Search Results

Search found 20785 results on 832 pages for 'idea'.

Page 684/832 | < Previous Page | 680 681 682 683 684 685 686 687 688 689 690 691  | Next Page >

  • Getting the ranking of a photo in SQL

    - by Jake Petroules
    I have the following tables: Photos [ PhotoID, CategoryID, ... ] PK [ PhotoID ] Categories [ CategoryID, ... ] PK [ CategoryID ] Votes [ PhotoID, UserID, ... ] PK [ PhotoID, UserID ] A photo belongs to one category. A category may contain many photos. A user may vote once on any photo. A photo can be voted for by many users. I want to select the ranks of a photo (by counting how many votes it has) both overall and within the scope of the category that photo belongs to. The count of SELECT * FROM Votes WHERE PhotoID = @PhotoID being the number of votes a photo has. I want the resulting table to have generated columns for overall rank, and rank within category, so that I may order the results by either. So for example, the resulting table from the query should look like: PhotoID VoteCount RankOverall RankInCategory 1 48 1 7 3 45 2 5 19 33 3 1 2 17 4 3 7 9 5 5 ... ...you get the idea. How can I achieve this? So far I've got the following query to retrieve the vote counts, but I need to generate the ranks as well: SELECT PhotoID, UserID, CategoryID, DateUploaded, (SELECT COUNT(CommentID) AS Expr1 FROM dbo.Comments WHERE (PhotoID = dbo.Photos.PhotoID)) AS CommentCount, (SELECT COUNT(PhotoID) AS Expr1 FROM dbo.PhotoVotes WHERE (PhotoID = dbo.Photos.PhotoID)) AS VoteCount, Comments FROM dbo.Photos

    Read the article

  • Passing ByteArray from flash (as3) to AMFPHP (2.0.1)

    - by Mauro
    i have a problem passing ByteArray from flash (as3) to amfphp to save an image. With old version of amfphp, all worked in the past… now, with new version i have many problem. I'm using version 2.0.1 and the first problem is that i have to do this, for access to my info: function SaveAsJPEG($json) { $string = json_encode($json); $obj = json_decode($string); $compressed = $obj->{'compressed'}; } in the past i wrote only: function SaveAsJPEG($json) { $compressed = $json['compressed']; } Anyway… now i can take all data (if i use " $json['compressed']" i receive an error) but i can't receive my ByteArray data. From flash i write this: var tempObj:Object = new Object(); tempObj["jpgStream "]= createBitStream(myBitmmapData); // return ByteArray tempObj["compressed"] = false; tempObj["dir"] = linkToSave; tempObj["name"] = this.imageName; So.. in my php class i receive all correct info, except "jpgStream" that seems "null". Do you have any idea?

    Read the article

  • How to organize and manage multiple database credentials in application?

    - by Polaris878
    Okay, so I'm designing a stand-alone web service (using RestLET as my framework). My application is divided in to 3 layers: Data Layer (just above the database, provides APIs for connecting to/querying database, and a database object) Object layer (responsible for serialization from the data layer... provides objects which the client layer can use without worrying about database) Client layer (This layer is the RestLET web service... basically just creates objects from the object layer and fulfills webservice request) Now, for each object I create in the object layer, I want to use different credentials (so I can sandbox each object...). The object layer should not know the exact credentials (IE the login/pw/DB URL etc). What would be the best way to manage this? I'm thinking that I should have a super class Database object in my data layer... and each subclass will contain the required log-in information... this way my object layer can just go Database db = new SubDatabase(); and then continue using that database. On the client level, they would just be able to go ItemCollection items = new ItemCollection(); and have no idea/control over the database that gets connected. I'm asking this because I am trying to make my platform extensible, so that others can easily create services off of my platform. If anyone has any experience with these architectural problems or how to manage this sort of thing I'd appreciate any insight or advice... Feel free to ask questions if this is confusing. Thanks! My platform is Java, the REST framework I'm using is RestLET, my database is MySQL.

    Read the article

  • Dynamic/Generic ViewModelBase?

    - by Shimmy
    I am learning MVVM now and I understand few things (more than but few are here..): Does every model potentially exposed (thru a VM) to the View is having a VM? For example, if I have a Contact and Address entity and each contact has an Addresses (many) property, does it mean I have to create a ContactViewModel and an AddressViewModel etc.? Do I have to redeclare all the properties of the Model again in the ViewModel (i.e. FirstName, LastName blah blah)? why not have a ViewModelBase and the ContactViewMode will be a subclass of ViewModelBase accessing the Entity's properties itself? and if this is a bad idea that the View has access to the entity (please explain why), then why not have the ViewModelBase be a DynamicObject (view the Dictionary example @ the link page), so I don't have to redeclare all the properties and validation over and over in the two tiers (M & VM) - because really, the View is anyway accessing the ViewModel's fields via reflection anyway. I think MVVM was the hardest technology I've ever learned. it doesn't have out-the-box support and there are to many frameworks and methods to achieve it, and in the other hand there is no arranged way to learn it (as MVC for instance), learning MVVM means browsing and surfing around trying to figure out what's better. Bottom line, what I mean by this section is please go and vote to MSFT to add MVVM support in the BCL and generators for VMs and Vs according to the Ms. Thanks

    Read the article

  • High Runtime for Dictionary.Add for a large amount of items

    - by aaginor
    Hi folks, I have a C#-Application that stores data from a TextFile in a Dictionary-Object. The amount of data to be stored can be rather large, so it takes a lot of time inserting the entries. With many items in the Dictionary it gets even worse, because of the resizing of internal array, that stores the data for the Dictionary. So I initialized the Dictionary with the amount of items that will be added, but this has no impact on speed. Here is my function: private Dictionary<IdPair, Edge> AddEdgesToExistingNodes(HashSet<NodeConnection> connections) { Dictionary<IdPair, Edge> resultSet = new Dictionary<IdPair, Edge>(connections.Count); foreach (NodeConnection con in connections) { ... resultSet.Add(nodeIdPair, newEdge); } return resultSet; } In my tests, I insert ~300k items. I checked the running time with ANTS Performance Profiler and found, that the Average time for resultSet.Add(...) doesn't change when I initialize the Dictionary with the needed size. It is the same as when I initialize the Dictionary with new Dictionary(); (about 0.256 ms on average for each Add). This is definitely caused by the amount of data in the Dictionary (ALTHOUGH I initialized it with the desired size). For the first 20k items, the average time for Add is 0.03 ms for each item. Any idea, how to make the add-operation faster? Thanks in advance, Frank

    Read the article

  • How can I set the tab on a webpage depending on which page you come from in ASP.Net MVC?

    - by uriDium
    I have a rather large entity. It has a parent relationship with many different child tables. Each of the child tables I have represented as a tab (luckily it makes sense and looks nice and makes things easier to navigate). If the users wants to add a new child row, they go the particular tab, and there they see a list of rows which is owned by the parent and they can do the usual CRUD. The CRUD takes them to a new controller and action and passes the ID of the parent to the action. (This is as far as I can tell what I was meant to do, any other ideas??) When they have finsihed they click save and it takes them back to the original page BUT I want it to automatically go to the right tab. How can I do this? I am using Jquery UI tabs, ASP.Net MVC 2.0. One idea I had was to just go back to the bookmark (the href part with the #, for e.g. /Parent/Details/4/#tabname). Apparently JQuery UI tabs can handle this. Or to set the tab name as part of the query string (/Parent/Details/4?tab=name) What is the best practise here?

    Read the article

  • Exposing a service to external systems - How should I design the contract?

    - by Larsi
    Hi! I know this question is been asked before here but still I'm not sure what to select. My service will be called from many 3 party system in the enterprise. I'm almost sure the information the service will collect (MyBigClassWithAllInfo) will change during the products lifetime. Is it still a good idea to expose objects? This is basically what my two alternatives: [ServiceContract] public interface ICollectStuffService { [OperationContract] SetDataResponseMsg SetData(SetDataRequestMsg dataRequestMsg); } // Alternative 1: Put all data inside a xml file [DataContract] public class SetDataRequestMsg { [DataMember] public string Body { get; set; } [DataMember] public string OtherPropertiesThatMightBeHandy { get; set; } // ?? } // Alternative 2: Expose the objects [DataContract] public class SetDataRequestMsg { [DataMember] public Header Header { get; set; } [DataMember] public MyBigClassWithAllInfo ExposedObject { get; set; } } public class SetDataResponseMsg { [DataMember] public ServiceError Error { get; set; } } The xml file would look like this: <?xml version="1.0" encoding="utf-8"?> <Message>   <Header>     <InfoAboutTheSender>...</InfoAboutTheSender>   </Header>   <StuffToCollectWithAllTheInfo>   <stuff1>...</stuff1> </StuffToCollectWithAllTheInfo> </Message> Any thought on how this service should be implemented? Thanks Larsi

    Read the article

  • ASP.NET Show/Hide Sections in a Datagrid row.

    - by ViperMAN
    Hi All, I have a datagrid where each row has information on Employees in a company. I would like to allow each row the ability to show/hide extra information. My first idea was use the CollapsiblePanelExtender from the AJAX toolkit and have each row like this: <ajaxtoolkit:collapsiblepanelextender TargetControlID="panel2"> ExpandControlID="LinkButton1" CollapseControlID="LinkButton1"> </ajaxtoolkit:collapsiblepanelextender> <asp:panel> FirstName | LastName | Phone | Email <LinkButton1> <- this hides/show extra info in panel2 </asp:panel> <asp:panel2> <textbox ="FirstName"> <textbox ="LastName"> <textbox ="EmailName"> ... ...lots of textboxes where information is assigned from the database. </asp:panel2> This works very well but it can be computationally expensive. The extra information panel has a lot of textboxes/labels, all of which gets its values from the database. Everytime the page loads all the data is got from the database at the start, some of it is hidden. Is there a better way to achieve my goal? Or is there a way to only load an employees extra details when the Show/Hide button is click? Thanks in advance!

    Read the article

  • Getting wierd issue with TO_NUMBER function in Oracle

    - by Fazal
    I have been getting an intermittent issue when executing to_number function in the where clause on a varchar2 column if number of records exceed a certain number n. I used n as there is no exact number of records on which it happens. On one DB it happens after n was 1 million on another when it was 0.1. million. E.g. I have a table with 10 million records say Table Country which has field1 varchar2 containing numberic data and Id If I do a query as an example select * from country where to_number(field1) = 23 and id 1 and id < 100000 This works But if i do the query select * from country where to_number(field1) = 23 and id 1 and id < 100001 It fails saying invalid number Next I try the query select * from country where to_number(field1) = 23 and id 2 and id < 100001 It works again As I only got invalid number it was confusing, but in the log file it said Memory Notification: Library Cache Object loaded into SGA Heap size 3823K exceeds notification threshold (2048K) KGL object name :with sqlplan as ( select c006 object_owner, c007 object_type,c008 object_name from htmldb_collections where COLLECTION_NAME='HTMLDB_QUERY_PLAN' and c007 in ('TABLE','INDEX','MATERIALIZED VIEW','INDEX (UNIQUE)')), ws_schemas as( select schema from wwv_flow_company_schemas where security_group_id = :flow_security_group_id), t as( select s.object_owner table_owner,s.object_name table_name, d.OBJECT_ID from sqlplan s,sys.dba_objects d It seems its related to SGA size, but google did not give me much help on this. Does anyone have any idea about this issue with TO_NUMBER or oracle functions for large data?

    Read the article

  • Linker error: wants C++ virtual base class destructor

    - by jdmuys
    Hi, I have a link error where the linker complains that my concrete class's destructor is calling its abstract superclass destructor, the code of which is missing. This is using GCC 4.2 on Mac OS X from XCode. I saw http://stackoverflow.com/questions/307352/g-undefined-reference-to-typeinfo but it's not quite the same thing. Here is the linker error message: Undefined symbols: "ConnectionPool::~ConnectionPool()", referenced from: AlwaysConnectedConnectionZPool::~AlwaysConnectedConnectionZPool()in RKConnector.o ld: symbol(s) not found collect2: ld returned 1 exit status Here is the abstract base class declaration: class ConnectionPool { public: static ConnectionPool* newPool(std::string h, short p, std::string u, std::string pw, std::string b); virtual ~ConnectionPool() =0; virtual int keepAlive() =0; virtual int disconnect() =0; virtual sql::Connection * getConnection(char *compression_scheme = NULL) =0; virtual void releaseConnection(sql::Connection * theConnection) =0; }; Here is the concrete class declaration: class AlwaysConnectedConnectionZPool: public ConnectionPool { protected: <snip data members> public: AlwaysConnectedConnectionZPool(std::string h, short p, std::string u, std::string pw, std::string b); virtual ~AlwaysConnectedConnectionZPool(); virtual int keepAlive(); // will make sure the connection doesn't time out. Call regularly virtual int disconnect(); // disconnects/destroys all connections. virtual sql::Connection * getConnection(char *compression_scheme = NULL); virtual void releaseConnection(sql::Connection * theConnection); }; Needless to say, all those members are implemented. Here is the destructor: AlwaysConnectedConnectionZPool::~AlwaysConnectedConnectionZPool() { printf("AlwaysConnectedConnectionZPool destructor call"); // nothing to destruct in fact } and also maybe the factory routine: ConnectionPool* ConnectionPool::newPool(std::string h, short p, std::string u, std::string pw, std::string b) { return new AlwaysConnectedConnectionZPool(h, p, u, pw, b); } I can fix this by artificially making my abstract base class concrete. But I'd rather do something better. Any idea? Thanks

    Read the article

  • How to generate XML from an Excel VBA macro?

    - by SuperNES
    So, I've got a bunch of content that was delivered to us in the form of Excel spreadsheets. I need to take that content and push it into another system. The other system takes its input from an XML file. I could do all of this by hand (and trust me, management has no problem making me do that!), but I'm hoping there's an easy way to write an Excel macro that would generate the XML I need instead. This seems like a better solution to me, as this is a job that will need to be repeated regularly (we'll be getting a LOT of content in Excel sheets) and it just makes sense to have a batch tool that does it for us. However, I've never experimented with generating XML from Excel spreadsheets before. I have a little VBA knowledge but I'm a newbie to XML. I guess my problem in Googling this is that I don't even know what to Google for. Can anyone give me a little direction to get me started? Does my idea sound like the right way to approach this problem, or am I overlooking something obvious? Thanks StackOverflow!

    Read the article

  • Facebook IFrame Application issues for certain users

    - by Kon
    We have a strange issue with running an Facebook IFrame application (using MVC 2). When I run my app and log into Facebook, I get to the application just fine. But when my coworker does it, she gets the following error: API Error Code: 100 API Error Description: Invalid parameter Error Message: Requires valid next URL. Typically this error is resolved by updating the "New Data Permissions" setting of the Facebook application. However, in this case it doesn't help. We've also tried logging in with our accounts from different computers and it seems that neither computer nor which one the MVC ASP.NET app is running from matters. The only difference is who is logged into Facebook. We've looked at our Facebook account settings, but couldn't find any obvious differences. We both have Developer access to the FB application and we both can edit its settings. However, only one of us can actually run the application without getting the above mentioned error message. Any idea what could be happening here?

    Read the article

  • StoreFilterField input doesn't react

    - by user1289877
    I'm trying to build grid with build in column filtering (using sencha gxt), here is my code: public Grid<Stock> createGrid() { // Columns definition ColumnConfig<Stock, String> nameCol = new ColumnConfig<Stock, String>(props.name(), 100, "Company"); // Column model definition and creation List<ColumnConfig<Stock, ?>> cl = new ArrayList<ColumnConfig<Stock, ?>>(); cl.add(nameCol); ColumnModel<Stock> cm = new ColumnModel<Stock>(cl); // Data populating ListStore<Stock> store = new ListStore<Stock>(props.key()); store.addAll(TestData.getStocks()); // Grid creation with data final Grid<Stock> grid = new Grid<Stock>(store, cm); grid.getView().setAutoExpandColumn(nameCol); grid.setBorders(false); grid.getView().setStripeRows(true); grid.getView().setColumnLines(true); // Filters definition StoreFilterField<Stock> filter = new StoreFilterField<Stock>() { @Override protected boolean doSelect(Store<Stock> store, Stock parent, Stock item, String filter) { // Window.alert(String.valueOf("a")); String name = item.getName(); name = name.toLowerCase(); if (name.startsWith(filter.toLowerCase())) { return true; } return false; } }; filter.bind(store); cm.addHeaderGroup(0, 0, new HeaderGroupConfig(filter, 1, 1)); filter.focus(); return grid; } My problem is: after I run this code, I cannot write anything to filter input, I'm using test data and classes (Stock.java and StockProperties.java) from this example: http://sencha.com/examples-dev/#ExamplePlace:filtergrid I try to put allert in doSelect method to check if this function was called, but it wasn't. Any idea will be welcome. Thanks.

    Read the article

  • C++: calling non-member functions with the same syntax of member ones

    - by peoro
    One thing I'd like to do in C++ is to call non-member functions with the same syntax you call member functions: class A { }; void f( A & this ) { /* ... */ } // ... A a; a.f(); // this is the same as f(a); Of course this could only work as long as f is not virtual (since it cannot appear in A's virtual table. f doesn't need to access A's non-public members. f doesn't conflict with a function declared in A (A::f). I'd like such a syntax because in my opinion it would be quite comfortable and would push good habits: calling str.strip() on a std::string (where strip is a function defined by the user) would sound a lot better than calling strip( str );. most of the times (always?) classes provide some member functions which don't require to be member (ie: are not virtual and don't use non-public members). This breaks encapsulation, but is the most practical thing to do (due to point 1). My question here is: what do you think of such feature? Do you think it would be something nice, or something that would introduce more issues than the ones it aims to solve? Could it make sense to propose such a feature to the next standard (the one after C++0x)? Of course this is just a brief description of this idea; it is not complete; we'd probably need to explicitly mark a function with a special keyword to let it work like this and many other stuff.

    Read the article

  • How to create more complex Lucene query strings?

    - by boris callens
    This question is a spin-off from this question. My inquiry is two-fold, but because both are related I think it is a good idea to put them together. How to programmatically create queries. I know I could start creating strings and get that string parsed with the query parser. But as I gather bits and pieces of information from other resources, there is a programattical way to do this. What are the syntax rules for the Lucene queries? --EDIT-- I'll give a requirement example for a query I would like to make: Say I have 5 fields: First Name Last Name Age Address Everything All fields are optional, the last field should search over all the other fields. I go over every field and see if it's IsNullOrEmpty(). If it's not, I would like to append a part of my query so it adds the relevant search part. First name and last name should be exact matches and have more weight then the other fields. Age is a string and should exact match. Address can varry in order. Everything can also varry in order. How should I go about this?

    Read the article

  • Which book should I pick to improve my program designs/design patterns?

    - by zxcvbnm
    I want to learn about design patterns and from what I've seen the most recommended ones are the Gang of Four's Design Patterns and Head First Design Patterns. There are also language specific books, but I never see them recommended. I suppose it ties you to whatever strengths/weaknesses are inherent to each language, so not a good idea to learn design patterns in general. The Gang of Four's book is kinda old, so I'm wondering if there isn't a better alternative out today? I've heard the Heard First one isn't quite as good. But I'm not sure why, so it's really hard to pick either one. I've see some answers on this very site recommending both, but if I can only read one, which should I pick? I've been coding for 3+ years, though I've never had a good class on this subject. Also, would a book like Code Complete help me with this? One more thing: how often are these techniques supposed to be useful? For example, this question has me wondering if this stuff is worth the trouble. And please, tell me more than just "read x". I'd like to know why you're suggesting x.

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Extract the vb code associated with a macro attached to an Action button in PowerPoint

    - by Patricker
    I have about 25 PowerPoint presentations, each with at least 45 slides. On each slide is a question with four possible answers and a help button which provides a hint relevant to the question. Each of the answers and the help button is a PowerPoint Action button that launches a macro. I am attempting to migrate all the questions/answers/hints into a SQL Database. I've worked with Office.Interop before when working with Excel and Word and I have plenty of SQL DB experience, so I don't foresee any issues with actually extracting the text portion of the question and answer and putting it into the db. What I have no idea how to do is given an object on a slide - get the action button info - Get the macro name - and finally get the macro's vb code. From there I can figure out how to parse out which is the correct answer and what the text of the hint is. Any help/ideas would be greatly appreciated. The guy I'm doing this for said he is willing to do it by hand... but that would take a while.

    Read the article

  • iPhone - adding views and landscape orientation

    - by Franz
    I got a problem with Cocoa touch and landscape orientation. I instantiate my view from a .xib; i added in my view controller - (BOOL)shouldAutorotateToInterfaceOrientation:(UIInterfaceOrientation)interfaceOrientation { return interfaceOrientation == UIInterfaceOrientationLandscapeRight; } to only allow landscape orientation. This works find for the first view i add.. if I add a second view however it is rotated again like the landscape view is shown in portrait mode (rotated 90 degree counterclockwise). I really don't know what is going on and can't find a workaround. I even tried to get behind what is happening just adding my view twice: MainMenuViewController* controller = [[MainMenuViewController alloc] initWithNibName:@"MainMenu" bundle:nil]; [window addSubview: controller.view]; MainMenuViewController* controller2 = [[MainMenuViewController alloc] initWithNibName:@"MainMenu" bundle:nil]; [window addSubview: controller2.view]; [window makeKeyAndVisible]; The view of controller is displayed correctly, while the view of controller2 is rotated by 90 degrees. Does anyone have an idea how this can happen? Thanks for your help.

    Read the article

  • Django: DatabaseLockError exception with Djapian

    - by jul
    Hi, I've got the exception shown below when executing indexer.update(). I have no idea about what to do: it used to work and now index database seems "locked". Anybody can help? Thanks Environment: Request Method: POST Request URL: http://piem.org:8000/restaurant/add/ Django Version: 1.1.1 Python Version: 2.5.2 Installed Applications: ['django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.comments', 'django.contrib.sites', 'django.contrib.admin', 'registration', 'djapian', 'resto', 'multilingual'] Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.middleware.locale.LocaleMiddleware', 'multilingual.middleware.DefaultLanguageMiddleware') Traceback: File "/var/lib/python-support/python2.5/django/core/handlers/base.py" in get_response 92. response = callback(request, *callback_args, **callback_kwargs) File "/home/jul/atable/../atable/resto/views.py" in addRestaurant 639. Restaurant.indexer.update() File "/home/jul/python-modules/Djapian-2.3.1-py2.5.egg/djapian/indexer.py" in update 181. database = self._db.open(write=True) File "/home/jul/python-modules/Djapian-2.3.1-py2.5.egg/djapian/database.py" in open 20. xapian.DB_CREATE_OR_OPEN, File "/usr/lib/python2.5/site-packages/xapian.py" in __init__ 2804. _xapian.WritableDatabase_swiginit(self,_xapian.new_WritableDatabase(*args)) Exception Type: DatabaseLockError at /restaurant/add/ Exception Value: Unable to acquire database write lock on /home/jul/atable /djapian_spaces/resto/restaurant/resto.index.restaurantindexer: already locked

    Read the article

  • DDD and Entity Base, Model using multiple identity types

    - by Thomas
    I have a model that looks like this: public interface IEntity { int Id { get; set; } } Then the idea is to have my entities inherit from this interface: public class User : IEntity { public int Id { get; set; } } However, one of my entities actually has a Guid as an identifier. public class UserSession { public Guid Id { get; set; } } I really would like all my entities inheriting from the same interface but that would force me to add an integer based identity column to the UserSession which is unnecessary since Guid is the identity, but it would keep the domain model nice since all entities would inherit from the same base. What options do I have in this scenario? Can I have two base interfaces, one for int and one for Guid? Should I add an identity column into the UserSession entity although it is unnecessary? I need the Guid so I can't just get rid of it and replace it with and integer. Any thoughts on best practices?

    Read the article

  • Java: extending Object class

    - by Fabio F.
    Hello, I'm writing (well, completing) an "extension" of Java which will help role programming. I translate my code to Java code with javacc. My compilers add to every declared class some code. Here's an example to be clearer: MyClass extends String implements ObjectWithRoles { //implements... is added /*Added by me */ public setRole(...){...} public ... /*Ends of stuff added*/ ...//myClass stuff } It adds Implements.. and the necessary methods to EVERY SINGLE CLASS you declare. Quite rough, isnt'it? It will be better if I write my methods in one class and all class extends that.. but.. if class already extends another class (just like the example)? I don't want to create a sort of wrapper that manage roles because i don't want that the programmer has to know much more than Java, few new reserved words and their use. My idea was to extends java.lang.Object.. but you can't. (right?) Other ideas? I'm new here, but I follow this site so thank you for reading and all the answers you give! (I apologize for english, I'm italian)

    Read the article

  • ASP MVC Controller Method not always called from $.getJSON request

    - by johnvpetersen
    I have a controller method that returns a jSON object and in one calling situation, it works and in another calling situation, it does not work. When the URL in my browser is this: http://localhost:65247/Client -- it works. But, when my url looks like this: http://localhost:65247/Client/UserAdmin?id=6 -- it DOES NOT work In a nutshell, clients have users. From within the client, I wish to work on a specific user (this is the UserAdmin view). In this case, the client id is 6. From within the UserAdmin view that was launched with Id=6, I then wish to select a user from a dropdown. The idea was to use javascript and $.getJSON to fetch data for the specific user so as not to have to refresh the entire page. I use this approach in other parts of the app. The only difference I can see is with the URL in the browser. It would appear the presence of parameters via the '?' is futzing things up a bit. Any ideas?? Thanks in advance. John

    Read the article

< Previous Page | 680 681 682 683 684 685 686 687 688 689 690 691  | Next Page >