Search Results

Search found 37875 results on 1515 pages for 'version space'.

Page 681/1515 | < Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • Invalid Argument javascript error only on certain computers

    - by Jen
    Getting an error whenever we click a particular button/link on our site. It is generating a javascript "Invalid Argument" error. I know in the other posts it is typically because it is a syntax error in the javascript however it only just seems to have started happening and it doesn't happen on all pcs. ie. in our client's environment if I remote onto their web server and view the uat website I get the javascript error. If I remote onto their sql server and view the uat website I don't get the javascript error. If it was a syntax error then I would always get the error wouldn't I? both browsers are the same version of IE6 (yeah I know...) :) I have tried deleting temporary internet files - including viewing the files and deleting them myself - but no joy. client uses citrix.. and they're all getting the error :( Any ideas would be appreciated - Thanks! :) Update - Sorry I haven't posted specific code as there is too much to post (and I'm not sure where the error is occurring). The "button" launches a new window which in turn opens up a couple of aspx pages and calls lots of javascript. So the window opens ok, and there's a function that gets called to resize the window - but before it calls the resizing of the window/content it throws the invalid argument error. Am busy trying to get alerts to trigger to see if I can see where it's falling over but so far no luck. Again not sure why this error doesn't occur when I use a particular PC (same browser version)

    Read the article

  • Maintenance tool for Application Database

    - by Thierry
    Hello ! Does anybody know about a good tool which help maintaining the database of an application ? I'm working on an application which uses a database (Microsoft Sql Server). When a development requires to change something in the database (e.g., structure, data migration...), we create a script (Transact-SQL script) and add it into our revision control tool (subversion - that tool also contains our code). Each script must add a line in a log table to keep a trace of all the scripts that have been ran into a database. In order to build a database for our application, one needs to run all scripts ordered by their creation date. I'm not really happy with this technique notably because it make application migration a bit hard. If we want to install a new version of the application somewhere, e.g., migrate from version 1.3 to 2.1, we must get all the scripts between these two versions. Then run them and ensure that everything is done in a transaction... For sure we could built home-made tools to help but I wonder if some tools already exists to do that kind of job.

    Read the article

  • CXF code first service, WSDL generation; soap:address changes?

    - by jcalvert
    I have a simple Java interface/implementation I am exposing via CXF. I have a jaxws element in my Spring configuration file like this: <jaxws:endpoint id="managementServiceJaxws" implementor="#managementService" address="/jaxws/ManagementService" > </jaxws:endpoint> It generates the WSDL from my annotated interface and exposes the service. Then when I hit http://myhostname/cxf/jaxws/ManagementService?wsdl I get a lovely WSDL. At the bottom in the wsdl:service element, I'll see <soap:address location="http://myhostname/cxf/jaxws/ManagementService"/> However, some time a day or so later, with no application restart, hitting that same url produces: This causes a number of problems, but what I really want is to fix it. Right now, there's a particular client to the webservice that sets the endpoint to localhost; because it runs on the same machine. Is it possible the wsdl is getting regenerated and cached and then exposing the 'localhost' version? In part I don't know the exact mechanism by which one goes from a ?wsdl request in CXF to the response. It seems almost certain that it's retrieving some cached version, given that it's supposed to be determining the address by asking the servletcontainer (Jetty). For reference I know a stopgap solution is using the hostname on the client and making sure an alias in place so that it goes over the loopback. EDIT: For reference, I confirmed that if I bring my application up and first hit it over localhost, then querying for the wsdl via the hostname shows the address as localhost. Conversely, first hitting it over the hostname causes localhost requests to show the hostname. So obviously something is getting cached here.

    Read the article

  • Why is UseCompatibleTextRendering needed here?

    - by HotOil
    Hi, I think I'm missing something fundamental. Please tell me what it is, if you can. I have developed a little C++ WinForms app using VS2008. So it is built using .NET 3.5 SP1. My development box is Win7, if that matters. The default value of UseCompatibleTextRendering property in WinForms controls is false in this version of VStudio. And this should not matter to me, I don't think. I don't have any custom-drawn text or controls. The app looks good running on my Win7 box. If I package it up (dragging along .NET 3.5) and install it on one of our WinXP desktops, the buttons and labels don't look good; the text is chopped off in them. If I set UseCompatibleTextRendering to true and then run it on the XP boxes, the text fits into the buttons and labels. My question is: Why? The installation puts .Net 3.5 on the XP boxes, so the app should be able to find and use the right version of WinForms, right? I should note that before I put my app + .NET 3.5 on these boxes, they have no .NET at all. They do not get automatic Microsoft updates; our IT guy gates the patches and upgrades. [ This sort of thing has happened before with apps I create.. they look/work great on the Engineering machines, because we maintain those and they mostly have up-to-date stuff. When they are run on the corporate boxes, they usually don't run and need the VCredist installed. ] Back to the question at hand: The text looks better with the UseCompatibleTextRendering set to false, so I'd rather keep it that way, if I can. I'd like to understand what might be missing on those XP boxes that is making the text not fit. Thanks S

    Read the article

  • Handle BACK key event in child view

    - by Mick Byrne
    In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

    Read the article

  • Can anyone explain this strange behaviour?

    - by partizan
    Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false! this is not the expected result } } So, what do you think about this?

    Read the article

  • Conditional references in .NET project, possible to get rid of warning?

    - by Lasse V. Karlsen
    I have two references to a SQLite assembly, one for 32-bit and one for 64-bit, which looks like this (this is a test project to try to get rid of the warning, don't get hung up on the paths): <Reference Condition=" '$(Platform)' == 'x64' " Include="System.Data.SQLite, Version=1.0.61.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=AMD64"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\64-bit\System.Data.SQLite.DLL</HintPath> </Reference> <Reference Condition=" '$(Platform)' == 'x86' " Include="System.Data.SQLite, Version=1.0.65.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139, processorArchitecture=x86"> <SpecificVersion>True</SpecificVersion> <HintPath>..\..\LVK Libraries\SQLite3\version_1.0.65.0\32-bit\System.Data.SQLite.DLL</HintPath> </Reference> This produces the following warning: Warning 1 The referenced component 'System.Data.SQLite' could not be found. Is it possible for me to get rid of this warning? One way I've looked at it to just configure my project to be 32-bit when I develop, and let the build machine fix the reference when building for 64-bit, but this seems a bit awkward and probably prone to errors. Any other options? The reason I want to get rid of it is that the warning is apparently being picked up by TeamCity and periodically flagged as something I need to look into, so I'd like to get completely rid of it.

    Read the article

  • Cannot display converted value inside xml field

    - by zurna
    PS: My bad, there was not an error. I forgot to upload the latest version to the server... I have multimedias and images table. I save images in multimedias table with their images table id numbers. Then whenever I need image's url, with a simple function I get it from images table. The problem I am having is when I try to display image's url inside ImageURL, it just does not happen. This is very annoying. xml output <?xml version='1.0' encoding='windows-1254' ?> <rows><row id='1'> <MultimediaTitle>Hagi Goals</MultimediaTitle> /FLPM/media/images/5Y2K4T5V_sm.jpg <ImageURL><![CDATA[]]></ImageURL> <Videos> <VideoID id='1'><VideoURL>/FLPM/media/videos/0H7T9C0F.flv</VideoURL></VideoID> <VideoID id='2'><VideoURL>/FLPM/media/videos/9L6X9G9J.flv</VideoURL></VideoID> </Videos> </row> </rows>

    Read the article

  • waveInProc / Windows audio question...

    - by BTR
    I'm using the Windows API to get audio input. I've followed all the steps on MSDN and managed to record audio to a WAV file. No problem. I'm using multiple buffers and all that. I'd like to do more with the buffers than simply write to a file, so now I've got a callback set up. It works great and I'm getting the data, but I'm not sure what to do with it once I have it. Here's my callback... everything here works: // Media API callback void CALLBACK AudioRecorder::waveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD dwInstance, DWORD dwParam1, DWORD dwParam2) { // Data received if (uMsg == WIM_DATA) { // Get wav header LPWAVEHDR mBuffer = (WAVEHDR *)dwParam1; // Now what? for (unsigned i = 0; i != mBuffer->dwBytesRecorded; ++i) { // I can see the char, how do get them into my file and audio buffers? cout << mBuffer->lpData[i] << "\n"; } // Re-use buffer mResultHnd = waveInAddBuffer(hWaveIn, mBuffer, sizeof(mInputBuffer[0])); // mInputBuffer is a const WAVEHDR * } } // waveInOpen cannot use an instance method as its callback, // so we create a static method which calls the instance version void CALLBACK AudioRecorder::staticWaveInProc(HWAVEIN hWaveIn, UINT uMsg, DWORD_PTR dwInstance, DWORD_PTR dwParam1, DWORD_PTR dwParam2) { // Call instance version of method reinterpret_cast<AudioRecorder *>(dwParam1)->waveInProc(hWaveIn, uMsg, dwInstance, dwParam1, dwParam2); } Like I said, it works great, but I'm trying to do the following: Convert the data to short and copy into an array Convert the data to float and copy into an array Copy the data to a larger char array which I'll write into a WAV Relay the data to an arbitrary output device I've worked with FMOD a lot and I'm familiar with interleaving and all that. But FMOD dishes everything out as floats. In this case, I'm going the other way. I guess I'm basically just looking for resources on how to go from LPSTR to short, float, and unsigned char. Thanks much in advance!

    Read the article

  • MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

    - by user768113
    I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • XSLT - Comparing preceding-sibling's elements with current's node element

    - by siondream
    Hello, I have this XML file: <recursos> <recurso url="http://w3c.com"> <descripcion>Consorcio W3C</descripcion> <tipo>externo</tipo> <idioma>ingles</idioma> <contenido>General</contenido> <unidad>Unidad 2</unidad> </recurso> <recurso url="http://html.com"> <descripcion>Especificación HTML</descripcion> <tipo>externo</tipo> <idioma>castellano</idioma> <contenido>HTML</contenido> <version>4.01</version> <unidad>Unidad 3</unidad> </recurso> </recursos> I want to compare one "recurso"'s preceding sibling element "unidad" with the "unidad" of the current "recurso" to check if they're different. I was trying: <xsl:if test="preceding-sibling::recurso[position()=1]::unidad != unidad"> </xsl:if> But I know it's horribly wrong :( I hope you could help me, thank you very much.

    Read the article

  • Difference in calling redefined functions in F# and Clojure

    - by Michiel Borkent
    In F#: > let f x = x + 2;; val f : int -> int > let g x = f x;; val g : int -> int > g 10;; val it : int = 12 > let f x = x + 3;; val f : int -> int > g 10;; val it : int = 12 In Clojure: (defn f [x] (+ x 2)) (defn g [x] (f x)) (g 10) ;; => 12 (defn f [x] (+ x 3)) (g 10) ;; => 13 Note that in Clojure the most recent version of f gets called in the last line. In F# however still the old version of f is called. Why is this?

    Read the article

  • WCF service not working after program update

    - by Boesj
    I have recently added a WCF service reference to my program. When I perform a clean install of this program, everything seems to work as expected. But, when I install the program on a client which already has a previous version (without the new service reference) installed, I get a exception telling me the default endpoint for this particular service could not be found. It seems that the appname.exe.config is not being updated with the new endpoint settings. Is there any reason for this and how can I force the installer to overwrite the config file? I'm using the default Visual Studio 2008 installer project with RemovePreviousVersions set to True. Update: My program encrypts the settings section after the first run with the following code Configuration config = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None); ConfigurationSection section = config.GetSection(sectionKey); if (section != null) { if (!section.SectionInformation.IsProtected) { if (!section.ElementInformation.IsLocked) { section.SectionInformation.ProtectSection("DataProtectionConfigurationProvider"); section.SectionInformation.ForceSave = true; config.Save(ConfigurationSaveMode.Full); } } } When I do not run the program before installing the new version the app.config gets updated.

    Read the article

  • How to provide i18n service for developer and end user

    - by user247245
    Many android applications have quite poor i18n-support, and for an understandable reason, as it adds much work for the developer. From a both intuitive and cultural point of view it would be a good thing if end-users could translate the apps themself, and OTA share the translation, without reinstalling the app itself. In concept; as wikipedia, some add content easily, others only use what's there. It's of course important that the service is as easy as possible to use, both for app-developers, and people willing to transcribe. To keep it simple, this is the solution I'm concidering; Developer perspective: Developer uses a customized setContentView when open activities/layouts that will seach for thanslations of xml-entries. (below) The customized version is provided as a free downloadable library/class..., turning the i18n feature to more or less a one liner. User perspective: User downloads app without any translation As app launches, it checks locale running at phone, and will look for a translated xml-file at shared space in SD. If no or old transcribed xml (above), try to download new from internet-service (ansync). This is all done by library above, no need for intents. Translator perspective: Separate app to provide translations for any app using the i18n service above. (Could be just a webapp), with some form of QA on translators/input. QUESTION: Now, for this to work efficiently, it has to be AeasyAP for the developer to even bother, and the most fluent solution would be a customized version of setContentView, that simply loads the translated values from external xml, instead of the ones in the apk. Is this possible at all, and if not, what's your suggested solutions? (And of course, Happy New Year, feliz ano novo, blwyddyn newydd dda, Gott Nytt År, kontan ane nouvo, szczesliwego nowego roku ...) Regards, /T

    Read the article

  • Subversion freaking out on me!

    - by Malfist
    I have two copies of a site, one is the production copy, and the other is the development copy. I recently added everything in the production to a subversion repository hosted on our linux backup server. I created a tag of the current version and I was done. I then copied the development copy overtop of the production copy (on my local machine where I have everything checked out). There are only 10-20 files changed, however, when I use tortoise SVN to do a commit, it says every file has changed. The diff file generated shows subversion removing everything, and replacing it with the new version (which is the exact same). What is going on? How do I fix it? An example diff: Index: C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html =================================================================== --- C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (revision 5) +++ C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (working copy) @@ -1,4 +1,4 @@ -<html> -<body bgcolor="#FFFFFF"> -</body> +<html> +<body bgcolor="#FFFFFF"> +</body> </html> \ No newline at end of file

    Read the article

  • Visual Studio 2012 won't start

    - by David Aleu
    I installed VS2012 Premium from our MSDN subscription and it was working fine the first couple of days but then I installed a few extensions I can't now start VS2012 and it gives the error: Faulting application name: devenv.exe, version: 11.0.50727.1, time stamp: 0x5011ecaa Faulting module name: ntdll.dll, version: 6.1.7601.17725, time stamp: 0x4ec49b8f Exception code: 0xc0000374 Fault offset: 0x000ce6c3 Faulting process id: 0xee8 Faulting application start time: 0x01cd89bb777fc1dd Faulting application path: C:\Program Files (x86)\Microsoft Visual Studio 11.0\Common7\IDE\devenv.exe Faulting module path: C:\Windows\SysWOW64\ntdll.dll I'm running it on Windows 7 64 bit. I've tried to repair, uninstall and install again and nothing. I tried to restore to a previous restore system point but nothing. The extensions I installed I can remember: VS10x Code Map VSCommands Visual SVN Nuget manager (all the above my colleagues have it too and it works fine for them) and: Web Essentials Visual Studio Color Theme Editor SlowCheetah Mobile Ready HTML5 Questions are: Anyone else has had this problem? Is there a way I can uninstall extensions from a command line or software? (I removed the extensions folder but that doesn't do anything) Can I repair the "C:\Windows\SysWOW64\ntdll.dll"? Is it really a problem with this dll? I haven't been able to find any similar issue in other versions and because VS2012 is new doesn't seem to be much information either.

    Read the article

  • Error running web project in eclipse

    - by DarkKnight
    I am a newbie to servlets. I created a dynamic web project in eclipse. I have following files in my project home.html validateServlet.java I have defined validated servlet as an action in home.html form. However when I run it, I get http status 404. Below is the hierarchy of my project Project Java Resources src com.servlets ValidateServlet.java build WebContent META-INF WEB-INF web.xml hello.html Contents of my web.xml are as follows: <?xml version="1.0" encoding="UTF-8"?> <web-app xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:web="http://java.sun.com/xml/ns/javaee/web- app_2_5.xsd" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_3_0.xsd" id="WebApp_ID" version="3.0"> <display-name>Website</display-name> <servlet> <description></description> <display-name>ValidateServlet</display-name> <servlet-name>validate</servlet-name> <servlet-class>com.oracle.coen235.servlets.ValidateServlet</servlet-class> </servlet> </web-app> In my hello.html, action is specified as , What might be the issue? I guess I am not able to generate the class file for my servlet. Can anyone guide me through this problem?

    Read the article

  • Recoverable error while running XSL

    - by Kate
    XSL: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:ve="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:r="http://schemas.openxmlformats.org/officeDocument/2006/relationships" xmlns:m="http://schemas.openxmlformats.org/officeDocument/2006/math" xmlns:v="urn:schemas-microsoft-com:vml" xmlns:wp="http://schemas.openxmlformats.org/drawingml/2006/wordprocessingDrawing" xmlns:w10="urn:schemas-microsoft-com:office:word" xmlns:w="http://schemas.openxmlformats.org/wordprocessingml/2006/main" xmlns:wne="http://schemas.microsoft.com/office/word/2006/wordml" exclude-result-prefixes="wp wne w10 w ve o r m v" version="2.0"> <xsl:output method="text"/> <xsl:param name="styleName"/> <xsl:template match="w:p"> <xsl:apply-templates/><xsl:text>&#10;</xsl:text> </xsl:template> <xsl:template match="w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]"> <xsl:value-of select="replace(., '.', '&#xFF00;')"/> </xsl:template> </xsl:stylesheet> While processing the above XSL, I am getting the below error, Recoverable Error: Recoverable error on line 11 FORG0006: An error occurred matching pattern {w:r[not ((parent::w:hyperlink[@w:anchor[matches(.,concat('^(',$styleName,')')),'i']]))]}: Effective boolean value is not defined for a sequence of two or more items starting with a boolean Please Help. I am not able to figure out this.

    Read the article

  • Multi-client C# ODBC (Sybase/Oracle/MSSQL) table access question.

    - by Hamish Grubijan
    I am working on a feature that would allow clients pick a unique identifier (ci_name). The code below is a generic version that gets expanded to the right sql depending on the vendor. Hopefully it makes sense. #include "sql.h" create table client_identification ( ci_id TYPE_ID IDENTITY, ci_name varchar(64) not null, constraint ci_pk primary key (ci_name) ); go CREATE_SEQUENCE(ci_id) There will be simple stored procedures for adding, retrieving, and deleting these user records. This will be used by several admins. This will not happen very frequently, but there is still a possibility that something will be added or deleted since the list was initially retrieved. I have not yet decided if I need to detect the case of a double delete, but the user name cannot be created twice - primary key constraint will object. I want to be able to detect this particular case and display something like: "you snooze - you loose." :) I would like to leverage the pk constraint instead of doing some extra sql gymnastics. So, how can I detect this case cleanly, so that it works in MS SQL 2008, Sybase, and Oracle? I hope to do better than catch a general ODBC exception and parse out the text and look for what Sybase, Oracle, and MSSQL would give me back. Oracle is a little different. We actually prepend these variables to the Oracle version of stored procedures because they are not available otherwise: Vret_val out number, Vtran_count in out number, Vmessage_count in out number, Thanks. General helpful tips and comments are welcome, except for naming convention ones ( I do not have a choice here, plus I mangled the actual names a bit).

    Read the article

  • Kohana Auth Library Deployment

    - by Steve
    My Kohana app runs perfectly on my local machine. When I deployed my app to a server (and adjust the config files appropriately), I can no longer log into the app. I've traced through the app login routine on both my local version and the server version and they both agree with each other all the way through until you get to the auth.php controller logged_in() routine where suddenly, at line 140 - the is_object($this-user) test - the $user object no longer exists!?!?!? The login() function call that calls the logged_in() function successfully passes the following test, which causes a redirect to the logged_in() function. if(Auth::instance()->login($user, $post['password'])) Yes, the password and hash, etc all work perfectly. Here is the offending code: public function logged_in() { if ( ! is_object($this->user)) { // No user is currently logged in url::redirect('auth/login'); } etc... } As the code is the same between my local installation and the server, I reckon it must be some server setting that is messing with me. FYI: All the rest of the code works because I have a temporary backdoor available that allows me to use the application (view pages of tables, etc) without being logged in. Any ideas?

    Read the article

  • RMagick transparent_color deprecated? What's the alternative?

    - by user315975
    I'm developing an app that does a fair amount of generating transparent pngs on the fly. These are used as overlays, to show areas of interest in a graphic, so they have to have transparent backgrounds. I am developing in Ruby on Rails, deploying on Heroku. What works fine in development is not working in production. I get this error when I call a drawing routine using RMagick: NotImplementedError (the `transparent_color=' method is not supported by ImageMagick 6.2.4): /usr/local/lib/ruby/gems/1.8/gems/rmagick-1.15.17/lib/RMagick.rb:1691:in `transparent_color=' I'm using RMagick version 2.12.1 on the development machine, but I'm not exactly certain how to discover the version of ImageMagick that it's running, so I'm not sure if this is a case of my local code being behind or ahead. I'm hoping behind, because perhaps then there'll be a replacement for this call. Does anyone know what the fix is here? What's required to generate a transparent background, if not the call I'm using? I can't find this in the documentation: in fact, it was on a third-party site that I found mention of this capability.

    Read the article

  • Should TcpClient be used for this scenario?

    - by Martín Marconcini
    I have to communicate with an iPhone. I have its IP Address and the port (obtained via Bonjour). I need to send a header that is “0x50544833” (or similar, It’s an HEX number), then the size of the data (below) and then the data itself. The data is just a string that looks like this: <?xml version="1.0" encoding="utf-8"?> <!DOCTYPE plist SYSTEM "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>clientName</key> <string>XXX</string> <key>clientService</key> <string>0be397e7-21f4-4d3c-89d0-cdf179a7e14d</string> <key>registerCode</key> <string>0000</string> </dict> </plist> The requirement also says that I must send the data in little endian format (which I think is the default for Intel anyway). So it would be: hex_number + size of data + string_with_the_above_xml. I need to send that to the iPhone and read the response. What would be, according to your experience, the best way to send this data (and read the response)?

    Read the article

  • jquery fail to retrieve accurate data from sibling field.

    - by i need help
    wonder what's wrong <table id=tblDomainVersion> <tr> <td>Version</td> <td>No of sites</td> </tr> <tr> <td class=clsversion>1.25</td> <td><a id=expanddomain>3 sites</a><span id=spanshowall></span></td> </tr> <tr> <td class=clsversion>1.37</td> <td><a id=expanddomain>7 sites</a><span id=spanshowall></span></td> </tr> </table> $('#expanddomain').click(function() { //the siblings result incorrect //select first row will work //select second row will no response var versionforselected= $('#expanddomain').parent().siblings("td.clsversion").text(); alert(versionforselected); $.ajax({ url: "ajaxquery.php", type: "POST", data: 'version='+versionforselected, timeout: 900000, success: function(output) { output= jQuery.trim(output); $('#spanshowall').html(output); }, }); });

    Read the article

< Previous Page | 677 678 679 680 681 682 683 684 685 686 687 688  | Next Page >