Search Results

Search found 41660 results on 1667 pages for 'mike two'.

Page 726/1667 | < Previous Page | 722 723 724 725 726 727 728 729 730 731 732 733  | Next Page >

  • Are +=, |=, &= etc atomic?

    - by SF.
    Are the "modify" operators like +=, |=, &= etc atomic? I know ++ is atomic (if you perform x++; in two different threads "simultaneously", you will always end up with x increased by 2, as opposed to x=x+1 with optimization switched off.) What I wonder is whether variable |= constant, and the likes are thread-safe or do I have to protect them with a mutex? (...or is it CPU-dependent? In this case, how is it on ARM?)

    Read the article

  • disable horizontal scrolling by finger swipe

    - by codelove
    This may just be a mac issue, but I have a page with an element which is twice the size of the page and is moved into view dynamically. in my css I have overflow-x:hidden set so that this element won't create an ugly bottom scollbar, the problem is on my laptop (and probably on ipads and other devices) I can just swipe with two fingers to scroll and view this content. This breaks the whole layout and looks really bad, and I am looking for a way to completely disable this horizontal scrolling action with javascript or css. Thank you

    Read the article

  • How to update NSMutableDictionary. My code doesn't work.

    - by dawatson833
    I've populated an array using. arrSettings = [[NSMutableArray alloc] initWithContentsOfFile:[self settingsPath]]; The file is a plist with the root as an array and then a dictionary with three three keys defined as number. I've also tried setting the keys to string. I display the values in the plist file on a view using. diaper = [[arrSettings objectAtIndex:0] objectForKey:@"Diaper Expenses"]; oil = [[arrSettings objectAtIndex:0] objectForKey:@"Oil Used"]; tree = [[arrSettings objectAtIndex:0] objectForKey:@"Wood Used"]; This code works fine, the values in the dictionary are assigned to the variables and they are displayed. The user can make changes and then press a save button. I use this code to extract the dictionary part of the array so I can update it. The assignment to editDictionary works. I've double checked the key names including case and that is correct. editDictionary = [[NSMutableDictionary alloc] init]; editDictionary = [arrSettings objectAtIndex:0]; NSNumber *myNumber = [NSNumber numberWithFloat:diaperAmount]; [editDictionary setValue:myNumber forKey:@"Diaper Expenses"]; myNumber = [NSNumber numberWithFloat:oilAmount]; [editDictionary setValue:myNumber forKey:@"Oil Used"]; myNumber = [NSNumber numberWithFloat:treeAmount]; [editDictionary setValue:myNumber forKey:@"Wood Used"]; In this example I've used a nsnumber. But I've also tried the xxxAmount field as part of SetValue instead of creating a NSNumber. Neither implementation works. Several strange things happen. Sometimes the first two setvalue statements work, but the last setvalue fails with a EXC_BAD_ACCESS failure. Other times the first setValue fails with the same error. I have no idea why the first two sometimes work. I'm at a loss of what to do next. I've tried several implentations and none of them work. Also, in the debugger how can I display the editDictionary elements. I can see editDictionary, but I don't know how to display the individual elements.

    Read the article

  • Hierarchy inheritance

    - by reito
    I had faced the problem. In my C++ hierarchy tree I have two branches for entities of difference nature, but same behavior - same interface. I created such hierarchy trees (first in image below). And now I want to work with Item or Base classes independetly of their nature (first or second). Then I create one abstract branch for this use. My mind build (second in image below). But it not working. Working scheme seems (third in image below). It's bad logic, I think... Do anybody have some ideas about such hierarchy inheritance? How make it more logical? More simple for understanding? Image Sorry for my english - russian internet didn't help:) Update: You ask me to be more explicit, and I will be. In my project (plugins for Adobe Framemaker) I need to work with dialogs and GUI controls. In some places I working with WinAPI controls, and some other places with FDK (internal Framemaker) controls, but I want to work throw same interface. I can't use one base class and inherite others from it, because all needed controls - is a hierarchy tree (not one class). So I have one hierarchy tree for WinAPI controls, one for FDK and one abstract tree to use anyone control. For example, there is an Edit control (WinEdit and FdkEdit realization), a Button control (WinButton and FdkButton realization) and base entity - Control (WinControl and FdkControl realization). For now I can link my classes in realization trees (Win and Fdk) with inheritence between each of them (WinControl is base class for WinButton and WinEdit; FdkControl is base class for FdkButton and FdkEdit). And I can link to abstract classes (Control is base class for WinControl and FdkControl; Edit is base class for WinEdit and FdkEdit; Button is base class for WinButton and FdkButton). But I can't link my abstract tree - compiler swears. In fact I have two hierarchy trees, that I want to inherite from another one. Update: I have done this quest! :) I used the virtual inheritence and get such scheme (http://img12.imageshack.us/img12/7782/99614779.png). Abstract tree has only absolute abstract methods. All inheritence in abstract tree are virtual. Link from realization tree to abstract are virtual. On image shown only one realization tree for simplicity. Thanks for help!

    Read the article

  • Eclipse plugin using actionset which will prompt a window for selection,how to do??

    - by Rahul
    *In eclipse plugin using actionSet Here blue icon for some code(using actionset) ,when i click on that it should prompt a window(some popup) which contains two or more link like web links, when i click 1st link it should perform the 1st action and window should disappear so on...Can anyone help me in this how to do that??? See the picture below for reference ..like this with ok button ok should perform the selected action plz help me to do this...??

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Consolidating Columns in Excel

    - by New to iPhone
    I have two columns in excel like the following a,apple a,bannana a,orange a,plum b,apple b,berry b,orange b,grapefruit c,melon c,berry c,kiwi I need to consolidate them like this on a different sheet a,apple,bannana,orange,plum b,apple,berry,orange,grapefruit c,melon,berry,kiwi Any help would be appreciated

    Read the article

  • looping through variable post vars and adding them to the database

    - by Neil Hickman
    I have been given the task of devising a custom forms manager that has a mysql backend. The problem I have now encountered after setting up all the front end, is how to process a form that is dynamic. For E.G Form one could contain 6 fields all with different name attributes in the input tag. Form two could contain 20 fields all with different name attributes in the input tag. How would i process the forms without using up oodles of resource.

    Read the article

  • Why GLatLng() doesn't receive variables?

    - by David
    Hi, i have the following code to update a google map: function updateit(c1,c2){ alert(c1+"-"+c2); // This works map.setCenter(new GLatLng(c1, c2), 13); // But this doesn't } updateit(37.4419, -122.1419); The alert is working and show the two coordinations, but i think the GLatLng() doesn't receive them, so the map is not updated unless i directly declare them as strings : function updateit(c1,c2){ map.setCenter(new GLatLng(37.4419, -122.1419), 13); // This works } How to fix this problem? Thanks

    Read the article

  • Is there a MergedGradientBrush in wpf?

    - by AKRamkumar
    Suppose I had two brushes. One that was a linear gradient brush that was from Dark to light One was a radial brush that went from Dark to light. How could I merge the brushes so that when I apply them, I can apply both at once. EG Check this: 1) http://www.codeproject.com/KB/vista/WindowsVistaRenderer/VistaRenderer4.gif 2) http://www.codeproject.com/KB/vista/WindowsVistaRenderer/VistaRenderer5.gif How could I (In WPF/XAML) merge both into one gradient and then refer to that? (This is Mr. Menendez's Images from Codeproject)

    Read the article

  • Trying to keep filled bars in a faceted plot

    - by John Horton
    Not sure what I'm doing wrong here. I have this plot: ggplot(data.PE5, aes(ybands,fill=factor(decide))) + geom_bar(position="dodge") which produces: Then I want to facet by a factor, creating two stacked plots w/ dodged, colored bars ggplot(data.PE5, aes(ybands,fill=factor(decide))) + geom_bar(position="dodge") + facet_grid(~group_label) However, I lose the factor-based coloring, which I want to keep:

    Read the article

  • ServerAlias * problem

    - by nyrox
    I have 3 websites on a dedicate server (with cent os and Plesk control panel) and one of these websites must ServerAlias * when I try this in httpd.include , other two websites alias on mastersite.com but I dont want this i solved it with dedicated ip , but now I want do it with one ip <VirtualHost xx.xx.xx.xx:80> ServerName mastersite.com:80 ServerAlias * UseCanonicalName Off SuexecUserGroup .. .. .. sorry for my English

    Read the article

  • How can char* be a condition in for loop?

    - by Jackie
    In a book I am reading there is a piece of code : string x; size_t h=0; for(const char* s=x.ctr();*s;++s) h=(h*17)^*s; Regarding this code, I have two questions: how can *s be a condition? what does it mean? what does "h=(h*17)^*s" mean? Thanks for help!

    Read the article

  • C++: Unknown pointer size when forward declaring (error C2036)

    - by Rosarch
    In a header file, I have forward declared two members of a namespace: namespace Foo { struct Odp typedef std::vector<Odp> ODPVEC; }; class Bar { public: Foo::ODPVEC baz; // C2036 }; The error generated by the compiler is: error C2036: 'Foo::Odp *': unknown size I'm guessing this is an issue with forward declaring Odp. How can I get around this?

    Read the article

  • How can I pin a div in my sidebar column to the bottom?

    - by vg1890
    I have a simple two column layout with a footer at the bottom. When the content in the sidebar is taller than the content in the main column, everything looks great. But when the height of the main column is greater than the sidebar, I need the sidebar to grow to the same height as the main column and for the last <div> in the sidebar to be pinned to the very bottom. Here's my sample code: http://jsfiddle.net/mqnML/1/

    Read the article

  • How can I tweak this elisp function to distinguish between C-d & DEL?

    - by Fletcher Moore
    Here's my current function (blindly copy-pasted from a website) (defun tweakemacs-delete-one-line () "Delete current line." (interactive) (beginning-of-line) (kill-line) (kill-line)) (global-set-key (kbd "C-d") 'tweakemacs-delete-one-line) There are two quirks here that I want to get rid of. 1) This actually rebinds DEL to the same function. I want my DEL to remain "delete one character". 2) There needs to be a condition where it will not double-kill if the line is only a newline character.

    Read the article

  • Git branch unknown to local clone

    - by Rimian
    I have a git repository with two branches. If I clone my repo I can only see the master branch. I have both branches up to date. The problem is I don't fully understand merging and branching. Darn it! My example can be seen here: http://github.com/rimian/rimian/network Can anyone tell me how to get this back to normal?

    Read the article

  • How to select all parent objects into DataContext using single LINQ query ?

    - by too
    I am looking for an answer to a specific problem of fetching whole LINQ object hierarchy using single SELECT. At first I was trying to fill as much LINQ objects as possible using LoadOptions, but AFAIK this method allows only single table to be linked in one query using LoadWith. So I have invented a solution to forcibly set all parent objects of entity which of list is to be fetched, although there is a problem of multiple SELECTS going to database - a single query results in two SELECTS with the same parameters in the same LINQ context. For this question I have simplified this query to popular invoice example: public static class Extensions { public static IEnumerable<T> ForEach<T>(this IEnumerable<T> collection, Action<T> func) { foreach(var c in collection) { func(c); } return collection; } } public IEnumerable<Entry> GetResults(AppDataContext context, int CustomerId) { return ( from entry in context.Entries join invoice in context.Invoices on entry.EntryInvoiceId equals invoice.InvoiceId join period in context.Periods on invoice.InvoicePeriodId equals period.PeriodId // LEFT OUTER JOIN, store is not mandatory join store in context.Stores on entry.EntryStoreId equals store.StoreId into condStore from store in condStore.DefaultIfEmpty() where (invoice.InvoiceCustomerId = CustomerId) orderby entry.EntryPrice descending select new { Entry = entry, Invoice = invoice, Period = period, Store = store } ).ForEach(x => { x.Entry.Invoice = Invoice; x.Invoice.Period = Period; x.Entry.Store = Store; } ).Select(x => x.Entry); } When calling this function and traversing through result set, for example: var entries = GetResults(this.Context); int withoutStore = 0; foreach(var k in entries) { if(k.EntryStoreId == null) withoutStore++; } the resulting query to database looks like (single result is fetched): SELECT [t0].[EntryId], [t0].[EntryInvoiceId], [t0].[EntryStoreId], [t0].[EntryProductId], [t0].[EntryQuantity], [t0].[EntryPrice], [t1].[InvoiceId], [t1].[InvoiceCustomerId], [t1].[InvoiceDate], [t1].[InvoicePeriodId], [t2].[PeriodId], [t2].[PeriodName], [t2].[PeriodDateFrom], [t4].[StoreId], [t4].[StoreName] FROM [Entry] AS [t0] INNER JOIN [Invoice] AS [t1] ON [t0].[EntryInvoiceId] = [t1].[InvoiceId] INNER JOIN [Period] AS [t2] ON [t2].[PeriodId] = [t1].[InvoicePeriodId] LEFT OUTER JOIN ( SELECT 1 AS [test], [t3].[StoreId], [t3].[StoreName] FROM [Store] AS [t3] ) AS [t4] ON [t4].[StoreId] = ([t0].[EntryStoreId]) WHERE (([t1].[InvoiceCustomerId]) = @p0) ORDER BY [t0].[InvoicePrice] DESC -- @p0: Input Int (Size = 0; Prec = 0; Scale = 0) [186] -- Context: SqlProvider(Sql2008) Model: AttributedMetaModel Build: 3.5.30729.1 SELECT [t0].[EntryId], [t0].[EntryInvoiceId], [t0].[EntryStoreId], [t0].[EntryProductId], [t0].[EntryQuantity], [t0].[EntryPrice], [t1].[InvoiceId], [t1].[InvoiceCustomerId], [t1].[InvoiceDate], [t1].[InvoicePeriodId], [t2].[PeriodId], [t2].[PeriodName], [t2].[PeriodDateFrom], [t4].[StoreId], [t4].[StoreName] FROM [Entry] AS [t0] INNER JOIN [Invoice] AS [t1] ON [t0].[EntryInvoiceId] = [t1].[InvoiceId] INNER JOIN [Period] AS [t2] ON [t2].[PeriodId] = [t1].[InvoicePeriodId] LEFT OUTER JOIN ( SELECT 1 AS [test], [t3].[StoreId], [t3].[StoreName] FROM [Store] AS [t3] ) AS [t4] ON [t4].[StoreId] = ([t0].[EntryStoreId]) WHERE (([t1].[InvoiceCustomerId]) = @p0) ORDER BY [t0].[InvoicePrice] DESC -- @p0: Input Int (Size = 0; Prec = 0; Scale = 0) [186] -- Context: SqlProvider(Sql2008) Model: AttributedMetaModel Build: 3.5.30729.1 The question is why there are two queries and how can I fetch LINQ objects without such hacks?

    Read the article

  • implementing proxy support in C, is there any library for that?

    - by Sabya
    Hi, I want to implement proxy support in my application. There are two parts that needs to be implemented: Detection of proxy details (protocol, host, port): I am using libproxy for that. Connecting to the the proxy server and telling it to relay the packets. Get the connected socket and then use it in your application. Is there library for the #2 part?

    Read the article

< Previous Page | 722 723 724 725 726 727 728 729 730 731 732 733  | Next Page >