Search Results

Search found 36065 results on 1443 pages for 'string manipulation'.

Page 7/1443 | < Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >

  • String.IsNullOrWhiteSpace

    - by Scott Dorman
    An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); }   return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty("   ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; }   Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

    Read the article

  • Feedback on "market manipulation", a peripheral game mechanic for a satirical MMO

    - by BerndBrot
    This question asks for feedback on a specific game-mechanic. Since there is not one right feedback on a game mechanic, I tried to provide enough context and guidelines to still make it possible for users to rate answers and to accept an answer as the best answer (following these criteria from Writer.SE's meta website). Please comment if you have any suggestions on how I could improve the question in that regard. So, let's begin with the game itself and some of its elements which are relevant for this question. Context I'm working on a satirical, text-based multiplayer adventure and role-playing game set in modern-day London. The game resolves around the concept of sin and features a myriad of (venomous) allusions to all the things that go wrong in this world. Players can choose between character classes like bullshit artist (consultant), bankster, lawyer, mobster, celebrity, politician, etc. In order to complete the game, the player has to live so sinfully with regard to any of the seven deadly sins that a demon is willing to offer them a contract of sponsorship. On their quest to live a sinful live, characters explore more and more locations of modern-day London (on a GoogleMap), fight "monsters" like insurance sales agents or Jehovah's Witnesses, and complete quests, like building a PowerPoint presentation out of marketing buzz words or keeping up a number of substance abuse effects in order to progress on the gluttony path. Battles are turn based with both combatants having a deck of cards, with which they try to make their enemy give in to temptations of all sorts. Tempted enemies sometimes become contacts (an item drop mechanic), which can be exploited for various benefits, depending on their area of influence (finance, underworld, bureaucracy, etc.), level of influence, and kind of sway that the player has over them (bribed, seduced, threatened, etc.) Once a contract has been exploited, the player loses that contact. Most actions require turns. Turns are limited, but refill each day. Criteria A number of peripheral game mechanics are supposed to represent real world abuses and mischief in a humorous way integrate real world data and events to strengthen the feeling of relevance of the game's humor with regard to real world problems add fun ways of interacting with other players add ways for players to express themselves through game-play Market manipulation is one such peripheral game mechanic and should fulfill all of these goals. Market manipulation This is my initial design of the mechanic: Players can enter the London Stock Exchange (LSE) (without paying a turn) LSE displays the stock prices of a number of companies in industries like weapons or tobacco as well as some derivatives based on wheat and corn. The stock prices are calculated based on the actual stock prices of these companies and derivatives (in real time) any market manipulations that were conducted by the players any market corrections of the system Players can buy and sell shares with cash, a resource in the game, at current in-game market value (without paying a turn). Players can manipulate the market, i.e. let the price of a share either rise or fall, by some amount, over a certain period of time. Manipulating the market requires 1 turn A contact in the financial sector (see above). The higher the level of influence of the contact, the stronger the effect of the manipulation on the stock price, and/or the shorter it takes for the manipulation to manifest itself. Market manipulation also adds a crime to the player's record. (There are a multitude of ways to take care of that, but it is still another "cost" of market manipulations.) The system continuously corrects market manipulations by letting the in-game prices converge towards their real world counterparts at a rate of 2% of the difference between the two per hour. Because of this market correction mechanism, pushing up prices (and screwing down prices) becomes increasingly difficult the higher (lower) the price already is. Whenever food prices reach a certain level, in-game stories are posted about hunger catastrophes happening somewhere far, far away (maybe with links to real world news stories). Whenever a player sells a certain number of shares with a sufficiently high margin, they are mentioned in that day's in-game financial news. Since the number of stock options is very limited, players will inevitably collide in their efforts to manipulate the market in their favor. Hopefully, it will also be a fun side-arena for guilds and covenants to fight each other. Question(s) What do you think of this mechanism given the criteria for peripheral game mechanics that I specified for my game? Do you have any ideas how the mechanic could be improved with regard to these criteria (or otherwise)? Could it be improved to allow for more expressive game-play, or involve an allusion to some other real world madness (like short selling, leveraging, or some other banking magic)? Are there any game-theoretic problems with this mechanic, like maybe certain dominant individual strategies that, collectively, lead to every player profiting and thus eliminating the idea of market manipulation PVP? Also, if you like (or dislike) this question, feel free to participate in the discussion on GDSE meta: "Should we be more lax with regard to SE's question/answer format to make game design questions possible?"

    Read the article

  • string manipulation without alloc mem in c

    - by Mike
    I'm wondering if there is another way of getting a sub string without allocating memory. To be more specific, I have a string as: const char *str = "9|0\" 940 Hello"; Currently I'm getting the 940, which is the sub-string I want as, char *a = strstr(str,"9|0\" "); char *b = substr(a+5, 0, 3); // gives me the 940 Where substr is my sub string procedure. The thing is that I don't want to allocate memory for this by calling the sub string procedure. Is there a much easier way?, perhaps by doing some string manipulation and not alloc mem. I'll appreciate any feedback.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Bitwise operators versus .NET abstractions for bit manipulation in C# prespective

    - by Leron
    I'm trying to get basic skills in working with bits using C#.NET. I posted an example yesterday with a simple problem that needs bit manipulation which led me to the fact that there are two main approaches - using bitwise operators or using .NET abstractions such as BitArray (Please let me know if there are more build-in tools for working with bits other than BitArray in .NET and how to find more info for them if there are?). I understand that bitwise operators work faster but using BitArray is something much more easier for me, but one thing I really try to avoid is learning bad practices. Even though my personal preferences are for the .NET abstraction(s) I want to know which i actually better to learn and use in a real program. Thinking about it I'm tempted to think that .NET abstractions are not that bad at, after all there must be reason to be there and maybe being a beginner it's more natural to learn the abstraction and later on improve my skills with low level operations, but this is just random thoughts.

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • Performance intensive string splitting and manipulation in java

    - by juhanic
    What is the most efficient way to split a string by a very simple separator? Some background: I am porting a function I wrote in C with a bunch of pointer arithmetic to java and it is incredibly slow(After some optimisation still 5* slower). Having profiled it, it turns out a lot of that overhead is in String.split The function in question takes a host name or ip address and makes it generic: 123.123.123.123-*.123.123.123 a.b.c.example.com-*.example.com This can be run over several million items on a regular basis, so performance is an issue.

    Read the article

  • How Do I Remove The First 4 Characters From A String If It Matches A Pattern In Ruby

    - by James
    I have the following string: "h3. My Title Goes Here" I basically want to remove the first 4 characters from the string so that I just get back: "My Title Goes Here". The thing is I am iterating over an array of strings and not all have the h3. part in front so I can't just ditch the first 4 characters blindly. I have checked the docs and the closest think I could find was chomp, but that only works for the end of a string. Right now I am doing this: "h3. My Title Goes Here".reverse.chomp(" .3h").reverse This gives me my desired output, but there has to be a better way right? I mean I don't want to reverse a string twice for no reason. I am new to programming so I might have missed something obvious, but I didn't see the opposite of chomp anywhere in the docs. Is there another method that will work? Thanks!

    Read the article

  • String Manipulation in C

    - by baris_a
    Hi guys, I am helping my nephew for his C lab homework, it is a string manipulation assignment and applying Wang's algorithm. Here is the BNF representation for the input. <sequent> ::= <lhs> # <rhs> <lhs> ::= <formulalist>| e <rhs> ::= <formulalist>| e <formulalist> ::= <formula>|<formula> , <formulalist> <formula> ::= <letter>| - <formula>| (<formula><in?xop><formula>) <in?xop> ::= & | | | > <letter> ::= A | B | ... | Z What is the best practice to handle and parse this kind of input in C? How can I parse this structure without using struct? Thanks in advance.

    Read the article

  • String to array or Array to string tips on formats, etc

    - by user316841
    hi, first of all thanks for taking your time! I'm a junior Dev, working with PHP + mysql. My issue: I'm saving data from a form to my database. From this form, there's only need to save the contacts: Name, phone number, address. But, it would be nice to have a small reference to the user answers. Let's say for each question we've got a value betwee 1 and 4. Since there's no need to create a table just for it, because what's needed is just the personal contacts. I'm thinking of recording each question/answer, as a letter and its correspondent value. Example (A2, B1, C5, D3, etc). My question is: Is there a format I could afterwards, handle easily ? Convert to array (string to array) in case the client change ideas, and ask this data, placed in table columns ? Just to prevent this situation! Example, From (A2, B1, C5 ) to array( "A" = "1", "B" = "1", "C" = "5" ) For now I guess, Regex is the answer, but it's allways hard to figure it out and I'm allways getting in troubles =) Thanks!

    Read the article

  • SQL SERVER – Find First Non-Numeric Character from String

    - by pinaldave
    It is fun when you have to deal with simple problems and there are no out of the box solution. I am sure there are many cases when we needed the first non-numeric character from the string but there is no function available to identify that right away. Here is the quick script I wrote down using PATINDEX. The function PATINDEX exists for quite a long time in SQL Server but I hardly see it being used. Well, at least I use it and I am comfortable using it. Here is a simple script which I use when I have to identify first non-numeric character. -- How to find first non numberic character USE tempdb GO CREATE TABLE MyTable (ID INT, Col1 VARCHAR(100)) GO INSERT INTO MyTable (ID, Col1) SELECT 1, '1one' UNION ALL SELECT 2, '11eleven' UNION ALL SELECT 3, '2two' UNION ALL SELECT 4, '22twentytwo' UNION ALL SELECT 5, '111oneeleven' GO -- Use of PATINDEX SELECT PATINDEX('%[^0-9]%',Col1) 'Position of NonNumeric Character', SUBSTRING(Col1,PATINDEX('%[^0-9]%',Col1),1) 'NonNumeric Character', Col1 'Original Character' FROM MyTable GO DROP TABLE MyTable GO Here is the resultset: Where do I use in the real world – well there are lots of examples. In one of the future blog posts I will cover that as well. Meanwhile, do you have any better way to achieve the same. Do share it here. I will write a follow up blog post with due credit to you. Reference : Pinal Dave (http://blog.SQLAuthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Function, SQL Query, SQL Server, SQL String, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • String.valueOf(int value) gives error [closed]

    - by Davidrd91
    I am trying to convert an int into a String so that I can put the String values into an SQLite Cursor. I've tried multiple syntax and methods but none seem to work for me. The Error occurs in MangaItemDB() while trying to convert any Int types aswell as the boolean. I've looked through several articles like this one but none works for me. Here's my code: public class MangaItem { private int _id; private String mangaName; private String mangaLink; private static String mangaAlpha; private static int mangaCount; private static int alphaCount; private boolean mangaComplete = false; public MangaItem MangaItemDB(int id, String mangaName, String mangaLink, String mangaAlpha, String mangaCount, String alphaCount, String mangaComplete) { MangaItem MangaItemDB = new MangaItem(); MangaItemDB._id = id; MangaItemDB.mangaName = mangaName; MangaItemDB.mangaLink = mangaLink; MangaItemDB.mangaAlpha = mangaAlpha; MangaItemDB.mangaCount = String.valueOf(int mangaCount); MangaItemDB.alphaCount = Integer.toString(getAlphaCount()); MangaItemDB.mangaComplete = String.valueOf(getMangaComplete()); return MangaItemDB; } public void incrementMangaCount() { mangaCount++; } public int getMangaCount() { return mangaCount; } public void incrementAlphaCount() { alphaCount++; } public int getAlphaCount() { return alphaCount; } public boolean setMangaComplete(boolean mangaComplete) { return true; } public boolean getMangaComplete() { return mangaComplete; } /** * @return the mangaName */ public String getMangaName() { return mangaName; } /** * @param mangaName the mangaName to set */ public void setMangaName(String mangaName) { this.mangaName = mangaName; } /** * @return the mangaLink */ public String getMangaLink() { return mangaLink; } /** * @param mangaLink the mangaLink to set */ public void setMangaLink(String mangaLink) { this.mangaLink = mangaLink; } /** * @return the mangaAlpha */ public String getMangaAlpha() { return mangaAlpha; } /** * @param mangaAlpha the mangaAlpha to set */ public void setMangaAlpha(String mangaAlpha) { this.mangaAlpha = mangaAlpha; } /** * @return the _id */ public int get_id() { return _id; } /** * @param _id the _id to set */ public void set_id(int _id) { this._id = _id; } } The lines : MangaItemDB.mangaCount = String.valueOf(mangaCount); MangaItemDB.alphaCount = Integer.toString(getAlphaCount()); MangaItemDB.mangaComplete = String.valueOf(getMangaComplete()); all give "Type mismatch: cannot convert from String to Int"

    Read the article

  • String Length Evaluating Incorrectly

    - by Justin R.
    My coworker and I are debugging an issue in a WCF service he's working on where a string's length isn't being evaluated correctly. He is running this method to unit test a method in his WCF service: // Unit test method public void RemoveAppGroupTest() { string addGroup = "TestGroup"; string status = string.Empty; string message = string.Empty; appActiveDirectoryServicesClient.RemoveAppGroup("AOD", addGroup, ref status, ref message); } // Inside the WCF service [OperationBehavior(Impersonation = ImpersonationOption.Required)] public void RemoveAppGroup(string AppName, string GroupName, ref string Status, ref string Message) { string accessOnDemandDomain = "MyDomain"; RemoveAppGroupFromDomain(AppName, accessOnDemandDomain, GroupName, ref Status, ref Message); } public AppActiveDirectoryDomain(string AppName, string DomainName) { if (string.IsNullOrEmpty(AppName)) { throw new ArgumentNullException("AppName", "You must specify an application name"); } } We tried to step into the .NET source code to see what value string.IsNullOrEmpty was receiving, but the IDE printed this message when we attempted to evaluate the variable: 'Cannot obtain value of local or argument 'value' as it is not available at this instruction pointer, possibly because it has been optimized away.' (None of the projects involved have optimizations enabled). So, we decided to try explicitly setting the value of the variable inside the method itself, immediately before the length check -- but that didn't help. // Lets try this again. public AppActiveDirectoryDomain(string AppName, string DomainName) { // Explicitly set the value for testing purposes. AppName = "AOD"; if (AppName == null) { throw new ArgumentNullException("AppName", "You must specify an application name"); } if (AppName.Length == 0) { // This exception gets thrown, even though it obviously isn't a zero length string. throw new ArgumentNullException("AppName", "You must specify an application name"); } } We're really pulling our hair out on this one. Has anyone else experienced behavior like this? Any tips on debugging it?

    Read the article

< Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >