Search Results

Search found 18803 results on 753 pages for 'link to'.

Page 706/753 | < Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >

• Ie7 float problems and hiperlinks not clickable

  - by Uffo

  Markup <ul class="navigation clearfix"> <li class="navigation-top"></li> <div class="first-holder" style="height:153px;"> <dl class="hold-items clearfix"> <dd class="clearfix with"><a href="http://site.com" title="Protokoll">Protokoll</a></dd> <dd class="with-hover"><a href="http://site.com" title="Mein/e Unternehmen">Mein/e Unternehmen</a></dd> <dd class="with"><a class="face-me" href="http://site.com" title="Erweiterte Suche">Erweiterte Suche</a></dd> <dd class="with"><a href="http://site.com" title="Abmelden">Abmelden</a></dd> </dl> </div><!--[end] /.first-holder--> <li class="navigation-bottom"></li> </ul><!--[end] /.navigation--> Css: .first-holder{height:304px;position:relative;width:178px;overflow:hidden;margin-bottom:0px;padding-bottom: 0px;} .hold-items{top:0px;position:absolute;} .navigation dd.with{line-height:38px;background:url('/images/sprite.png') no-repeat -334px -46px;width:162px;height:38px;padding-bottom:0px;overflow: hidden;} .navigation dd.with a{position:relative;outline:0;display:block;font-weight:bold;color:#3f78c0;padding-left:10px;line-height:38px;} .with-hover{background:url('/images/sprite.png') no-repeat -505px -47px;width:178px;height:38px;line-height:38px;overflow:none;} .with-hover a{position:relative;display:block;font-weight:bold;color:#fff;padding-left:10px} .navigation-top{background:url('/images/sprite.png') no-repeat -694px -46px;width:160px;height:36px;} .navigation-top a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-top a span{display:block;background:url('/images/sprite.png') no-repeat -212px -65px;width:8px;height:6px;} .navigation-bottom{background:url('/images/sprite.png') no-repeat -784px -402px;width:160px;height:37px;} .navigation-bottom a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-bottom a span{display:block;background:url('/images/sprite.png') no-repeat -212px -74px;width:8px;height:6px;} Also the links, are not clickable, if I click on a link in IE7 it doesn't do the action..it doesn't redirect me to the location. This is how it looks in IE7: http://screencast.com/t/MGY4NjljZjc This is how it look in IE8,Firefox,Chrome and so on http://screencast.com/t/MzhhMDQ1M What I'm doing wrong PS: .navigation-top a span and .navigation-bottom a span I'm using some where else, but that it's ok it works fine.

  Read the article

• jquery ie6 issue swaping videos through hide/show while playing.

  - by user217181

  So my code is: Click the link show the div. I'm using the jquery flash embed object. $(document).ready( function() { $('a.overview').click( function() { $('#overview').show(); // show div.contact $('#evaulting').hide(); // hide div.contact $('#his').hide(); // hide div.contact }); }); $(document).ready( function() { $('a.evaulting').click( function() { $('#evaulting').show(); // show div.contact $('#overview').hide(); // hide div.contact $('#his').hide(); // hide div.contact }); }); <div id="overview" style="display:none"> <ul> <li rel="play-norelated.swf:680:480:true:ffffff" class="flash-replaced"> <embed width="680" height="480" type="application/x-shockwave-flash" src="play-norelated.swf" pluginspage="http://www.adobe.com/go/getflashplayer" flashvars="playVideo=ent_web_480x" bgcolor="ffffff" /> <div class="alt"><h1>To Play Iron Mountain Videos - You will need to upgrade your Flash Player</h1> <p><a href="http://www.adobe.com/go/getflashplayer"><img src="http://www.adobe.com/images/shared/download_buttons/get_flash_player.gif" alt="Get Adobe Flash player" /></a></p></div> </li> </ul> </div> <div id="evaulting" style="display:none"> <ul> <li rel="play-norelated.swf:680:480:true:ffffff" class="flash-replaced"> <embed width="680" height="480" type="application/x-shockwave-flash" src="play-norelated.swf" pluginspage="http://www.adobe.com/go/getflashplayer" flashvars="playVideo=evaulting_web_480x" bgcolor="ffffff" /> <div class="alt"><h1>To Play Iron Mountain Video's - You will need to upgrade your Flash Player</h1> <p><a href="http://www.adobe.com/go/getflashplayer"><img src="http://www.adobe.com/images/shared/download_buttons/get_flash_player.gif" alt="Get Adobe Flash player" /></a></p></div> </li> </ul> </div> When I repeat this code and get the second video to load on click. It works in all browsers. The only issue I'm running into is that in IE6 the video keeps playing and in other browsers it stops the video your watching and loads the one you clicked on. I looked into using the .remove object or the .append to a div, but I can't seem to get that to work and if it does work will it play nice with IE6. Try it out and maybe solve my issues.

  Read the article

• How to perform add/update of a model object that contains EntitySet

  - by David Liddle

  I have a similar concept to the SO questions/tags scenario however am trying to decide the best way of implementation. Tables Questions, QuestionTags and Tags Questions QuestionTags Tags --------- ------------ ---- QID QID TID QName TID TName When adding/updating a question I have 2 textboxes. The important part is a single textbox that allows users to enter in multiple Tags separated by spaces. I am using Linq2Sql so the Questions model has an EntitySet of QuestionTags with then link to Tags. My question is regarding the adding/updating of Questions (part 1), and also how to best show QuestionTags for a Question (part 2). Part 1 Before performing an add/update, my service layer needs to deal with 3 scenarios before passing to their respective repositories. Insert Tags that do not already exist Insert/Update Question Insert QuestionTags - when updating need to remove existing QuestionTags Here is my code below however started to get into a bit of a muddle. I've created extension methods on my repositories to get Tags WithNames etc. public void Add(Question q, string tags) { var tagList = tags.Split(new string[] { " " }, StringSplitOptions.RemoveEmptyEntries).ToList(); using (DB.TransactionScope ts = new DB.TransactionScope()) { var existingTags = TagsRepository.Get() .WithName(tagList) .ToList(); var newTags = (from t in tagList select new Tag { TName = t }).Except(existingTags, new TagsComparer()).ToList(); TagsRepository.Add(newTags); //need to insert QuestionTags QuestionsRepository.Add(q); ts.Complete(); } } Part 2 My second question is, when displaying a list of Questions how is it best to show their QuestionTags? For example, I have an Index view that shows a list of Questions in a table. One of the columns shows an image and when the user hovers over it shows the list of Tags. My current implementation is to create a custom ViewModel and show a List of QuestionIndexViewModel in the View. QuestionIndexViewModel { Question Question { get; set; } string Tags { get; set; } } However, this seems a bit clumsy and quite a few DB calls. public ViewResult Index() { var model= new List<QuestionIndexViewModel>(); //make a call to get a list of questions //foreach question make a call to get their QuestionTags, //to be able to get their Tag names and then join them //to form a single string. return View(model); } Also, just for test purposes using SQL Profiler, I decided to iterate through the QuestionTags entity set of a Question in my ViewModel however nothing was picked up in Profiler? What would be the reason for this?

  Read the article

• HTML: Include, or exclude, optional closing tags?

  - by Ian Boyd

  Some HTML1 closing tags are optional, i.e.: </HTML> </HEAD> </BODY> </P> </DT> </DD> </LI> </OPTION> </THEAD> </TH> </TBODY> </TR> </TD> </TFOOT> </COLGROUP> Note: Not to be confused with closing tags that are forbidden to be included, i.e.: </IMG> </INPUT> </BR> </HR> </FRAME> </AREA> </BASE> </BASEFONT> </COL> </ISINDEX> </LINK> </META> </PARAM> Note: xhtml is different from HTML. xhtml is a form of xml, which requires every element have a closing tag. A closing tag can be forbidden in html, yet mandatory in xhtml. Are the optional closing tags ideally included, but we'll accept them if you forgot them, or ideally not included, but we'll accept them if you put them in In other words, should i include them, or should i not include them? The HTML 4.01 spec talks about closing element tags being optional, but doesn't say if it's preferable to include them, or preferable to not include them. On the other hand, a random article on DevGuru says: The ending tag is optional. However, it is recommended that it be included. The reason i ask is because you just know it's optional for compatibility reasons; and they would have made them (mandatory | forbidden) if they could have. Put it another way: What did HTML 1, 2, 3 do with regards to these, now optional, closing tags. What does HTML 5 do? And what should i do? Footnotes 1HTML 4.01

  Read the article

• Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

  - by Ian Leslie

  I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

  Read the article

• How to efficently build an interpreter (lexer+parser) in C?

  - by Rizo

  I'm trying to make a meta-language for writing markup code (such as xml and html) wich can be directly embedded into C/C++ code. Here is a simple sample written in this language, I call it WDI (Web Development Interface): /* * Simple wdi/html sample source code */ #include <mySite> string name = "myName"; string toCapital(string str); html { head { title { mySiteTitle; } link(rel="stylesheet", href="style.css"); } body(id="default") { // Page content wrapper div(id="wrapper", class="some_class") { h1 { "Hello, " + toCapital(name) + "!"; } // Lists post ul(id="post_list") { for(post in posts) { li { a(href=post.getID()) { post.tilte; } } } } } } } Basically it is a C source with a user-friendly interface for html. As you can see the traditional tag-based style is substituted by C-like, with blocks delimited by curly braces. I need to build an interpreter to translate this code to html and posteriorly insert it into C, so that it can be compiled. The C part stays intact. Inside the wdi source it is not necessary to use prints, every return statement will be used for output (in printf function). The program's output will be clean html code. So, for example a heading 1 tag would be transformed like this: h1 { "Hello, " + toCapital(name) + "!"; } // would become: printf("<h1>Hello, %s!</h1>", toCapital(name)); My main goal is to create an interpreter to translate wdi source to html like this: tag(attributes) {content} = <tag attributes>content</tag> Secondly, html code returned by the interpreter has to be inserted into C code with printfs. Variables and functions that occur inside wdi should also be sorted in order to use them as printf parameters (the case of toCapital(name) in sample source). I am searching for efficient (I want to create a fast parser) way to create a lexer and parser for wdi. Already tried flex and bison, but as I am not sure if they are the best tools. Are there any good alternatives? What is the best way to create such an interpreter? Can you advise some brief literature on this issue?

  Read the article

• Configuring a html page from an original demo page

  - by Wold

  I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

  Read the article

• Regular expression to convert ul to textindent and back, with a different attribute value for first

  - by chapmanio

  Hi, This is a related to a previous question I have asked here, see the link below for a brief description as to why I am trying to do this. Regular expression from font to span (size and colour) and back (VB.NET) Basically I need a regex replace function (or if this can be done in pure VB then that's fine) to convert all ul tags in a string to textindent tags, with a different attribute value for the first textindent tag. For example: <ul> <li>This is some text</li> <li>This is some more text</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> <li> <ul> <li>This is some indented text</li> <li>This is some more text</li> </ul> </li> <li>More text!</li> </ul> Will become: <textformat indent="0"> <li>This is some text</li> <li>This is some more text</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> <li> <textformat indent="20"> <li>This is some indented text</li> <li>This is some more text</li> </textformat> </li> <li>More text!</li> </textformat> Basically I want the first ul tag to have no indenting, but all nested ul tags to have an indent of 20. I appreciate this is a strange request but hopefully that makes sense, please let me know if you have any questions. Thanks in advance.

  Read the article

• NHibernate Many to Many delete all my data in the table

  - by Daoming Yang

  I would love to thank @Stefan Steinegger and @David helped me out yesterday with many-to-many mapping. I have 3 tables which are "News", "Tags" and "News_Tags" with Many-To-Many relationship and the "News_Tags" is the link table. If I delete one of the news records, the following mappings will delete all my news records which have the same tags. One thing I need to notice, I only allowed unique tag stored in the "Tag" table. This mapping make sense for me, it will delete the tag and related News records, but how can I implement a tagging system with NHibernate? Can anyone give me some suggestion? Many thanks. Daoming. News Mapping: <class name="New" table="News" lazy="false"> <id name="NewID"> <generator class="identity" /> </id> <property name="Title" type="String"></property> <property name="Description" type="String"></property> <set name="TagsList" table="New_Tags" lazy="false" inverse="true" cascade="all"> <key column="NewID" /> <many-to-many class="Tag" column="TagID" /> </set> </class> Tag Mapping: <class name="Tag" table="Tags" lazy="false"> <id name="TagID"> <generator class="identity" /> </id> <property name="TagName" type="String"></property> <property name="DateCreated" type="DateTime"></property> <!--inverse="true" has been defined in the "News mapping"--> <set name="NewsList" table="New_Tags" lazy="false" cascade="all"> <key column="TagID" /> <many-to-many class="New" column="NewID" /> </set> </class>

  Read the article

• meteor mongodb _id changing after insert (and UUID property as well)

  - by lommaj

  I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

  Read the article

• Trying to integrate CakePHP and jQuery

  - by user198003

  Trying to integrate CakePHP and jQuery, using next example http://bakery.cakephp.org/articles/view/dynamic-select-boxes-with-ajax-jquery What I want is to when user change first option element, to automaticly fill second select option box with proper values. But, nothing happens, if you can help me why. So, there is a Invoice add form (add.ctp), with next code... <?php echo $form->create('Invoice');?> <?php echo $javascript->link('jquery.js'); $category = array('1' => 'First', '4' => 'Fourth', '7' => 'Seventh'); echo $form->input('client_id', array('options' => $category, 'empty' => 'Choose:')); echo $form->select('clientBank_id', array("Choose category first"), null, null, false); ?> <script> $("#InvoiceClientId").change(function () { $.post('/invoices/listTitleByCategory/' + $(this).val(), function(data) { $("#InvoiceClientBankId").empty().append(data); }, 'html'); }) </script> Also, there is controller (invoices_controller.php): <?php var $name = 'Invoices'; var $helpers = array('Html', 'Form', 'Time', 'Number', 'Javascript'); var $paginate = array('order' => array('Invoice.pinned DESC', 'Invoice.invoiceNumber')); var $components = array('RequestHandler'); function beforeRender(){ // prevent useless warnings for Ajax if($this->RequestHandler->isAjax()){ Configure::write('debug', 0); } } // etc... function listTitleByCategory($category = "") { $this->layout = 'ajax'; $this->beforeRender(); $this->autoRender = false; $data = $this->Invoice->Client->find('list'); echo "<option value=0>just for testing...</option>"; foreach($data as $key => $val) { echo "<option value=$key>$val</option>"; } } ?> Please, if you can help me solving this. Thank you in advance!

  Read the article

• How to Load Dependent Files on Demand + Check if They're Loaded or Not?

  - by br4inwash3r

  I'm trying to implement an assets/dependency loader that i've found from an old article at 24Ways.org. most of you might be familiar with it. it's from this article by Christian Heilmann: http://24ways.org/2007/keeping-javascript-dependencies-at-bay i've modified the script to load CSS files as well. and it's now quite close to what i want. but i still need to do some checking to see wether an asset have been completely loaded or not. just wondering if you guys have any ideas :) here's what my script currently looked like: var assetLoader = { assets: { products: { js: 'products.js', css: 'products.css', loaded: false }, articles: { js: 'articles.js', css: 'articles.css', loaded: false }, [...] cycle: { js: 'jquery.cycle.min.js', loaded: false }, swfobject: { js: 'jquery.swfobject.min.js', loaded: false } }, add: function(asset) { var comp = assetLoader.assets[asset]; var path = '/path/to/assets/'; if (comp && comp.loaded == false) { if (comp.js) { // load js var js = document.createElement('script'); js.src = path + 'js/' + comp.js; js.type = 'text/javascript'; js.charset = 'utf-8'; // append to document document.getElementsByTagName('body')[0].appendChild(js); } if (comp.css) { // load css var css = document.createElement('link'); css.rel = 'stylesheet'; css.href = path + 'css/' + comp.css; css.type = 'text/css'; css.media = 'screen, projection'; css.charset = 'utf-8'; // append to document document.getElementsByTagName('head')[0].appendChild(css); } } }, check: function(asset) { assetLoader.assets[asset].loaded = true; } } Christian explains this method in his article in great detail. I don't want to confuse you guys anymore with my bad english :P and here's an example of how i run the script: ... // load jquery cycle plugin if (page=='tvc' || page=='products') { if (!assetLoader.assets.cycle.loaded) { assetLoader.add('cycle'); } } // load products page assets if (!assetLoader.assets.products.loaded) { assetLoader.add('products'); } ... this kind of approach is very problematic though. coz assets loads asynchronously, which means some of the code inside products.js that depends on jquery.cycle.js might continue running before jquery.cycle.js is even loaded resulting in errors. while i'm quite aware that scripts can be attached with an onload event, i'm just not really sure how to implement it to my script. anyone care to help me? please... :P

  Read the article

• Google Code + SVN or GitHub + Git

  - by Nazgulled

  Let me start by telling you that I never used anything besides SVN and I'm also a Windows user. I have a couple of simple projects that are open-source, others are on there way when I'm happy enough to release their source code but either way, I was thinking of using Google Code and SVN to share the source code of my projects instead of providing a link to the source on my website. This as always been a pain cause I had to update the binaries and the code every time I released a new version. This would also help me out to have a backup of my code some where instead of just my local machine (I used to have a local Subversion server running). What I want from a service like this is very simple... I just want a place to store my source code that people can download if they want, allows me to control revisions and provide a simple and easy issue system so people can submit bugs and stuff like that. I guess both of them have this. But I don't want to host any binaries in their websites, I want this to be hosted on my website so I can control download statistics with my own scripts, I also don't have the need for wiki pages as I prefer to have all the documentation in my own website. Does anyone of this services provide a way to "disable" features like wiki and downloads and don't show them at all for my project(s)? Now, I'm sure there are lots of pros and cons about using Google Code with SVN and GitHub with Git (of course) but here's what it's important for me on each one and why I like them: Google Code: As with any Google page, the complexity is almost non-existent Everyone (or almost) as a Google account and this is nice if people want to report problems using the issues system GitHub: May (or may not) be a little more complex (not a problem for me though) than Google's pages but... ...has a much prettier interface than Google's service It needs people to be registered on GitHub to post about issues I like the fact that with Git, you have your own revisions locally (can I use TortoiseGit for this or?) Basically that's it, not much I know... What other, most common, pros and cons can you tell me about each site/software? Keep in mind that my projects are simple, I'm probably the only one who will ever develop these projects on these repositories (or maybe not, for now I will)

  Read the article

• mysql timeout - c/C++

  - by user1262876

  Guys i'm facing a problem with this code, the problem is the timeout by timeout i mean the time it takes the program to tell me if the server is connected or not. If i use my localhost i get the answer fast, but when i connect to outside my localhost it takes 50sc - 1.5 min to response and the program frezz until it done. HOw can i fix the frezzing, or make my own timeout, like if still waiting after 50sc, tell me connection failed and stop? please use codes as help, becouse i would understand it better, thanks for any help i get PS: USING MAC #include "mysql.h" #include <stdio.h> #include <stdlib.h> // Other Linker Flags: -lmysqlclient -lm -lz // just going to input the general details and not the port numbers struct connection_details { char *server; char *user; char *password; char *database; }; MYSQL* mysql_connection_setup(struct connection_details mysql_details) { // first of all create a mysql instance and initialize the variables within MYSQL *connection = mysql_init(NULL); // connect to the database with the details attached. if (!mysql_real_connect(connection,mysql_details.server, mysql_details.user, mysql_details.password, mysql_details.database, 0, NULL, 0)) { printf("Conection error : %s\n", mysql_error(connection)); exit(1); } return connection; } MYSQL_RES* mysql_perform_query(MYSQL *connection, char *sql_query) { // send the query to the database if (mysql_query(connection, sql_query)) { printf("MySQL query error : %s\n", mysql_error(connection)); exit(1); } return mysql_use_result(connection); } int main() { MYSQL *conn; // the connection MYSQL_RES *res; // the results MYSQL_ROW row; // the results row (line by line) struct connection_details mysqlD; mysqlD.server = (char*)"Localhost"; // where the mysql database is mysqlD.user = (char*)"root"; // the root user of mysql mysqlD.password = (char*)"123456"; // the password of the root user in mysql mysqlD.database = (char*)"test"; // the databse to pick // connect to the mysql database conn = mysql_connection_setup(mysqlD); // assign the results return to the MYSQL_RES pointer res = mysql_perform_query(conn, (char*) "SELECT * FROM me"); printf("MySQL Tables in mysql database:\n"); while ((row = mysql_fetch_row(res)) !=NULL) printf("%s - %s\n", row[0], row[1], row[2]); // <-- Rows /* clean up the database result set */ mysql_free_result(res); /* clean up the database link */ mysql_close(conn); return 0; }

  Read the article

• Problem Fetching JSON Result with jQuery in Firefox and Chrome (IE8 Works)

  - by senfo

  I'm attempting to parse JSON using jQuery and I'm running into issues. Using the code below, the data keeps coming back null: <!DOCTYPE html> <html> <head> <title>JSON Test</title> </head> <body> <div id="msg"></div> <script src="http://code.jquery.com/jquery-latest.js"></script> <script> $.ajax({ url: 'http://datawarehouse.hrsa.gov/ReleaseTest/HGDWDataWebService/HGDWDataService.aspx?service=HC&zip=20002&radius=10&filter=8357&format=JSON', type: 'GET', dataType: 'json', success: function(data) { $('#msg').html(data[0].title); // Always null in Firefox/Chrome. Works in IE8. }, error: function(data) { alert(data); } }); </script> </body> </html> The JSON results look like the following: {"title":"HEALTHPOINT TYEE CAMPUS","link":"http://www.healthpointchc.org","id":"tag:datawarehouse.hrsa.gov,2010-04-29:/8357","org":"HEALTHPOINT TYEE CAMPUS","address":{"street-address":"4424 S. 188TH St.","locality":"Seatac","region":"Washington","postal-code":"98188-5028"},"tel":"206-444-7746","category":"Service Delivery Site","location":"47.4344818181818 -122.277672727273","update":"2010-04-28T00:00:00-05:00"} If I replace my URL with the Flickr API URL (http://api.flickr.com/services/feeds/photos_public.gne?tags=cat&tagmode=any&format=json&jsoncallback=?), I get back a valid JSON result that I am able to make use of. I have successfully validated my JSON at JSONLint, so I've run out of ideas as to what I might be doing wrong. Any thoughts? Update: I had the client switch the content type to application/json. Unfortunately, I'm still experiencing the exact same problem. I also updated my HTML and included the live URL I've been working with. Update 2: I just gave this a try in IE8 and it works fine. For some reason, it doesn't work in either Firefox 3.6.3 or Chrome 4.1.249.1064 (45376). I did notice a mistake with the data being returned (the developer is returning a collection of data, even for queries that will always return a single record), but it still baffles me why it doesn't work in other browsers. It might be important to note that I am working from an HTML file on my local file system. I thought it might be a XSS issue, but that doesn't explain why Flickr works.

  Read the article

• Tag Cloud JS + Flash. Actual Tags In Cloud Not Clickable?

  - by Alex

  Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("some/swfObject/url", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); } </script>

  Read the article

• jQuery toggling divs, expand collapse all and keep first item selected when page loads

  - by hollyb

  Hi, I have a question about some functionality I'm trying to add to my jQuery to enable a button or text to expand/contract all the divs on click... and I'd like to figure out how to keep the first div open when the page loads. Here is the jQuery: (document).ready(function(){ //Hides containers on load $(".toggle_container").hide(); //Switch "Open" and "Close" state on click $("h2.trigger").toggle(function(){ $(this).addClass("active"); }, function () { $(this).removeClass("active"); }); //Slide up and down on click $("h2.trigger").click(function(){ $(this).next(".toggle_container").slideToggle("slow"); }); }); And the css: // uses a background image with an on (+) and off (-) state stacked on top of each other h2.trigger { background: url(buttonBG.gif) no-repeat;height: 46px;line-height: 46px;width: 300px;font-size: 2em;font-weight: normal;} h2.trigger a {color: #fff;text-decoration: none; display: block;} h2.active {background-position: left bottom;} .toggle_container { overflow: hidden; } .toggle_container .block {padding: 20px;} And the html <h2 class="trigger"><a href="#">Heading</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> <h2 class="trigger"><a href="#">Heading 2</a></h2> <div class="toggle_container"> <div class="block">Stuff goes here</div> </div> So it works great and looks great. However, when I try to get it to keep the first instance open, the background image that should adjust show the (-) state doesn't change. The code I used to this was: $(".toggle_container:first").show(); So, my question is, does anyone know of an easier way to show the first instance of this as open without having to created specials rules/class for the first item? Also, any ideas about how to make an open all/close all link? Thanks!

  Read the article

• Sliding panel in the middle of the page. Z-index given not working

  - by Nehal Rupani

  Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Search row with highest number of cells in a row with colspan

  - by user593029

  What is the efficient way to search highest number of cells in big table with numerous colspan (merge cells ** colspan should be ignored so in below example highest number of cells is 4 in first row). Is it js/jquery with reg expression or just the loop with bubble sorting. I got one link as below explainig use of regex is it ideal way ... can someone suggest pseudo code for this. High cpu consumption due to a jquery regex patch <table width="156" height="84" border="0" > <tbody> <tr style="height:10px"> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px" colspan="2"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px" colspan="2"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px" colspan="2"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> </tbody> </table>

  Read the article

• xml append issue in ie,chrome

  - by 3gwebtrain

  Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

  Read the article

• session management: problem displaying username in the header

  - by aeonsleo

  hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

  Read the article

• CodeIgniter Third party class not loading

  - by Jatin Soni

  I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

  Read the article

• Can this be imporved? Scrubing of dangerous html tags.

  - by chobo2

  Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

  Read the article

• Simple html page using Bootstrap

  - by Athashri

  I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

  Read the article

< Previous Page | 702 703 704 705 706 707 708 709 710 711 712 713  | Next Page >