Search Results

Search found 18534 results on 742 pages for 'dave long'.

Page 688/742 | < Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >

  • Google Maps API 3 How to call initialize without putting it in Body onload

    - by Bex
    Hi I am using the google maps API and have copied the examples and have ended up with a function called "initialize" that is called from the body onload. I am using the maps in a few different user controls, which are placed within content place holders, so the body tag is in the master page. Is there a way of calling initialize directly in the usercontrol rather than having to place an onload on the masterpage? Ideally I want my user control to be a stand alone control that I can just slot into pages without trying to access the master page body onload. I have tried calling the Initialize function from my page load of the user control (by adding a start up script), but the map doesn't appear. Any suggestions? My code: <script type="text/javascript" src="http://maps.google.com/maps/api/js?sensor=false">/script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> var map; var geocoder; function initialize() { geocoder = new google.maps.Geocoder(); var latlng = new google.maps.LatLng(51.8052184317649, -4.965819906250006); var myOptions = { zoom: 8, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); $.ajax({ type: "POST", url: "/GoogleMapsService.asmx/GetPointers", contentType: "application/json; charset=utf-8", dataType: "json", beforeSend: function () { $(".loadingData").html("<p>Loading data..</p>"); }, complete: function () { $(".loadingData").html(""); }, cache: true, success: mapPoints, error: onError }); } function onError(xhr, ajaxOptions, thrownError) { alert(xhr.status); alert(xhr.responseText); } function mapPoints(response) { if (response.d != null) { if (response.d.length > 0) { for (var i = 0; i < response.d.length; i++) { plotOnMap(response.d[i].Id, response.d[i].Name, response.d[i].Lat, response.d[i].Long, response.d[i].ShortDesc) } } } } and on my test master page: <body onload="initialize()"> <form runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePageMethods="true"></asp:ScriptManager> <asp:ContentPlaceHolder ID="MainContent" runat="server"> </asp:ContentPlaceHolder> </form> </body>

    Read the article

  • Need help simplifying my php table

    - by user342391
    I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

    Read the article

  • Can't access font resource in Silverlight class library

    - by Matt
    I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

    Read the article

  • What would you do to make this code more "over-engineered"? [closed]

    - by Mez
    A friend and I got bored, and, long story short, decided to make an over-engineered FizzBuzz in PHP <?php interface INumber { public function go(); public function setNumber($i); } class FBNumber implements INumber { private $value; private $fizz; private $buzz; public function __construct($fizz = 3 , $buzz = 5) { $this->setFizz($fizz); $this->setBuzz($buzz); } public function setNumber($i) { if(is_int($i)) { $this->value = $i; } } private function setFizz($i) { if(is_int($i)) { $this->fizz = $i; } } private function setBuzz($i) { if(is_int($i)) { $this->buzz = $i; } } private function isFizz() { return ($this->value % $this->fizz == 0); } private function isBuzz() { return ($this->value % $this->buzz == 0); } private function isNeither() { return (!$this->isBuzz() AND !$this->isFizz()); } private function isFizzBuzz() { return ($this->isFizz() OR $this->isBuzz()); } private function fizz() { if ($this->isFizz()) { return "Fizz"; } } private function buzz() { if ($this->isBuzz()) { return "Buzz"; } } private function number() { if ($this->isNeither()) { return $this->value; } } public function go() { return $this->fizz() . $this->buzz() . $this->number(); } } class FizzBuzz { private $limit; private $number_class; private $numbers = array(); function __construct(INumber $number_class, $limit = 100) { $this->number_class = $number_class; $this->limit = $limit; } private function collectNumbers() { for ($i=1; $i <= $this->limit; $i++) { $n = clone($this->number_class); $n->setNumber($i); $this->numbers[$i] = $n->go(); unset($n); } } private function printNumbers() { $return = ''; foreach($this->numbers as $number){ $return .= $number . "\n"; } return $return; } public function go() { $this->collectNumbers(); return $this->printNumbers(); } } $fb = new FizzBuzz(new FBNumber()); echo $fb->go(); In theory, what could we/would you do to make it even more "over-engineered"?

    Read the article

  • web service filling gridview awfully slow, as is paging/sorting

    - by nat
    Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Mixing .NET versions between website and virtual directories and the "server application unavailable" error Message

    - by Doug Chamberlain
    Backstory Last month our development team created a new asp.net 3.5 application to place out on our production website. Once we had the work completed, we requested from the group that manages are server to copy the app out to our production site, and configure the virtual directory as a new application. On 12/27/2010, two public 'Gineau Pigs' were selected to use the app, and it worked great. On 12/30/2010, We received notification by internal staff, that when that staff member tried to access the application (this was the Business Process Owner) they recieved the 'Server Application Unavailable' message. When I called the group that does our server support, I was told that it probably failed, because I didn't close the connections in my code. However, the same group went in and then created a separate app pool for this Extension Request application. It has had no issues since. I did a little googling, since I do not like being blamed for things. I found that the 'Server Application Unavailable' message will also appear when you have multiple applications using different frameworks and you do not put them in different application pools. Technical Details - Tree of our website structure Main Website <-- ASP Classic +-Virtual Directory(ExtensionRequest) <-- ASP 3.5 From our server support group: 'Reviewed server logs and website setup in IIS. Had to reset the application pool as it was not working properly. This corrected the website and it is now back online. We went ahead and created a application pool for the extension web so it is isolated from the main site pool. In the past we have seen other application do this when there is a connection being left open and the pool fills up. Would recommend reviewing site code to make sure no connections are being left open.' The Real Question: What really caused the failure? Isn't the connection being left open issue an ASP Classic issue? Wouldn't the ExtensionRequest application have to be used (more than twice) in the first place to have the connections left open? Is it more likely the failure is caused by them not bothering to setup the new Application in it's own App Pool in the first place? Sorry for the long windedness

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do you combine "Revision Control" with "WorkFlow" for R?

    - by Tal Galili
    Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

  • How to salvage SQL server 2008 query from KILLED/ROLLBACK state without waiting half a day?

    - by littlegreen
    I have a stored procedure that inserts batches of millions of rows, emerging from a certain query, into an SQL database. It has one parameter selecting the batch; when this parameter is omitted, it will gather a list of batches and recursively call itself, in order to iterate over batches. In (pseudo-)code, it looks something like this: CREATE PROCEDURE spProcedure AS BEGIN IF @code = 0 BEGIN ... WHILE @@Fetch_Status=0 BEGIN EXEC spProcedure @code FETCH NEXT ... INTO @code END END ELSE BEGIN -- Disable indexes ... INSERT INTO table SELECT (...) -- Enable indexes ... Now it can happen that this procedure is slow, for whatever reason: it can't get a lock, one of the indexes it uses is misdefined or disabled. In that case, I want to be able kill the procedure, truncate and recreate the resulting table, and try again. However, when I try and kill the procedure, the process frequently oozes into a KILLED/ROLLBACK state from which there seems to be no return. From Google I have learned to do an sp_lock, find the spid, and then kill it with KILL <spid>. But when I try to kill it, it tells me SPID 75: transaction rollback in progress. Estimated rollback completion: 0%. Estimated time remaining: 554 seconds. I did find a forum message hinting that another spid should be killed before the other one can start a rollback. But that didn't work for me either, plus I do not understand, why that would be the case... could it be because I am recursively calling my own stored procedure? (But it should be having the same spid, right?) In any case, my process is just sitting there, being dead, not responding to kills, and locking the table. This is very frustrating, as I want to go on developing my queries, not waiting hours on my server sitting dead while pretending to be finishing a supposed rollback. Is there some way in which I can tell the server not to store any rollback information for my query? Or not to allow any other queries to interfere with the rollback, so that it will not take so long? Or how to rewrite my query in a better way, or how kill the process successfully without restarting the server?

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • Change HttpContext.Request.InputStream

    - by user320478
    I am getting lot of errors for HttpRequestValidationException in my event log. Is it possible to HTMLEncode all the inputs from override of ProcessRequest on web page. I have tried this but it gives context.Request.InputStream.CanWrite == false always. Is there any way to HTMLEncode all the feilds when request is made? public override void ProcessRequest(HttpContext context) { if (context.Request.InputStream.CanRead) { IEnumerator en = HttpContext.Current.Request.Form.GetEnumerator(); while (en.MoveNext()) { //Response.Write(Server.HtmlEncode(en.Current + " = " + //HttpContext.Current.Request.Form[(string)en.Current])); } long nLen = context.Request.InputStream.Length; if (nLen > 0) { string strInputStream = string.Empty; context.Request.InputStream.Position = 0; byte[] bytes = new byte[nLen]; context.Request.InputStream.Read(bytes, 0, Convert.ToInt32(nLen)); strInputStream = Encoding.Default.GetString(bytes); if (!string.IsNullOrEmpty(strInputStream)) { List<string> stream = strInputStream.Split('&').ToList<string>(); Dictionary<int, string> data = new Dictionary<int, string>(); if (stream != null && stream.Count > 0) { int index = 0; foreach (string str in stream) { if (str.Length > 3 && str.Substring(0, 3) == "txt") { string textBoxData = str; string temp = Server.HtmlEncode(str); //stream[index] = temp; data.Add(index, temp); index++; } } if (data.Count > 0) { List<string> streamNew = stream; foreach (KeyValuePair<int, string> kvp in data) { streamNew[kvp.Key] = kvp.Value; } string newStream = string.Join("", streamNew.ToArray()); byte[] bytesNew = Encoding.Default.GetBytes(newStream); if (context.Request.InputStream.CanWrite) { context.Request.InputStream.Flush(); context.Request.InputStream.Position = 0; context.Request.InputStream.Write(bytesNew, 0, bytesNew.Length); //Request.InputStream.Close(); //Request.InputStream.Dispose(); } } } } } } base.ProcessRequest(context); }

    Read the article

  • Spring 3 MVC - Form Failure Causes Exception When Reloading JSP

    - by jboyd
    Using Spring 3 MVC, please bear with the long code example, it's quite simple, but I want to make sure all relevant information is posted. Basically here is the use case: There is a registration page, a user can login, OR fill out a registration form. The login form is a simple HTML form, the registration form is a more complicated, Spring bound form that uses a RegistrationFormData bean. Here is the relevant code: UserController.java ... @RequestMapping(value = "/login", method = RequestMethod.GET) public String login(Model model) { model.addAttribute("registrationInfo", new ProfileAdminFormData()); return "login"; } ... @RequestMapping(value = "/login.do", method = RequestMethod.POST) public String doLogin( @RequestParam(value = "userName") String userName, @RequestParam(value = "password") String password, Model model) { logger.info("login.do : userName=" + userName + ", password=" + password); try { getUser().login(userName, password); } catch (UserNotFoundException ex) { logger.error(ex); model.addAttribute("loginError", ex.getWebViewableErrorMessage()); return "login"; } return "redirect:/"; } ... @RequestMapping(value = "/register.do") public String register( @ModelAttribute(value = "registrationInfo") ProfileAdminFormData profileAdminFormData, BindingResult result, Model model) { //todo: redirect if (new RegistrationValidator(profileAdminFormData, result).validate()) { try { User().register(profileAdminFormData); return "index"; } catch (UserException ex) { logger.error(ex); model.addAttribute("registrationErrorMessage", ex.getWebViewableErrorMessage()); return "login"; } } return "login"; } and the JSP: ... <form:form commandName="registrationInfo" action="register.do"> ... So the problem here is that when login fails I get an exception because there is no bean "registrationInfo" in the model attributes. What I need is that regardless of the path through this controller that the "registrationInfo" bean is not null, that way if login fails, as opposed to registration, that bean is still in the model. As you can see I create the registrationInfo object explicitly in my controller in the method bound to "/login", which is what I thought was going to be kind of a setup method" Something doesn't feel right about the "/login" method which sets up the page, but I needed to that in order to get the page to render at all without throwing an exception because there is no "registrationInfo" model attribute, as needed by the form in the JSP

    Read the article

  • How to tag photos in facebook-api?

    - by Camillo
    Hey, I wanted to ask if/how is it possible to tag a photo using the FB API (Graph or REST). I've managed to create an album and also to upload a photo in it, but I stuck on tagging. I've got the permissions and the correct session key. My code until now: try { $uid = $facebook->getUser(); $me = $facebook->api('/me'); $token = $session['access_token'];//here I get the token from the $session array $album_id = $album[0]; //upload photo $file= 'images/hand.jpg'; $args = array( 'message' => 'Photo from application', ); $args[basename($file)] = '@' . realpath($file); $ch = curl_init(); $url = 'https://graph.facebook.com/'.$album_id.'/photos?access_token='.$token; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_setopt($ch, CURLOPT_POSTFIELDS, $args); $data = curl_exec($ch); //returns the id of the photo you just uploaded print_r(json_decode($data,true)); $search = array('{"id":', "}"); $delete = array("", ""); // picture id call with $picture $picture = str_replace($search, $delete, $data); //here should be the photos.addTag, but i don't know how to solve this //above code works, below i don't know what is the error / what's missing $json = 'https://api.facebook.com/method/photos.addTag?pid='.urlencode($picture).'&tag_text=Test&x=50&y=50&access_token='.urlencode($token); $ch = curl_init(); $url = $json; curl_setopt($ch, CURLOPT_URL, $url); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_RETURNTRANSFER, true); curl_setopt($ch, CURLOPT_POST, true); curl_exec($ch); } catch(FacebookApiException $e){ echo "Error:" . print_r($e, true); } I really searched a long time, if you know something that might help me, please post it here :) Thanks for all your help, Camillo

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • problem to create session of facebook

    - by khoyendra
    try { HttpClient http = new HttpClient(); http.setParams(new HttpClientParams()); //http.getHostConfiguration().setHost("http://www.facebook.com/"); http.setState(new HttpState()); String api_key = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; String secret = "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"; // String appId=124812364218050; //http://www.facebook.com/developers/editapp.php?app_id=124812364218050 FacebookRestClient client = new FacebookRestClient(api_key, secret); client.setIsDesktop(true); // String sessionKey = request.getParameter(FacebookParam.SESSION_KEY.toString()); // boolean b = client.users_setStatus("This is a test..."); // System.out.println("User Status RESULT : " + b); String token = client.auth_createToken(); final String loginId = "http://www.facebook.com/login.php"; GetMethod get = new GetMethod(loginId + "?api_key=" + api_key + "&v=1.0&auth_token=" +token); System.out.println("Get="+get); http.executeMethod(get); PostMethod post = new PostMethod(loginId); post.addParameter(new NameValuePair("api_key", api_key)); post.addParameter(new NameValuePair("v", "1.0")); post.addParameter(new NameValuePair("auth_token", token)); post.addParameter(new NameValuePair("fbconnect","true")); post.addParameter(new NameValuePair("return_session","true")); post.addParameter(new NameValuePair("session_key_only","true")); post.addParameter(new NameValuePair("req_perms","read_stream,publish_stream")); post.addParameter(new NameValuePair("email", email)); post.addParameter(new NameValuePair("pass", password)); System.out.println("Token ="+token); int postStatus = http.executeMethod(post); System.out.println("Response : " + postStatus); session = client.auth_getSession(token); // Here I am getting error System.out.println("Session string: " + session); long userid = client.users_getLoggedInUser(); System.out.println("User Id is : " + userid); } catch (Exception e) { e.printStackTrace(); } please solve my problem i cannot create session of facebook.

    Read the article

  • Asp.net Mvc - Kigg: Maintain User object in HttpContext.Items between requests.

    - by Pickels
    Hallo, first I want to say that I hope this doesn't look like I am lazy but I have some trouble understanding a piece of code from the following project. http://kigg.codeplex.com/ I was going through the source code and I noticed something that would be usefull for my own little project I am making. In their BaseController they have the following code: private static readonly Type CurrentUserKey = typeof(IUser); public IUser CurrentUser { get { if (!string.IsNullOrEmpty(CurrentUserName)) { IUser user = HttpContext.Items[CurrentUserKey] as IUser; if (user == null) { user = AccountRepository.FindByClaim(CurrentUserName); if (user != null) { HttpContext.Items[CurrentUserKey] = user; } } return user; } return null; } } This isn't an exact copy of the code I adjusted it a little to my needs. This part of the code I still understand. They store their IUser in HttpContext.Items. I guess they do it so that they don't have to call the database eachtime they need the User object. The part that I don't understand is how they maintain this object in between requests. If I understand correctly the HttpContext.Items is a per request cache storage. So after some more digging I found the following code. internal static IDictionary<UnityPerWebRequestLifetimeManager, object> GetInstances(HttpContextBase httpContext) { IDictionary<UnityPerWebRequestLifetimeManager, object> instances; if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { lock (httpContext.Items) { if (httpContext.Items.Contains(Key)) { instances = (IDictionary<UnityPerWebRequestLifetimeManager, object>) httpContext.Items[Key]; } else { instances = new Dictionary<UnityPerWebRequestLifetimeManager, object>(); httpContext.Items.Add(Key, instances); } } } return instances; } This is the part where some magic happens that I don't understand. I think they use Unity to do some dependency injection on each request? In my project I am using Ninject and I am wondering how I can get the same result. I guess InRequestScope in Ninject is the same as UnityPerWebRequestLifetimeManager? I am also wondering which class/method they are binding to which interface? Since the HttpContext.Items get destroyed each request how do they prevent losing their user object? Anyway it's kinda a long question so I am gradefull for any push in the right direction. Kind regards, Pickels

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

  • php connecting to mysql server(localhost) very slow

    - by Ahmad
    actually its little complicated: summary: the connection to DB is very slow. the page rendering takes around 10 seconds but the last statement on the page is an echo and i can see its output while the page is loading in firefox (IE is same). in google chrome the output becomes visible only when the loading finishes. loading time is approximately the same across browsers. on debugging i found out that its the DB connectivity that is creating problem. the DB was on another machine. to debug further. i deployed the DB on my local machine .. so now the DB connection is at 127.0.0.1 but the connectivity still takes long time. this means that the issue is with APACHE/PHP and not with mysql. but then i deployed my code on another machine which connects to DB remotely.and everything seems fine. basically the application uses couple of mod_rewrite.. but i removed all the .htaccess files and the slow connectivity issue remains.. i installed another APACHE on my machine and used default settings. the connection was still very slow. i added following statements to measure the execution time $stime = microtime(); $stime = explode(" ",$stime); $stime = $stime[1] + $stime[0]; // my code -- it involves connection to DB $mtime = microtime(); $mtime = explode(" ",$mtime); $mtime = $mtime[1] + $mtime[0]; $totaltime = ($mtime - $stime); echo $totaltime; the output is 0.0631899833679 but firebug Net panel shows total loading time of 10-11 seconds. same is the case with google chrome i tried to turn off windows firewall.. connectivity is still slow and i just can't quite find the reason.. i've tried multiple DB servers.. multiple apaches.. nothing seems to be working.. any idea of what might be the problem?

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

< Previous Page | 684 685 686 687 688 689 690 691 692 693 694 695  | Next Page >