release of the Audio instance. I know this because I've allowed time for the GC in Chromium to run and it will allow me to play another 32 or so sounds again. Here's an example of what I'm doing: <html><head> <script language="javascript"> function playSound(url) { snd = new Audio(url); snd.play(); delete snd; snd = null; } </script> </head> <body> <a href="#" onclick="playSound('blah.mp3');">Play sound</a> </body></html> I also have this, which works well for pages that have less than 32 playSound calls: var AudioPlayer = { cache: {}, play: function(url) { if (!AudioPlayer.cache[url]) AudioPlayer.cache[url] = new Audio(url); AudioPlayer.cache[url].play(); } }; But this will not work for what I want to do (dynamically replace a div with other content (from separate files), which have even more sounds on them - 1. memory usage would easily skyrocket, 2. many sounds will never play). I need a way to release the sound immediately. Is it possible to do this? I have found no free/close/unload method for the Audio interface. The pages will be viewed locally, so the constant loading of sounds is not a big factor at all (and most sounds are rather short).

    Read the article

  • How to pass dynamic parameters to .pde file

    - by Kalpana
    class Shape contains two methods drawCircle() and drawTriangle(). Each function takes different set of arguments. At present, I invoke this by calling the pde file directly. How to pass these arguments from a HTML file directly if I have to control the arguments being passed to the draw function? 1) Example.html has (current version) <script src="processing-1.0.0.min.js"></script> <canvas data-processing-sources="example.pde"></canvas> 2) Example.pde has class Shape { void drawCircle(intx, int y, int radius) { ellipse(x, y, radius, radius); } void drawTriangle(int x1, int y1, int x2, int y2, int x3, int y3) { rect(x1, y1, x2, y2, x3, y3); } } Shape shape = new Shape(); shape.drawCircle(10, 40, 70); I am looking to do something like this in my HTML file, so that I can move all the functions into a separate file and call them with different arguments to draw different shapes (much similar to how you would do it in Java) A.html <script> Shape shape = new Shape(); shape.drawCircle(10, 10, 3); </script> B.html <script> Shape shape = new Shape(); shape.drawTriangle(30, 75, 58, 20, 86, 75); </script> 2) Iam using Example2.pde has void setup() { size(200,200); background(125); fill(255); } void rectangle(int x1, int y1, int x2, int y2) { rect(x1, y1, x2, y2); } My Example2.html has var processingInstance; processingInstance.rectangle(30, 20, 55, 55); but this is not working. How to pass these parameters dynamically from html.

    Read the article

< Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >