Search Results

Search found 15743 results on 630 pages for 'js is bad'.

Page 72/630 | < Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • Is this bad coding practice?

    - by user566540
    I'm using PC-lint to analyze my code and theese lines are generating several errors. That makes me wonder if my coding pratice is wrong? char *start; char *end; // Extract the phone number start = (char*) (strchr(data, '\"') +1); end = (char*) strchr(start, '\"'); *end = 0; strlcpy((char*)Fp_smsSender, start , start-(end-1)); EDIT: After your help i now have: char *start; char *end; if (data != NULL) { // Extract the phone number start = strchr(data, '\"'); if (start != NULL) { ++start; end = strchr(start, '\"'); if (end != NULL) { *end = 0; strlcpy((char*)Fp_smsSender, start , FP_MAX_PHONE); } } How does that look?

    Read the article

  • Alligator tags(<% %>) inside js string?

    - by bangoker
    I am trying to redirect a page reading the url from the config file. However, when I try this: <script type="text/javascript"> <%string redirectUrl = System.Web.Configuration.WebConfigurationManager.AppSettings["RedirectURL"];%> window.parent.location.replace("<%=redirectUrl%>"); </script> the alligator tags <% % are Not being highlighted, and when I run I get the following error in the yellow screen: the controls collection cannot be modified because the control contains code blocks (i.e. <% ... %>). What am I doing wrong?? Thanks!

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Feedback + Bad output

    - by user1770094
    So I've got an assignment I think I'm more or less done with, but there is something which is messing up the output badly somewhere down the line, or even the calculation, and I don't see where the problem is. The assignment is to make a game in which a certain ammount of players run up through a tunnel towards a spot,where they will stop and spin around it,and then their dizziness is supposed to make them randomly either progress towards goal or regress back towards start.And each time they get another spot closer to goal,they get another "marking",and it goes on like this until one of them reaches goal. The program includes three files: one main.cpp,one header file and another cpp file. The header file: #ifndef COMPETITOR_H #define COMPETITOR_H #include <string> using namespace std; class Competitor { public: void setName(); string getName(); void spin(); void move(); int checkScore(); void printResult(); private: string name; int direction; int markedSpots; }; #endif // COMPETITOR_H The second cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void Competitor::setName() { cin>>name; } string Competitor::getName() { return name; } void Competitor::spin() { srand(time(NULL)); direction = rand()%1+0; } void Competitor::move() { if(direction == 1) { markedSpots++; } else if(direction == 0 && markedSpots != 0) { markedSpots--; } } int Competitor::checkScore() { return markedSpots; } void Competitor::printResult() { if(direction == 1) { cout<<" is heading towards goal and has currently "<<markedSpots<<" markings."; } else if(direction == 0) { cout<<"\n"<<getName()<<" is heading towards start and has currently "<<markedSpots<<" markings."; } } The main cpp file: #include <iostream> #include <string> #include <cstdlib> #include <ctime> #include "Competitor.h" using namespace std; void inputAndSetNames(Competitor comps[],int nrOfComps); void makeTwist(Competitor comps[],int nrOfComps); void makeMove(Competitor comps[],int nrOfComps); void showAll(Competitor comps[],int nrOfComps); int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces); int main() { int nrOfTwistPlaces; int nrOfComps; int noWinner = -1; int laps = 0; cout<<"How many spinning places should there be? "; cin>>nrOfTwistPlaces; cout<<"How many competitors should there be? "; cin>>nrOfComps; Competitor * comps = new Competitor[nrOfComps]; inputAndSetNames(comps, nrOfComps); do { laps++; cout<<"\nSpin "<<laps<<":"; makeTwist(comps, nrOfComps); makeMove(comps, nrOfComps); showAll(comps, nrOfComps); }while(noWinner == -1); delete [] comps; return 0; } void inputAndSetNames(Competitor comps[],int nrOfComps) { cout<<"Type in the names of the "<<nrOfComps<<" competitors:\n"; for(int i=0;i<nrOfComps;i++) { comps[i].setName(); } cout<<"\n"; } void makeTwist(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].spin(); } } void makeMove(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].move(); } } void showAll(Competitor comps[],int nrOfComps) { for(int i=0;i<nrOfComps;i++) { comps[i].printResult(); } cout<<"\n\n"; system("pause"); } int winner(Competitor comps[],int nrOfComps, int nrOfTwistPlaces) { int end = 0; int score = 0; for(int i=0;i<nrOfComps;i++) { score = comps[i].checkScore(); if(score == nrOfTwistPlaces) { end = 1; } else end = -1; } return end; } I'd be grateful if you would point out other mistakes if you see any.Thanks in advance.

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • EXC_BAD_ACCESS iPhone Development

    - by gkres121
    Sorry, this could be a simple fix, as I am new to iPhone Development. In my Delegate, after pressing the create profile button, the create profile view is pushed: -(void) createProfile_clicked:(id)sender { AddNewProfile *create = [[AddNewProfile alloc] init]; [self.window addSubview:create.view]; [self invisibleCreateProfileBar]; AddNewProfile *controller = [[AddNewProfile alloc] initWithNibName:@"AddNewProfile" bundle:[NSBundle mainBundle]]; [ self.navigationController pushViewController:controller animated:YES ]; currentController=controller; } Then in the AddNewProfile.m: - (IBAction)backgroundTap:(id)sender { if([nameField isFirstResponder]){ [nameField resignFirstResponder]; } if([ageField isFirstResponder]){ [ageField resignFirstResponder]; } if([doctorNameField isFirstResponder]){ [doctorNameField isFirstResponder]; } if([doctorNumberField isFirstResponder]){ [doctorNumberField resignFirstResponder]; } } This leads to a exc_bad_access error every time the FirstResponder is ever messed with, with any of my controls. I can select a control(text box), but once I click out of one, it crashes. Any help would be greatly appreciated.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • JS regular expression to find a substring surrounded by double quotes

    - by 2619
    I need to find a substring surrounded by double quotes, for example, like "test", "te\"st" or "", but not """ neither "\". To achieve this, which is the best way to go for it in the following 1) /".*"/g 2) /"[^"\\]*(?:\\[\S\s][^"\\]*)*"/g 3) /"(?:\\?[\S\s])*?"/g 4) /"([^"\\]*("|\\[\S\s]))+/g I was asked this question yesterday during an interview, and would like to know the answer for future reference.

    Read the article

  • ActionScript JPGEncoder +bad quality of the image

    - by Alex
    I have noticed that the quality of the images produced by the JPEGEncoder does not match that of other encoders available (i.e. php's built in image compression functions from the gd library) Any explanation ? or hints/workarounds for improving the quality of compressed images by JPEGEncoder ??

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • How can I get the Forever to write to a different log file every day?

    - by user1438940
    I have a cluster of production servers running a Node.JS app via Forever. As far as I can tell, my options for log files are as follows: Let Forever do it on its own, in which case it will log to ~/.forever/XXXX.log Specify one specific log file for the entire life of the process What I'd like to do, however, is have it log to a different file every day. eg. 20121027.log, 20121028.log, etc. Is this possible? If so, how can it be done?

    Read the article

  • Are instance initializers good or bad?

    - by berry120
    I personally quite like instance initializers - I use them to assign default values to things such as collections so when writing constructors I don't have to remember to assign them the same default values each time. It seems quite elegant to me - avoids annoying NPE's popping up and avoids duplicate code. A private method doesn't seem as nice because a) it can't assign values to final fields, b) it could be run elsewhere in code and c) the method still needs to be explicitly called at the start of each constructor. However, the flip side with others I have spoken to is that they're confusing, some people reading the code might not understand what they do or when they're called and thus they could cause more problems than they solve. Are proper use of these initializers something to be encouraged or avoided? Or is it an "each to their own" case?

    Read the article

  • Are bad backlinks causing thousands of 404 and 410 errors in webmaster tools?

    - by Natália
    Our webmaster tools account is showing 250.000 errors related with weird links from other sites. These URLs are comming mostly from non existent sites or are being generated directly by our website. Here some examples of these URLs: oursite.com/&q=videos+caseros+sexo+pornos+gratis&sa=X&ei=R638T8eTO8WphAfF2vG8Bg&ved=0CCAQFjAC%2F%2Fpage%2F2%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F4%2Fpage%2F5%2Fpage%2F4/page/3 Our site is a popular spanish adult site, yet we don´t have keywords which are being mentioned in this URL. Apparently this link comes from our site. Some more examples: oursite.com/&q=losmejoresvideosporno&sa=X&ei=U__8T-BnqK7RBdjmhYsH&ved=0CBUQFjAA%2F%2Fpage%2F2%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3/page/4 Once again: not our queries, not out URLs. oursite/tag/tetonas We think that it might be other site, which is having a policy of extremely bad SEO based on other sites branding and keywords usage: thirdsite/buscador/tetonas-oursite The question is: if other sites are generating these URLs, how can we prevent this? Why the tag is being generated if no link was added to the other site? What should we do with these errors? 301? 410 gone? I have read all similar Q&A here but none of them seems to solve our problem. It is not likely to be a bad ad (Inspected them all). Maybe some all content which google decided to recrawl suddenly? Maybe third parties bad SEO policy? Maybe all of them?

    Read the article

  • 250 k 404 & 410 errors in Webmaster Tools. Bad backlinks?

    - by Natália
    Our webmaster tools account is showing 250.000 errors related with weird links from other sites. These URLs are comming mostly from non existent sites or are being generated directly by our website. Here some examples of these urls: oursite.com/&q=videos+caseros+sexo+pornos+gratis&sa=X&ei=R638T8eTO8WphAfF2vG8Bg&ved=0CCAQFjAC%2F%2Fpage%2F2%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F4%2Fpage%2F5%2Fpage%2F4/page/3 Our site is a popular spanish adult site, yet we don´t have keywords which are being mentioned in this url. Apparently this link comes from our site. Some more examples: oursite.com/&q=losmejoresvideosporno&sa=X&ei=U__8T-BnqK7RBdjmhYsH&ved=0CBUQFjAA%2F%2Fpage%2F2%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3%2Fpage%2F4%2Fpage%2F3%2Fpage%2F2%2Fpage%2F3/page/4 Once again: not our queries, not out urls. oursite/tag/tetonas We think that it might be other site, which is having a policy of extremely bad SEO based on other sites branding and keywords usage: thirdsite/buscador/tetonas-oursite The question is: if other sites are generating these urls, how can we prevent this? Why the tag is being generated if no link was added to the other site? What should we do with these errors? 301? 410 gone? I have read all similar Q&A here but none of them seems to solve our problem. It is not likely to be a bad ad (Inspected them all). Maybe some all content which google decided to recrawl suddenly? Maybe third parties bad SEO policy? Maybe all of them? Any help will be higly appreciated,

    Read the article

< Previous Page | 68 69 70 71 72 73 74 75 76 77 78 79  | Next Page >