Search Results

Search found 196 results on 8 pages for 'iterative deepening'.

Page 7/8 | < Previous Page | 3 4 5 6 7 8  | Next Page >

  • Windows Batch file to echo a specific line number

    - by Lee
    So for the second part of my current dilemma, I have a list of folders in c:\file_list.txt. I need to be able to extract them (well, echo them with some mods) based on the line number because this batch script is being called by an iterative macro process. I'm passing the line number as a parameter. @echo off setlocal enabledelayedexpansion set /a counter=0 set /a %%a = "" for /f "usebackq delims=" %%a in (c:\file_list.txt) do ( if "!counter!"=="%1" goto :printme & set /a counter+=1 ) :printme echo %%a which gives me an output of %a. Doh! So, I've tried echoing !a! (result: ECHO is off.); I've tried echoing %a (result: a) I figured the easy thing to do would be to modify the head.bat code found here: http://stackoverflow.com/questions/130116/dos-batch-commands-to-read-first-line-from-text-file except rather than echoing every line - I'd just echo the last line found. Not as simple as one might think. I've noticed that my counter is staying at zero for some reason; I'm wondering if the set /a counter+=1 is doing what I think it's doing.

    Read the article

  • Performance question: Inverting an array of pointers in-place vs array of values

    - by Anders
    The background for asking this question is that I am solving a linearized equation system (Ax=b), where A is a matrix (typically of dimension less than 100x100) and x and b are vectors. I am using a direct method, meaning that I first invert A, then find the solution by x=A^(-1)b. This step is repated in an iterative process until convergence. The way I'm doing it now, using a matrix library (MTL4): For every iteration I copy all coeffiecients of A (values) in to the matrix object, then invert. This the easiest and safest option. Using an array of pointers instead: For my particular case, the coefficients of A happen to be updated between each iteration. These coefficients are stored in different variables (some are arrays, some are not). Would there be a potential for performance gain if I set up A as an array containing pointers to these coefficient variables, then inverting A in-place? The nice thing about the last option is that once I have set up the pointers in A before the first iteration, I would not need to copy any values between successive iterations. The values which are pointed to in A would automatically be updated between iterations. So the performance question boils down to this, as I see it: - The matrix inversion process takes roughly the same amount of time, assuming de-referencing of pointers is non-expensive. - The array of pointers does not need the extra memory for matrix A containing values. - The array of pointers option does not have to copy all NxN values of A between each iteration. - The values that are pointed to the array of pointers option are generally NOT ordered in memory. Hopefully, all values lie relatively close in memory, but *A[0][1] is generally not next to *A[0][0] etc. Any comments to this? Will the last remark affect performance negatively, thus weighing up for the positive performance effects?

    Read the article

  • dotNet Templated, Repeating, Databound ServerControl: Modifying underlying ServerControl data per te

    - by Campbeln
    I have a server control that wraps an underlying class which manages a number of indexes to track where it is in a dataset (ie: RenderedRecordCount, ErroredRecordCount, NewRecordCount, etc.). I've got the server control rendering great, but OnDataBinding I'm having an issue as to seems to happen after CreateChildControls and before Render (both of which properly manage the iteration of the underlying indexes). While I'm somewhat familiar with the ASP.NET page lifecycle, this one seems to be beyond me at the moment. So... How do I hook into the iterative process OnDataBinding uses so I can manage the underlying indexes? Will I have to iterate over the ITemplates myself, managing the indexes as I go or is there an easier solution? [edit: Agh... writing the problem out is very cathartic... I'm thinking this is exactly what I will need to do...] Also... I implemented the iteration of the underlying indexes during CreateChildControls originally in the belief that was the proper place to hook in for events like OnDataBinding (thinking it was done as the controls were being .Add'd). Now it seems that this may actually be unnecessary. So I guess the secondary question is: What happens during CreateChildControls? Are the unadulterated (read: with various <%-tags in place) controls added to the .Controls collection without any other processing?

    Read the article

  • converting a Tree to newick format. java

    - by Esmond
    I'm having problems converting a binary rooted tree to newick format. The full explanation for such a format can be found: http://code.google.com/p/mrsrf/wiki/NewickTree An example of a newick format would be as follows: for a tree T such as http://www.cs.mcgill.ca/~cs251/OldCourses/1997/topic8/images/completetreetwo.gif the newick representation would be: (((8,9),(10,11)),((12,13),(14,15))) the internal node will become the commas while the leaves will be retained. such trees have internal nodes which will always have 2 children. I have a problem using recursion to come out with this newick format. The output contains far too many nodes and braces. Any comments to resolve this problem is appreciated or even an iterative algorithm would be welcomed import java.util.Stack; public class Tree { .... public String inOrderNewick(Node root, String output) throws ItemNotFoundException { if (root.hasChild()) { output += "("; output += inOrderNewick(root.child1, output); output += ","; output += inOrderNewick(root.child2, output); output += ")"; return output; } else { output += root.getSeq(); return output; } } }

    Read the article

  • Highlighting a piechart slice from an HTML element (mouseover)

    - by nickhar
    I have a series of HTML table cells with data - an example of which is: <tr id="rrow1"> <td> <a href="/electricity" class="category">Electricity</a> </td> <td> 901.471 </td> </tr> <tr id="rrow2">... <tr id="rrow3">... etc In this case, each <tr> (or hypathetically for the wider community a div/span/tr/td) is assigned a sequential id based on $rrow++; in a while loop (in PHP). I also have a Piechart using the highcharts library, where i'd like to highlight the slice (sliced: true) based upon onmouseover of particular div/span/tr/td element - in this case #rrow1 as above, but multiple/iterative elements as required and (sliced: false) onmouseout... As a simple example, I've tried accessing various derivatives of the following, but failed: $('#rrow1').mouseover(function() { chart.series[0].graph.attr('sliced', true); }); $('#rrow1').mouseout(function() { chart.series[0].graph.attr('sliced', false); }); The nearest I've found is this but bastardised at most and without success: plotOptions: { series: { mouseOver: function() { if( $('#rrow1').mouseover ) series.x = sliced: true; }, mouseOut: function() { if( $('#rrow1').mouseout ) series.x = sliced: false; } } } These are far from approaching correct and despite searching I can't find a valid/helpful example to work from or draw direction. You can view the pie chart in question on jsfiddle here.

    Read the article

  • DOS Batch file to echo a specific line number

    - by Lee
    So for the second part of my current dilemma, I have a list of folders in "c:\file_list.txt". I need to be able to extract them (well, echo them with some mods) based on the line number because this batch script is being called by an iterative macro process. I'm passing the line number as a parameter. @echo off setlocal enabledelayedexpansion set /a counter=0 set /a %%a = "" for /f "usebackq delims=" %%a in (c:\file_list.txt) do (if "!counter!"=="%1" goto :printme & set /a counter+=1) :printme echo %%a which gives me an output of "%a". Doh! So, I've tried echoing !a! (result: "ECHO is off."); I've tried echoing %a (result: a) I figured the easy thing to do would be to modify the "head.bat" code found here: http://stackoverflow.com/questions/130116/dos-batch-commands-to-read-first-line-from-text-file except rather than echoing every line - I'd just echo the last line found. Not as simple as one might think. I've noticed that my counter is staying at zero for some reason; I'm wondering if the "set /a counter+=1" is doing what I think it's doing.

    Read the article

  • SQL Server database change workflow best practices

    - by kubi
    The Background My group has 4 SQL Server Databases: Production UAT Test Dev I work in the Dev environment. When the time comes to promote the objects I've been working on (tables, views, functions, stored procs) I make a request of my manager, who promotes to Test. After testing, she submits a request to an Admin who promotes to UAT. After successful user testing, the same Admin promotes to Production. The Problem The entire process is awkward for a few reasons. Each person must manually track their changes. If I update, add, remove any objects I need to track them so that my promotion request contains everything I've done. In theory, if I miss something testing or UAT should catch it, but this isn't certain and it's a waste of the tester's time, anyway. Lots of changes I make are iterative and done in a GUI, which means there's no record of what changes I made, only the end result (at least as far as I know). We're in the fairly early stages of building out a data mart, so the majority of the changes made, at least count-wise, are minor things: changing the data type for a column, altering the names of tables as we crystallize what they'll be used for, tweaking functions and stored procs, etc. The Question People have been doing this kind of work for decades, so I imagine there have got to be a much better way to manage the process. What I would love is if I could run a diff between two databases to see how the structure was different, use that diff to generate a change script, use that change script as my promotion request. Is this possible? If not, are there any other ways to organize this process? For the record, we're a 100% Microsoft shop, just now updating everything to SQL Server 2008, so any tools available in that package would be fair game.

    Read the article

  • super light software development process

    - by Walty
    hi, For the development process I have involved so far, most have teams of SINGLE member, or occasionally two. We used python + django for the major development, the development process is actually very fast, and we do have code reviews, design pattern discussions, and constant refactoring. Though team size is small, I do think there are some development processes / best practices that could be enforced. For example, using svn would be definitely better than regular copy backup. I did read some articles & books about Agile, XP & continuous integration, I think they are nice, but still too heavy for this case (team of 1 or 2, and fast coding). For example, IMHO, with nice design pattern, and iterative development + refactoring, the TDD MIGHT be an overkill, or at least the overhead does not out-weight the advantages. And so is the pair programming. The automated testing is a nice idea, but it seems not technically feasible for every project. our current practices are: svn + milestone + code review I wonder if there are development processes / best practices specifically targeted on such super light teams? thanks.

    Read the article

  • Tail recursion and memoization with C#

    - by Jay
    I'm writing a function that finds the full path of a directory based on a database table of entries. Each record contains a key, the directory's name, and the key of the parent directory (it's the Directory table in an MSI if you're familiar). I had an iterative solution, but it started looking a little nasty. I thought I could write an elegant tail recursive solution, but I'm not sure anymore. I'll show you my code and then explain the issues I'm facing. Dictionary<string, string> m_directoryKeyToFullPathDictionary = new Dictionary<string, string>(); ... private string ExpandDirectoryKey(Database database, string directoryKey) { // check for terminating condition string fullPath; if (m_directoryKeyToFullPathDictionary.TryGetValue(directoryKey, out fullPath)) { return fullPath; } // inductive step Record record = ExecuteQuery(database, "SELECT DefaultDir, Directory_Parent FROM Directory where Directory.Directory='{0}'", directoryKey); // null check string directoryName = record.GetString("DefaultDir"); string parentDirectoryKey = record.GetString("Directory_Parent"); return Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey), directoryName); } This is how the code looked when I realized I had a problem (with some minor validation/massaging removed). I want to use memoization to short circuit whenever possible, but that requires me to make a function call to the dictionary to store the output of the recursive ExpandDirectoryKey call. I realize that I also have a Path.Combine call there, but I think that can be circumvented with a ... + Path.DirectorySeparatorChar + .... I thought about using a helper method that would memoize the directory and return the value so that I could call it like this at the end of the function above: return MemoizeHelper( m_directoryKeyToFullPathDictionary, Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey)), directoryName); But I feel like that's cheating and not going to be optimized as tail recursion. Any ideas? Should I be using a completely different strategy? This doesn't need to be a super efficient algorithm at all, I'm just really curious. I'm using .NET 4.0, btw. Thanks!

    Read the article

  • No idea how to solve SICP exercise 1.11

    - by Javier Badia
    This is not homework. Exercise 1.11: A function f is defined by the rule that f(n) = n if n<3 and f(n) = f(n - 1) + 2f(n - 2) + 3f(n - 3) if n 3. Write a procedure that computes f by means of a recursive process. Write a procedure that computes f by means of an iterative process. Implementing it recursively is simple enough. But I couldn't figure out how to do it iteratively. I tried comparing with the Fibonacci example given, but I didn't know how to use it as an analogy. So I gave up (shame on me) and Googled for an explanation, and I found this: (define (f n) (if (< n 3) n (f-iter 2 1 0 n))) (define (f-iter a b c count) (if (< count 3) a (f-iter (+ a (* 2 b) (* 3 c)) a b (- count 1)))) After reading it, I understand the code and how it works. But what I don't understand is the process needed to get from the recursive defintion of the function to this. I don't get how the code formed in someone's head. Could you explain the thought process needed to arrive at the solution?

    Read the article

  • Building static (but complicated) lookup table using templates.

    - by MarkD
    I am currently in the process of optimizing a numerical analysis code. Within the code, there is a 200x150 element lookup table (currently a static std::vector < std::vector < double ) that is constructed at the beginning of every run. The construction of the lookup table is actually quite complex- the values in the lookup table are constructed using an iterative secant method on a complicated set of equations. Currently, for a simulation, the construction of the lookup table is 20% of the run time (run times are on the order of 25 second, lookup table construction takes 5 seconds). While 5-seconds might not seem to be a lot, when running our MC simulations, where we are running 50k+ simulations, it suddenly becomes a big chunk of time. Along with some other ideas, one thing that has been floated- can we construct this lookup table using templates at compile time? The table itself never changes. Hard-coding a large array isn't a maintainable solution (the equations that go into generating the table are constantly being tweaked), but it seems that if the table can be generated at compile time, it would give us the best of both worlds (easily maintainable, no overhead during runtime). So, I propose the following (much simplified) scenario. Lets say you wanted to generate a static array (use whatever container suits you best- 2D c array, vector of vectors, etc..) at compile time. You have a function defined- double f(int row, int col); where the return value is the entry in the table, row is the lookup table row, and col is the lookup table column. Is it possible to generate this static array at compile time using templates, and how?

    Read the article

  • How to get the size of a binary tree ?

    - by Andrei Ciobanu
    I have a very simple binary tree structure, something like: struct nmbintree_s { unsigned int size; int (*cmp)(const void *e1, const void *e2); void (*destructor)(void *data); nmbintree_node *root; }; struct nmbintree_node_s { void *data; struct nmbintree_node_s *right; struct nmbintree_node_s *left; }; Sometimes i need to extract a 'tree' from another and i need to get the size to the 'extracted tree' in order to update the size of the initial 'tree' . I was thinking on two approaches: 1) Using a recursive function, something like: unsigned int nmbintree_size(struct nmbintree_node* node) { if (node==NULL) { return(0); } return( nmbintree_size(node->left) + nmbintree_size(node->right) + 1 ); } 2) A preorder / inorder / postorder traversal done in an iterative way (using stack / queue) + counting the nodes. What approach do you think is more 'memory failure proof' / performant ? Any other suggestions / tips ? NOTE: I am probably going to use this implementation in the future for small projects of mine. So I don't want to unexpectedly fail :).

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Algorithm to pick values from set to match target value?

    - by CSharperWithJava
    I have a fixed array of constant integer values about 300 items long (Set A). The goal of the algorithm is to pick two numbers (X and Y) from this array that fit several criteria based on input R. Formal requirement: Pick values X and Y from set A such that the expression X*Y/(X+Y) is as close as possible to R. That's all there is to it. I need a simple algorithm that will do that. Additional info: The Set A can be ordered or stored in any way, it will be hard coded eventually. Also, with a little bit of math, it can be shown that the best Y for a given X is the closest value in Set A to the expression X*R/(X-R). Also, X and Y will always be greater than R From this, I get a simple iterative algorithm that works ok: int minX = 100000000; int minY = 100000000; foreach X in A if(X<=R) continue; else Y=X*R/(X-R) Y=FindNearestIn(A, Y);//do search to find closest useable Y value in A if( X*Y/(X+Y) < minX*minY/(minX+minY) ) then minX = X; minY = Y; end end end I'm looking for a slightly more elegant approach than this brute force method. Suggestions?

    Read the article

  • Matlab GUI: How to Save the Results of Functions (states of application)

    - by niko
    Hi, I would like to create an animation which enables the user to go backward and forward through the steps of simulation. An animation has to simulate the iterative process of channel decoding (a receiver receives a block of bits, performs an operation and then checks if the block corresponds to parity rules. If the block doesn't correspond the operation is performed again and the process finally ends when the code corresponds to a given rules). I have written the functions which perform the decoding process and return a m x n x i matrix where m x n is the block of data and i is the iteration index. So if it takes 3 iterations to decode the data the function returns a m x n x 3 matrix with each step is stired. In the GUI (.fig file) I put a "decode" button which runs the method for decoding and there are buttons "back" and "forward" which have to enable the user to switch between the data of recorded steps. I have stored the "decodedData" matrix and currentStep value as a global variable so by clicking "forward" and "next" buttons the indices have to change and point to appropriate step states. When I tried to debug the application the method returned the decoded data but when I tried to click "back" and "next" the decoded data appeared not to be declared. Does anyone know how is it possible to access (or store) the results of the functions in order to enable the described logic which I want to implement in Matlab GUI?

    Read the article

  • Stuck in implementing Pagination in Android

    - by user443141
    I am implementing pagination for ListView in Android . I am extending the BaseAdapater class for customising the ListView. Already I have the code working fine for the Customised ListView. Below is the new requirement. 1I am fetching 6 items from server & displaying them . Now when the user scrolls to the 6th item(end of list) , I need to call the server to fetch the next 6 items & update the Listview I have overriden the methods ipublic void onScroll(AbsListView view, int firstVisibleItem,int visibleItemCount, int totalItemCount) iipublic void onScrollStateChanged(AbsListView view, int scrollState) In the first response from the server, I get the total no of pages from the server & for each time I call the server , I get the current page value . Kindly provide me the steps/sample code on how to check the last item of the list & update the list . The code should be iterative since I may need to call multiple times & fetch from server. Warm Regards, CB

    Read the article

  • Tree iterator, can you optimize this any further?

    - by Ron
    As a follow up to my original question about a small piece of this code I decided to ask a follow up to see if you can do better then what we came up with so far. The code below iterates over a binary tree (left/right = child/next ). I do believe there is room for one less conditional in here (the down boolean). The fastest answer wins! The cnt statement can be multiple statements so lets make sure this appears only once The child() and next() member functions are about 30x as slow as the hasChild() and hasNext() operations. Keep it iterative <-- dropped this requirement as the recursive solution presented was faster. This is C++ code visit order of the nodes must stay as they are in the example below. ( hit parents first then the children then the 'next' nodes). BaseNodePtr is a boost::shared_ptr as thus assignments are slow, avoid any temporary BaseNodePtr variables. Currently this code takes 5897ms to visit 62200000 nodes in a test tree, calling this function 200,000 times. void processTree (BaseNodePtr current, unsigned int & cnt ) { bool down = true; while ( true ) { if ( down ) { while (true) { cnt++; // this can/will be multiple statesments if (!current->hasChild()) break; current = current->child(); } } if ( current->hasNext() ) { down = true; current = current->next(); } else { down = false; current = current->parent(); if (!current) return; // done. } } }

    Read the article

  • How to iteratively generate k elements subsets from a set of size n in java?

    - by Bea Metitiri
    Hi, I'm working on a puzzle that involves analyzing all size k subsets and figuring out which one is optimal. I wrote a solution that works when the number of subsets is small, but it runs out of memory for larger problems. Now I'm trying to translate an iterative function written in python to java so that I can analyze each subset as it's created and get only the value that represents how optimized it is and not the entire set so that I won't run out of memory. Here is what I have so far and it doesn't seem to finish even for very small problems: public static LinkedList<LinkedList<Integer>> getSets(int k, LinkedList<Integer> set) { int N = set.size(); int maxsets = nCr(N, k); LinkedList<LinkedList<Integer>> toRet = new LinkedList<LinkedList<Integer>>(); int remains, thresh; LinkedList<Integer> newset; for (int i=0; i<maxsets; i++) { remains = k; newset = new LinkedList<Integer>(); for (int val=1; val<=N; val++) { if (remains==0) break; thresh = nCr(N-val, remains-1); if (i < thresh) { newset.add(set.get(val-1)); remains --; } else { i -= thresh; } } toRet.add(newset); } return toRet; } Can anybody help me debug this function or suggest another algorithm for iteratively generating size k subsets? EDIT: I finally got this function working, I had to create a new variable that was the same as i to do the i and thresh comparison because python handles for loop indexes differently.

    Read the article

  • dotNet Templated, Repeating, Databound ServerControl: Counting the templates OnDataBind?

    - by Campbeln
    I have a server control that wraps an underlying class which manages a number of indexes to track where it is in a dataset (ie: RenderedRecordCount, ErroredRecordCount, NewRecordCount, etc.). I've got the server control rendering great, but OnDataBinding I'm having an issue as to seems to happen after CreateChildControls and before Render (both of which properly manage the iteration of the underlying indexes). While I'm somewhat familiar with the ASP.NET page lifecycle, this one seems to be beyond me at the moment. So... how do I hook into the iterative process OnDataBinding uses so I can manage the underlying indexes? Will I have to iterate over the ITemplates myself, managing the indexes as I go or is there an easier solution? Also... I implemented the iteration of the underlying indexes during CreateChildControls originally in the belief that was the proper place to hook in for events like OnDataBinding (thining it was done as the controls were being .Add'd). Now it seems that this may actually be unnecessary. So I guess the secondary question is: What happens during CreateChildControls? Are the unadulterated (read: with <%-tags in place) controls added to the .Controls collection without any other processing?

    Read the article

  • Measuring Usability with Common Industry Format (CIF) Usability Tests

    - by Applications User Experience
    Sean Rice, Manager, Applications User Experience A User-centered Research and Design Process The Oracle Fusion Applications user experience was five years in the making. The development of this suite included an extensive and comprehensive user experience design process: ethnographic research, low-fidelity workflow prototyping, high fidelity user interface (UI) prototyping, iterative formative usability testing, development feedback and iteration, and sales and customer evaluation throughout the design cycle. However, this process does not stop when our products are released. We conduct summative usability testing using the ISO 25062 Common Industry Format (CIF) for usability test reports as an organizational framework. CIF tests allow us to measure the overall usability of our released products.  These studies provide benchmarks that allow for comparisons of a specific product release against previous versions of our product and against other products in the marketplace. What Is a CIF Usability Test? CIF refers to the internationally standardized method for reporting usability test findings used by the software industry. The CIF is based on a formal, lab-based test that is used to benchmark the usability of a product in terms of human performance and subjective data. The CIF was developed and is endorsed by more than 375 software customer and vendor organizations led by the National Institute for Standards and Technology (NIST), a US government entity. NIST sponsored the CIF through the American National Standards Institute (ANSI) and International Organization for Standardization (ISO) standards-making processes. Oracle played a key role in developing the CIF. The CIF report format and metrics are consistent with the ISO 9241-11 definition of usability: “The extent to which a product can be used by specified users to achieve specified goals with effectiveness, efficiency and satisfaction in a specified context of use.” Our goal in conducting CIF tests is to measure performance and satisfaction of a representative sample of users on a set of core tasks and to help predict how usable a product will be with the larger population of customers. Why Do We Perform CIF Testing? The overarching purpose of the CIF for usability test reports is to promote incorporation of usability as part of the procurement decision-making process for interactive products. CIF provides a common format for vendors to report the methods and results of usability tests to customer organizations, and enables customers to compare the usability of our software to that of other suppliers. CIF also enables us to compare our current software with previous versions of our software. CIF Testing for Fusion Applications Oracle Fusion Applications comprises more than 100 modules in seven different product families. These modules encompass more than 400 task flows and 400 user roles. Due to resource constraints, we cannot perform comprehensive CIF testing across the entire product suite. Therefore, we had to develop meaningful inclusion criteria and work with other stakeholders across the applications development organization to prioritize product areas for testing. Ultimately, we want to test the product areas for which customers might be most interested in seeing CIF data. We also want to build credibility with customers; we need to be able to make the case to current and prospective customers that the product areas tested are representative of the product suite as a whole. Our goal is to test the top use cases for each product. The primary activity in the scoping process was to work with the individual product teams to identify the key products and business process task flows in each product to test. We prioritized these products and flows through a series of negotiations among the user experience managers, product strategy, and product management directors for each of the primary product families within the Oracle Fusion Applications suite (Human Capital Management, Supply Chain Management, Customer Relationship Management, Financials, Projects, and Procurement). The end result of the scoping exercise was a list of 47 proposed CIF tests for the Fusion Applications product suite.  Figure 1. A participant completes tasks during a usability test in Oracle’s Usability Labs Fusion Supplier Portal CIF Test The first Fusion CIF test was completed on the Supplier Portal application in July of 2011.  Fusion Supplier Portal is part of an integrated suite of Procurement applications that helps supplier companies manage orders, schedules, shipments, invoices, negotiations and payments. The user roles targeted for the usability study were Supplier Account Receivables Specialists and Supplier Sales Representatives, including both experienced and inexperienced users across a wide demographic range.  The test specifically focused on the following functionality and features: Manage payments – view payments Manage invoices – view invoice status and create invoices Manage account information – create new contact, review bank account information Manage agreements – find and view agreement, upload agreement lines, confirm status of agreement lines upload Manage purchase orders (PO) – view history of PO, request change to PO, find orders Manage negotiations – respond to request for a quote, check the status of a negotiation response These product areas were selected to represent the most important subset of features and functionality of the flow, in terms of frequency and criticality of use by customers. A total of 20 users participated in the usability study. The results of the Supplier Portal evaluation were favorable and exceeded our expectations. Figure 2. Fusion Supplier Portal Next Studies We plan to conduct two Fusion CIF usability studies per product family over the next nine months. The next product to be tested will be Self-service Procurement. End users are currently being recruited to participate in this usability study, and the test sessions are scheduled to begin during the last week of November.

    Read the article

  • Extreme Optimization – Numerical Algorithm Support

    - by JoshReuben
    Function Delegates Many calculations involve the repeated evaluation of one or more user-supplied functions eg Numerical integration. The EO MathLib provides delegate types for common function signatures and the FunctionFactory class can generate new delegates from existing ones. RealFunction delegate - takes one Double parameter – can encapsulate most of the static methods of the System.Math class, as well as the classes in the Extreme.Mathematics.SpecialFunctions namespace: var sin = new RealFunction(Math.Sin); var result = sin(1); BivariateRealFunction delegate - takes two Double parameters: var atan2 = new BivariateRealFunction (Math.Atan2); var result = atan2(1, 2); TrivariateRealFunction delegate – represents a function takes three Double arguments ParameterizedRealFunction delegate - represents a function taking one Integer and one Double argument that returns a real number. The Pow method implements such a function, but the arguments need order re-arrangement: static double Power(int exponent, double x) { return ElementaryFunctions.Pow(x, exponent); } ... var power = new ParameterizedRealFunction(Power); var result = power(6, 3.2); A ComplexFunction delegate - represents a function that takes an Extreme.Mathematics.DoubleComplex argument and also returns a complex number. MultivariateRealFunction delegate - represents a function that takes an Extreme.Mathematics.LinearAlgebra.Vector argument and returns a real number. MultivariateVectorFunction delegate - represents a function that takes a Vector argument and returns a Vector. FastMultivariateVectorFunction delegate - represents a function that takes an input Vector argument and an output Matrix argument – avoiding object construction  The FunctionFactory class RealFromBivariateRealFunction and RealFromParameterizedRealFunction helper methods - transform BivariateRealFunction or a ParameterizedRealFunction into a RealFunction delegate by fixing one of the arguments, and treating this as a new function of a single argument. var tenthPower = FunctionFactory.RealFromParameterizedRealFunction(power, 10); var result = tenthPower(x); Note: There is no direct way to do this programmatically in C# - in F# you have partial value functions where you supply a subset of the arguments (as a travelling closure) that the function expects. When you omit arguments, F# generates a new function that holds onto/remembers the arguments you passed in and "waits" for the other parameters to be supplied. let sumVals x y = x + y     let sumX = sumVals 10     // Note: no 2nd param supplied.     // sumX is a new function generated from partially applied sumVals.     // ie "sumX is a partial application of sumVals." let sum = sumX 20     // Invokes sumX, passing in expected int (parameter y from original)  val sumVals : int -> int -> int val sumX : (int -> int) val sum : int = 30 RealFunctionsToVectorFunction and RealFunctionsToFastVectorFunction helper methods - combines an array of delegates returning a real number or a vector into vector or matrix functions. The resulting vector function returns a vector whose components are the function values of the delegates in the array. var funcVector = FunctionFactory.RealFunctionsToVectorFunction(     new MultivariateRealFunction(myFunc1),     new MultivariateRealFunction(myFunc2));  The IterativeAlgorithm<T> abstract base class Iterative algorithms are common in numerical computing - a method is executed repeatedly until a certain condition is reached, approximating the result of a calculation with increasing accuracy until a certain threshold is reached. If the desired accuracy is achieved, the algorithm is said to converge. This base class is derived by many classes in the Extreme.Mathematics.EquationSolvers and Extreme.Mathematics.Optimization namespaces, as well as the ManagedIterativeAlgorithm class which contains a driver method that manages the iteration process.  The ConvergenceTest abstract base class This class is used to specify algorithm Termination , convergence and results - calculates an estimate for the error, and signals termination of the algorithm when the error is below a specified tolerance. Termination Criteria - specify the success condition as the difference between some quantity and its actual value is within a certain tolerance – 2 ways: absolute error - difference between the result and the actual value. relative error is the difference between the result and the actual value relative to the size of the result. Tolerance property - specify trade-off between accuracy and execution time. The lower the tolerance, the longer it will take for the algorithm to obtain a result within that tolerance. Most algorithms in the EO NumLib have a default value of MachineConstants.SqrtEpsilon - gives slightly less than 8 digits of accuracy. ConvergenceCriterion property - specify under what condition the algorithm is assumed to converge. Using the ConvergenceCriterion enum: WithinAbsoluteTolerance / WithinRelativeTolerance / WithinAnyTolerance / NumberOfIterations Active property - selectively ignore certain convergence tests Error property - returns the estimated error after a run MaxIterations / MaxEvaluations properties - Other Termination Criteria - If the algorithm cannot achieve the desired accuracy, the algorithm still has to end – according to an absolute boundary. Status property - indicates how the algorithm terminated - the AlgorithmStatus enum values:NoResult / Busy / Converged (ended normally - The desired accuracy has been achieved) / IterationLimitExceeded / EvaluationLimitExceeded / RoundOffError / BadFunction / Divergent / ConvergedToFalseSolution. After the iteration terminates, the Status should be inspected to verify that the algorithm terminated normally. Alternatively, you can set the ThrowExceptionOnFailure to true. Result property - returns the result of the algorithm. This property contains the best available estimate, even if the desired accuracy was not obtained. IterationsNeeded / EvaluationsNeeded properties - returns the number of iterations required to obtain the result, number of function evaluations.  Concrete Types of Convergence Test classes SimpleConvergenceTest class - test if a value is close to zero or very small compared to another value. VectorConvergenceTest class - test convergence of vectors. This class has two additional properties. The Norm property specifies which norm is to be used when calculating the size of the vector - the VectorConvergenceNorm enum values: EuclidianNorm / Maximum / SumOfAbsoluteValues. The ErrorMeasure property specifies how the error is to be measured – VectorConvergenceErrorMeasure enum values: Norm / Componentwise ConvergenceTestCollection class - represent a combination of tests. The Quantifier property is a ConvergenceTestQuantifier enum that specifies how the tests in the collection are to be combined: Any / All  The AlgorithmHelper Class inherits from IterativeAlgorithm<T> and exposes two methods for convergence testing. IsValueWithinTolerance<T> method - determines whether a value is close to another value to within an algorithm's requested tolerance. IsIntervalWithinTolerance<T> method - determines whether an interval is within an algorithm's requested tolerance.

    Read the article

  • Drive Online Engagement with Intuitive Portals and Websites

    - by kellsey.ruppel
    As more and more business is being conducted via online channels, engaging users and making them more productive and efficient though these online channels is becoming critical. These users could be customers, partners or employees and while the respective channels through which they interact might be different, these users do increasingly interact with your business through the Web, or mobile devices or now through various social mediums.  Businesses need a user engagement strategy and solution that allows them to deliver targeted and personalized content and applications to users through the various online mediums and touch points.  The customer experience today is made up of an ongoing set of interactions with organizations across many channels, online and offline.  The Direct channel (including sales reps, email and mail) is an important point of contact, as is the Contact Center.  Contact Centers rely on the phone as a means of interacting with customers, and also more now than ever, the Web as well.  However, the online organization is often managed separately from the Contact Center organization within a business. In-store is an important channel for retailers, offering Point-of-Service for human interactions, and Kiosks which enable self-service. Kiosks are a Web-enabled touch point but in-store kiosks are often managed by the head of retail operations, rather than the online organization.  And of course, the online channel, including customer interactions with an organization via digital means -- on the website, mobile websites, and social networking sites, has risen to paramount importance in recent years in the customer experience. Historically all of these channels have been managed separately. The result of all of this fragmentation is that the customer touch points with an organization are siloed.  Their interactions online are not known and respected in their dealings in-store.  Their calls to the contact center are not taken as input into what the website offers them when they arrive. Think of how many times you’ve fallen victim to this. Your experience with the company call center is different than the experience in-store. Your experience with the company website on your desktop computer is different than your experience on your iPad. I think you get the point. But the customer isn’t the only one we need to look at here, as employees and the IT organization have challenges as well when it comes to online engagement. There are many common tools and technologies that organizations have been using to try and engage users, whether it’s customers, employees or partners. Some have adopted different blog and wiki technologies (some hosted, some open source, sometimes embedded in platforms), to things like tagging, file sharing and content management, or composite applications for self-service applications and activity streams. Basically, there are so many different tools & technologies that each address different aspects of user engagement. Now, one of the challenges with this, is that if we look at each individual tool, typically just implementing for example a file sharing and basic collaboration solution, may meet the needs of the business user for one aspect of user engagement, but it may not be the best solution to engage with customers and partners, or it may not fit with IT standards such as integrating with their single sign on tools or their corporate website. Often, the scenario is that businesses are having to acquire multiple pieces and parts as well as build custom applications to meet their needs. Leaving customers and partners with a more fragmented way of interacting with the company. Every organization has some sort of enterprise balancing act between the needs of the business user and the needs and restrictions enforced by enterprise IT groups. As we’ve been discussing, we all know that the expectations for online engagement have changed since the days of the static, one-size fits all website. With these changes have come some very difficult organizational challenges as well. Today, as a business user, you want to engage with your customers, and your customers expect you to know who they are. They expect you to recall the details they’ve provided to you on your website, to your CSRs and to your sales people. They expect you to remember their purchases, their preferences and their problems. And they expect you to know who they are, equally well, across channels, including your web presence. This creates a host of challenges for today’s business users. Delivering targeted, relevant content online is now essential for converting prospects into customers and for engendering long term loyalty. Business users need the ability to leverage customer data from different sources to fuel their segmentation and targeting strategies and to easily set-up, manage and optimize online campaigns. Also critical, they need the ability to accomplish these things on-the-fly, at the speed of the marketplace, while making iterative improvements.  These changing expectations put a host of demands on the IT organization as well. The web presence must be able to scale to support the delivery of personalized and targeted content to thousands of site visitors without sacrificing performance. And integration between systems becomes more important as well, as organizations strive to obtain one view of the customer culled from WCM data, CRM data and more. So then, how do you solve these challenges and meet the growing demands of your users?  You need a solution that: Unifies every customer interaction across all channels Personalizes the products and content that interest the customer and to the device Delivers targeted promotions to the right customer Engages and improve employee productivity Provides self-service access to applications Includes embedded in-context social   So how then do you achieve this level of online engagement, complete customer experience and engage your employees? The answer: Oracle WebCenter. If you want to learn how to get there, we encourage you to attend this webcast on Thursday Drive Online Engagement with Intuitive Portals and Websites, where we'll talk about how you are able to transform your portal experience and optimize online engagement -- making your portals more interactive and more engaging across multiple channels. Register today!

    Read the article

  • Diophantine Equation [closed]

    - by ANIL
    In mathematics, a Diophantine equation (named for Diophantus of Alexandria, a third century Greek mathematician) is a polynomial equation where the variables can only take on integer values. Although you may not realize it, you have seen Diophantine equations before: one of the most famous Diophantine equations is: X^n+Y^n=Z^n We are not certain that McDonald's knows about Diophantine equations (actually we doubt that they do), but they use them! McDonald's sells Chicken McNuggets in packages of 6, 9 or 20 McNuggets. Thus, it is possible, for example, to buy exactly 15 McNuggets (with one package of 6 and a second package of 9), but it is not possible to buy exactly 16 nuggets, since no non- negative integer combination of 6's, 9's and 20's adds up to 16. To determine if it is possible to buy exactly n McNuggets, one has to solve a Diophantine equation: find non-negative integer values of a, b, and c, such that 6a + 9b + 20c = n. Problem 1 Show that it is possible to buy exactly 50, 51, 52, 53, 54, and 55 McNuggets, by finding solutions to the Diophantine equation. You can solve this in your head, using paper and pencil, or writing a program. However you chose to solve this problem, list the combinations of 6, 9 and 20 packs of McNuggets you need to buy in order to get each of the exact amounts. Given that it is possible to buy sets of 50, 51, 52, 53, 54 or 55 McNuggets by combinations of 6, 9 and 20 packs, show that it is possible to buy 56, 57,..., 65 McNuggets. In other words, show how, given solutions for 50-55, one can derive solutions for 56-65. Problem 2 Write an iterative program that finds the largest number of McNuggets that cannot be bought in exact quantity. Your program should print the answer in the following format (where the correct number is provided in place of n): "Largest number of McNuggets that cannot be bought in exact quantity: n" Hints: Hypothesize possible instances of numbers of McNuggets that cannot be purchased exactly, starting with 1 For each possible instance, called n, a. Test if there exists non-negative integers a, b, and c, such that 6a+9b+20c = n. (This can be done by looking at all feasible combinations of a, b, and c) b. If not, n cannot be bought in exact quantity, save n When you have found six consecutive values of n that in fact pass the test of having an exact solution, the last answer that was saved (not the last value of n that had a solution) is the correct answer, since you know by the theorem that any amount larger can also be bought in exact quantity

    Read the article

  • Algorithm to Render a Horizontal Binary-ish Tree in Text/ASCII form

    - by Justin L.
    It's a pretty normal binary tree, except for the fact that one of the nodes may be empty. I'd like to find a way to output it in a horizontal way (that is, the root node is on the left and expands to the right). I've had some experience expanding trees vertically (root node at the top, expanding downwards), but I'm not sure where to start, in this case. Preferably, it would follow these couple of rules: If a node has only one child, it can be skipped as redundant (an "end node", with no children, is always displayed) All nodes of the same depth must be aligned vertically; all nodes must be to the right of all less-deep nodes and to the left of all deeper nodes. Nodes have a string representation which includes their depth. Each "end node" has its own unique line; that is, the number of lines is the number of end nodes in the tree, and when an end node is on a line, there may be nothing else on that line after that end node. As a consequence of the last rule, the root node should be in either the top left or the bottom left corner; top left is preferred. For example, this is a valid tree, with six end nodes (node is represented by a name, and its depth): [a0]------------[b3]------[c5]------[d8] \ \ \----------[e9] \ \----[f5] \--[g1]--------[h4]------[i6] \ \--------------------[j10] \-[k3] Which represents the horizontal, explicit binary tree: 0 a / \ 1 g * / \ \ 2 * * * / \ \ 3 k * b / / \ 4 h * * / \ \ \ 5 * * f c / \ / \ 6 * i * * / / \ 7 * * * / / \ 8 * * d / / 9 * e / 10 j (branches folded for compactness; * representing redundant, one-child nodes; note that *'s are actual nodes, storing one child each, just with names omitted here for presentation sake) (also, to clarify, I'd like to generate the first, horizontal tree; not this vertical tree) I say language-agnostic because I'm just looking for an algorithm; I say ruby because I'm eventually going to have to implement it in ruby anyway. Assume that each Node data structure stores only its id, a left node, and a right node. A master Tree class keeps tracks of all nodes and has adequate algorithms to find: A node's nth ancestor A node's nth descendant The generation of a node The lowest common ancestor of two given nodes Anyone have any ideas of where I could start? Should I go for the recursive approach? Iterative?

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

< Previous Page | 3 4 5 6 7 8  | Next Page >