variable length - Page 728

IE browser caching and the jQuery Form Plugin

- by Harfleur

Like so many lost souls before me, I'm floundering in the snake pit that is Ajax form submission and IE browser caching. I'm trying to write a simple script using the jQuery Form Plugin to Ajaxify Wordpress comments. It's working fine in Firefox, Chrome, Safari, et. al., but in IE, the response text is cached with the result that Ajax is pulling in the wrong comment. jQuery(this).ajaxSubmit({ success: function(data) { var response = $("<ol>"+data+"</ol>"); response.find('.commentlist li:last').hide().appendTo(jQuery('.commentlist')).slideDown('slow'); } }); ajaxSubmit sends the comment to wp-comments-post.php, which inelegantly spits back the entire page as a response. So, despite the fact that it's ugly as toads, I'm sticking the response text in a variable, using :last to isolate the most recent comment, and sliding it down in its place. IE, however, is returning the cached version of the page, which doesn't include the new comment. So ".commentlist li:last" selects the previous comment, a duplicate of which then uselessly slides down beneath the original. I've tried setting "cache: false" in the ajaxSubmit options, but it has no effect. I've tried setting a url option and tacking on a random number or timestamp, but it winds up being attached to the POST that submits the comment to the server rather than the GET that returns the response, and so has no effect. I'm not sure what else to try. Everything works fine in IE if I turn off browser caching, but that's obviously not something I can expect anyone viewing the page to do. Any help will be hugely appreciated. Thanks in advance! EDIT WITH A PROGRESS REPORT: A couple of people have suggested using PHP headers to prevent caching, and this does indeed work. The trouble is that wp-comments-post is spitting back the entire page when a new comment is submitted, and the only way I can see to add headers is to put them in the Wordpress post template, which disables caching on all posts at all times--not quite the behavior I'm looking for. Is there a way to set a php conditional--"if is_ajax" or something like that--that would keep the headers from being applied during regular pageloads, but plug them in if the page was called by an Ajax GET?

Read the article

When is ¦ not equal to ¦?

- by Trey Jackson

Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

Read the article

Basic Custom String Class for C++

- by wdow88

Hey all, I'm working on building my own string class with very basic functionality. I am having difficulty understand what is going on with the basic class that I have define, and believe there is some sort of error dealing with the scope occurring. When I try to view the objects I created, all the fields are described as (obviously bad pointer). Also, if I make the data fields public or build an accessor method, the program crashes. For some reason the pointer for the object is 0xccccccccc which points to no where. How can a I fix this? Any help/comments are much appreciated. //This is a custom string class, so far the only functions are //constructing and appending #include<iostream> using namespace std; class MyString1 { public: MyString1() { //no arg constructor char *string; string = new char[0]; string[0] ='\0'; std::cout << string; size = 1; } //constructor receives pointer to character array MyString1(char* chars) { int index = 0; //Determine the length of the array while (chars[index] != NULL) index++; //Allocate dynamic memory on the heap char *string; string = new char[index+1]; //Copy the contents of the array pointed by chars into string, the char array of the object for (int ii = 0; ii < index; ii++) string[ii] = chars[ii]; string[index+1] = '\0'; size = index+1; } MyString1 append(MyString1 s) { //determine new size of the appended array and allocate memory int newsize = s.size + size; MyString1 MyString2; char *newstring; newstring = new char[newsize+1]; int index = 0; //load the first string into the array while (string[index] != NULL) { newstring[index] = string[index]; index++; } //load the second string while (s.string[index] != NULL) { newstring[index] = s.string[index]; index++; } //null terminate newstring[newsize+1] = '\0'; delete string; //generate the object for return MyString2.string=newstring; MyString2.size=newsize; return MyString2; } private: char *string; int size; }; int main() { MyString1 string1; MyString1 string2("Hello There"); MyString1 string3("Buddy"); string2.append(string3); return 0; }

Read the article

How to define and work with an array of bits in C?

- by Eddy

I want to create a very large array on which I write '0's and '1's. I'm trying to simulate a physical process called random sequential adsorption, where units of length 2, dimers, are deposited onto an n-dimensional lattice at a random location, without overlapping each other. The process stops when there is no more room left on the lattice for depositing more dimers (lattice is jammed). Initially I start with a lattice of zeroes, and the dimers are represented by a pair of '1's. As each dimer is deposited, the site on the left of the dimer is blocked, due to the fact that the dimers cannot overlap. So I simulate this process by depositing a triple of '1's on the lattice. I need to repeat the entire simulation a large number of times and then work out the average coverage %. I've already done this using an array of chars for 1D and 2D lattices. At the moment I'm trying to make the code as efficient as possible, before working on the 3D problem and more complicated generalisations. This is basically what the code looks like in 1D, simplified: int main() { /* Define lattice */ array = (char*)malloc(N * sizeof(char)); total_c = 0; /* Carry out RSA multiple times */ for (i = 0; i < 1000; i++) rand_seq_ads(); /* Calculate average coverage efficiency at jamming */ printf("coverage efficiency = %lf", total_c/1000); return 0; } void rand_seq_ads() { /* Initialise array, initial conditions */ memset(a, 0, N * sizeof(char)); available_sites = N; count = 0; /* While the lattice still has enough room... */ while(available_sites != 0) { /* Generate random site location */ x = rand(); /* Deposit dimer (if site is available) */ if(array[x] == 0) { array[x] = 1; array[x+1] = 1; count += 1; available_sites += -2; } /* Mark site left of dimer as unavailable (if its empty) */ if(array[x-1] == 0) { array[x-1] = 1; available_sites += -1; } } /* Calculate coverage %, and add to total */ c = count/N total_c += c; } For the actual project I'm doing, it involves not just dimers but trimers, quadrimers, and all sorts of shapes and sizes (for 2D and 3D). I was hoping that I would be able to work with individual bits instead of bytes, but I've been reading around and as far as I can tell you can only change 1 byte at a time, so either I need to do some complicated indexing or there is a simpler way to do it? Thanks for your answers

Read the article

Using JSON Data to Populate a Google Map with Database Objects

- by MikeH

I'm revising this question after reading the resources mentioned in the original answers and working through implementing it. I'm using the google maps api to integrate a map into my Rails site. I have a markets model with the following columns: ID, name, address, lat, lng. On my markets/index view, I want to populate a map with all the markets in my markets table. I'm trying to output @markets as json data, and that's where I'm running into problems. I have the basic map displaying, but right now it's just a blank map. I'm following the tutorials very closely, but I can't get the markers to generate dynamically from the json. Any help is much appreciated! Here's my setup: Markets Controller: def index @markets = Market.filter_city(params[:filter]) respond_to do |format| format.html # index.html.erb format.json { render :json => @market} format.xml { render :xml => @market } end end Markets/index view: <head> <script type="text/javascript" src="http://www.google.com/jsapi?key=GOOGLE KEY REDACTED, BUT IT'S THERE" > </script> <script type="text/javascript"> var markets = <%= @markets.to_json %>; </script> <script type="text/javascript" charset="utf-8"> google.load("maps", "2.x"); google.load("jquery", "1.3.2"); </script> </head> <body> <div id="map" style="width:400px; height:300px;"></div> </body> Public/javascripts/application.js: function initialize() { if (GBrowserIsCompatible() && typeof markets != 'undefined') { var map = new GMap2(document.getElementById("map")); map.setCenter(new GLatLng(40.7371, -73.9903), 13); map.addControl(new GLargeMapControl()); function createMarker(latlng, market) { var marker = new GMarker(latlng); var html="<strong>"+market.name+"</strong><br />"+market.address; GEvent.addListener(marker,"click", function() { map.openInfoWindowHtml(latlng, html); }); return marker; } var bounds = new GLatLngBounds; for (var i = 0; i < markets.length; i++) { var latlng=new GLatLng(markets[i].lat,markets[i].lng) bounds.extend(latlng); map.addOverlay(createMarker(latlng, markets[i])); } } } window.onload=initialize; window.onunload=GUnload;

Read the article

Trying to filter a ListView with runQueryOnBackgroundThread but nothing happens - what am I missing?

- by Ian Leslie

I have a list of countries in a database. I have created a select country activity that consists of a edit box for filtering and a list which displays the flag and country name. When the activity starts the list shows the entire list of countries sorted alphabetically - works fine. When the customer starts typing into the search box I want the list to be filtered based on their typing. My database query was previously working in an AutoCompleteView (I just want to switch to a separate text box and list) so I know my full query and my constraint query are working. What I did was add a TextWatcher to the EditText view and every time the text is changed I invoke the list's SimpleCursorAdapter runQueryOnBackgroundThread with the edit boxes text as the constraint. The trouble is the list is never updated. I have set breakpoints in the debugger and the TextWatcher does make the call to runQueryOnBackgroundThread and my FilterQueryProvider is called with the expected constraint. The database query goes fine and the cursor is returned. The cursor adapter has a filter query provider set (and a view binder to display the flag): SimpleCursorAdapter adapter = new SimpleCursorAdapter (this, R.layout.country_list_row, countryCursor, from, to); adapter.setFilterQueryProvider (new CountryFilterProvider ()); adapter.setViewBinder (new FlagViewBinder ()); The FitlerQueryProvider: private final class CountryFilterProvider implements FilterQueryProvider { @Override public Cursor runQuery (CharSequence constraint) { Cursor countryCursor = myDbHelper.getCountryList (constraint); startManagingCursor (countryCursor); return countryCursor; } } And the EditText has a TextWatcher: myCountrySearchText = (EditText)findViewById (R.id.entry); myCountrySearchText.setHint (R.string.country_hint); myCountrySearchText.addTextChangedListener (new TextWatcher() { @Override public void afterTextChanged (Editable s) { SimpleCursorAdapter filterAdapter = (SimpleCursorAdapter)myCountryList.getAdapter (); filterAdapter.runQueryOnBackgroundThread (s.toString ()); } @Override public void onTextChanged (CharSequence s, int start, int before, int count) { // no work to do } @Override public void beforeTextChanged (CharSequence s, int start, int count, int after) { // no work to do } }); The query for the database looks like this: public Cursor getCountryList (CharSequence constraint) { if (constraint == null || constraint.length () == 0) { // Return the full list of countries return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, null, null, null, null, KEY_COUNTRYNAME); } else { // Return a list of countries who's name contains the passed in constraint return myDataBase.query (DATABASE_COUNTRY_TABLE, new String[] { KEY_ROWID, KEY_COUNTRYNAME, KEY_COUNTRYCODE }, "Country like '%" + constraint.toString () + "%'", null, null, null, "CASE WHEN Country like '" + constraint.toString () + "%' THEN 0 ELSE 1 END, Country"); } } It just seems like there is a missing link somewhere. Any help would be appreciated. Thanks, Ian

Read the article

Problem setting row backgrounds in Android Listview

- by zchtodd

I have an application in which I'd like one row at a time to have a certain color. This seems to work about 95% of the time, but sometimes instead of having just one row with this color, it will allow multiple rows to have the color. Specifically, a row is set to have the "special" color when it is tapped. In rare instances, the last row tapped will retain the color despite a call to setBackgroundColor attempting to make it otherwise. private OnItemClickListener mDirectoryListener = new OnItemClickListener(){ public void onItemClick(AdapterView parent, View view, int pos, long id){ if (stdir.getStationCount() == pos) { stdir.moreStations(); return; } if (playingView != null) playingView.setBackgroundColor(Color.DKGRAY); view.setBackgroundColor(Color.MAGENTA); playingView = view; playStation(pos); } }; I have confirmed with print statements that the code setting the row to gray is always called. Can anyone imagine a reason why this code might intermittently fail? If there is a pattern or condition that causes it, I can't tell. I thought it might have something to do with the activity lifecycle setting the "playingView" variable back to null, but I can't reliably reproduce the problem by switching activities or locking the phone. private class DirectoryAdapter extends ArrayAdapter { private ArrayList<Station> items; public DirectoryAdapter(Context c, int resLayoutId, ArrayList<Station> stations){ super(c, resLayoutId, stations); this.items = stations; } public int getCount(){ return items.size() + 1; } public View getView(int position, View convertView, ViewGroup parent){ View v = convertView; LayoutInflater vi = (LayoutInflater)getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE); if (position == this.items.size()) { v = vi.inflate(R.layout.morerow, null); return v; } Station station = this.items.get(position); v = vi.inflate(R.layout.songrow, null); if (station.playing) v.setBackgroundColor(Color.MAGENTA); else if (station.visited) v.setBackgroundColor(Color.DKGRAY); else v.setBackgroundColor(Color.BLACK); TextView title = (TextView)v.findViewById(R.id.title); title.setText(station.name); return v; } };

Read the article

Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

- by Jack Roscoe

Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

Read the article

Using events in threads between processes - C

- by Jamie Keeling

Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occurred and I have started to implement this already. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Create thread: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'm trying to find out how I would integrate an event with the threaded code to signify to the other process that something has happened, I've seen an MSDN article on using events but it's just confused me if anything, I'm coming up on empty whilst searching on the internet too. Thanks for any help Edit: I can only use the Create/Set/Open methods for events, sorry for not mentioning it earlier.

Read the article

meteor mongodb _id changing after insert (and UUID property as well)

- by lommaj

I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

Read the article

What would you suggest as a high school first language?

- by ldigas

Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

Read the article

Change the size of the panel dynamically

- by C. Karunarathne

Hi! I am implementing an application that needs to drag and drop image boxes in a panel.Image boxes are added dynamically from the program and so I have set the autoscroll property to true in panel.But when I have drag out the boxes at bottom in the panel the panel size got reduced.I have put autosize property false in panel.The panel is docked in another panel.I want to set the size of panel at run time.How can I achieve this. public form1(int[,] dummy, int columnSize, int rowSize) { this.dummy= dummy; numOfColumns = columnSize; numOfRows = rowSize; getData(); addIds = addIdArray; data = mylist; InitializeComponent(); //panel1.MinimumSize = new Size(columnSize * 40, rowSize * 40); //panel1.Height = rowSize * 40; //panel1.Width = columnSize * 40; //panel4.Height = rowSize * 40; //panel4.Width = columnSize * 40; int x, y; Structures.EmptyRectSpace space = new Structures.EmptyRectSpace(); for (int i = 0; i < data.Count; i++)// set picture boxes { space = (Structures.EmptyRectSpace)data[i]; x = space.startingJ; y = space.startingI; int h, w; h = space.length; w = space.width; p = new PictureBox(); p.Width = w * 40; p.Height = h * 40; p.BackColor = Color.DarkGreen; p.Image = Properties.Resources.v; p.BorderStyle = BorderStyle.FixedSingle; p.Name = addIdArray[i].ToString(); p.Location = new Point((x + 1 - w) * 40, (y + 1 - h) * 40); this.panel1.Controls.Add(p); } foreach (Control c in this.panel1.Controls) { if (c is PictureBox) { c.MouseDown += new MouseEventHandler(pictureBox1_MouseDown); } } this.panel1.DragOver += new System.Windows.Forms.DragEventHandler(this.panel1_DragOver); panel1.DragOver += new DragEventHandler(panel1_DragOver); panel1.DragDrop += new DragEventHandler(panel1_DragDrop); panel1.AllowDrop = true; panel2.AllowDrop = true; foreach (Control c in this.panel2.Controls) { c.MouseDown += new MouseEventHandler(pictureBox1_MouseDown); } this.panel2.DragOver += new System.Windows.Forms.DragEventHandler(this.panel2_DragOver); panel2.DragOver += new DragEventHandler(panel2_DragOver); panel2.DragDrop += new DragEventHandler(panel2_DragDrop); } This is the constructor of the form that contained panel.When it loaded the picture boxes must be added to the panel and there drag drop events of panel are implemented. Please give me a helping hand..

Read the article

tablednd post issue help please

- by netrise

Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

Read the article

how to send parameters to a web Services via SOAP?

- by Alejandra Meraz

Before I start: I'm programming for Iphone, using objective C. I have already implemented a call to a web service function using NSURLRequest and NSURLConnection and SOAP. The function then returns a XML with the info I need. The code is as follows: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body>\n" "<function xmlns=\"http://tempuri.org/\" />\n" "</soap:Body>\n" "</soap:Envelope>\n"]; NSURL *url = [NSURL URLWithString:@"http://myHost.com/myWebService/service.asmx"]; //the url to the WSDL NsMutableURLRequest theRequest = [[NSMutableURLRequest alloc] initWithURL:url]; NSString *msgLength = [NSString stringWithFormat:@"%d",[soapMessage length]]; [theRequest addValue:@"text/xml; charset=utf-8" forHTTPHeaderField:@"Content-Type"]; [theRequest addValue:msgLength forHTTPHeaderField:@"Content-Lenght"]; [theRequest setHTTPMethod:@"POST"]; [theRequest addValue:@"myhost.com" forHTTPHeaderField:@"Host"]; [theRequest addValue:@"http://tempuri.org/function" forHTTPHeaderField:@"SOAPAction"]; [theRequest setHTTPBody:[soapMessage dataUsingEncoding:NSUTF8StringEncoding]]; theConnection = [[NSURLConnection alloc] initWithRequest:theRequest delegate:self]; I basically copy and modified the soap request the web service gave as an example. i also implemented the methods didRecieveResponse didRecieveAuthenticationChallenge didRecievedData didFailWithError connectionDidFinishLoading. And it works perfectly. Now I need to send 2 parameters to the function: "location" and "module". I tried modifying the soapMessage like this: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body xmlns=\"http://tempuri.org/\" />\n" "<m:GetMonitorList>\n" "<m:location>USA</m:location>\n" "<m:module>DEVELOPMENT</m:module>\n" "</m:GetMonitorList>\n" "</soap:Body>\n" "</soap:Envelope>\n"]; But is not working...any thoughts how should I modify it? Extra info: it seems to be working... kind of. But the webservice return nothing. During the connection, the method didReceiveResponse execute once and the didFinishLoading method executes as well. But not even once the method didReceiveData. I wonder if, even though there is no USA locations, it will still send at least something? is there a way to know which are the parameters the function is waiting for? I don't have access to the source of the webservice but i can access the WSDL.

Read the article

How to hide certain elements on a page using jQuery

- by Ankur

I am trying to implement something that is similar to a faceted search. My data is a series of objects and relationships. The idea is that you click an object (in this case "95 Theses" and then the possibly relationships are displayed, in this case "author" and clicking the relationship shows the object that matches the relationship, in this case "Martin Luther". My clicking of objects and relationsips (predicates) works fine. What I need to do is allow users to click an object or relationship and have all those that extend from it removed. This is what I thought of adding when a object or relationship 'tag' is clicked (every time I add another object or relationship I increment the global attribute called 'level'): if($(".objHolder,. preHolder").filter("[level>'"+level+"']").filter("[holderId='"+holderId+"']").length) { $(".objHolder,. preHolder").filter("[level>'"+level+"']").filter("[holderId='"+holderId+"']").remove(); } <table border="0" cellpadding="4" cellspacing="2"> <tbody><tr> <td class="objHolder" objid="1" holderid="1" level="1"> <table border="0" cellpadding="4" cellspacing="2"> <tbody><tr class="objItemRow" objid="1" holderid="1" level="1"> <td class="objItem" objid="1" holderid="1" level="2" bgcolor="#eeeeee" nowrap="nowrap">95 Theses</td> </tr></tbody> </table></td> <td><img src="images/right.jpg" alt="" height="10" width="16"></td> <td class="preHolder" level="2" holderid="1"> <table border="0" cellpadding="4" cellspacing="2"><tbody> <tr><td class="preItem" level="3" subid="1" preid="1" holderid="1" bgcolor="#eeeeee" nowrap="nowrap">author</td></tr> </tbody></table></td> <td><img src="images/right.jpg" alt="" height="10" width="16"></td> <td class="objHolder" level="3" holderid="1"> <table border="0" cellpadding="4" cellspacing="2"><tbody><tr><td class="objItem" level="4" objid="3" holderid="1" bgcolor="#eeeeee" nowrap="nowrap">Martin Luther</td></tr></tbody></table> </td> </tr></tbody> </table>

Read the article

Correlation formula explanation needed d3.js

- by divakar

Read the article

Using jQuery or javascript to render json into multi-column table

- by Scott Yu - UX designer

I am trying to render a JSON into a HTML table. But the difficulty is making it so it loops through JSON and renders multiple columns if necessary. For the example below, what I want is this: Result wanted Result Wanted <table> <tr><th>AppName</th><td>App 1</td><td>App 2</td></tr> <tr><th>Last Modified</th><td>10/1/2012</td><td></td></tr> <tr><th>App Logo</th><td>10/1/2012</td><td></td></tr> blahblah </table> <table> <tr><th>AppName</th><td>App 1</td></tr> blahblah </table> JSON Example "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "Dan North", "ShipTo_Address": "Dan North", "ShipTo_Terms": "Dan North", "ShipTo_DueDate": "Dan North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] }, { "AppName": "App 2", "AppLogo": "http://www.google.com/logo.png", "LastModified": "10/1/2012, 9:30AM", "BillTo_Name": "Steve North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "222", "ShipTo_Address": "333 ", "ShipTo_Terms": "444", "ShipTo_DueDate": "5555", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], Code I am using now function CreateComparisonTable (arr,level,k) { var dumped_text = ""; if(!level) level = 0; //The padding given at the beginning of the line. var level_padding = ""; for(var j=0;j<level+1;j++) level_padding = "--"; if(typeof(arr) == 'object') { //Array/Hashes/Objects for (var item in arr) { var value = arr[item]; if (typeof(value) == 'object') { //If it is an array, if(item !=0) { dumped_text += '<tr><td>' + item + '<br>'; dumped_text += CreateComparisonTable(value,level+1); dumped_text += '</td></tr>'; } else { dumped_text += CreateComparisonTable(value,level, value.length); } } else { dumped_text += '<tr><td>' + level_padding + item + '</td><td>' + value + '</td></tr>'; } } } return dumped_text; } Jsfiddle here

Read the article

c++ class member functions instatiated by traits

- by Jive Dadson

I am reluctant to say I can't figure this out, but I can't figure this out. I've googled and searched stackoverflow, and come up empty. The abstract, and possibly overly vague form of the question is, how can I use the traits-pattern to instantiate non-virtual member functions? The question came up while modernizing a set of multivariate function optimizers that I wrote more than 10 years ago. The optimizers all operate by selecting a straight-line path through the parameter space away from the current best point (the "update"), then finding a better point on that line (the "line search"), then testing for the "done" condition, and if not done, iterating. There are different methods for doing the update, the line-search, and conceivably for the done test, and other things. Mix and match. Different update formulae require different state-variable data. For example, the LMQN update requires a vector, and the BFGS update requires a matrix. If evaluating gradients is cheap, the line-search should do so. If not, it should use function evaluations only. Some methods require more accurate line-searches than others. Those are just some examples. The original version instantiates several of the combinations by means of virtual functions. Some traits are selected by setting mode bits that are tested at runtime. Yuck. It would be trivial to define the traits with #define's and the member functions with #ifdef's and macros. But that's so twenty years ago. It bugs me that I cannot figure out a whiz-bang modern way. If there were only one trait that varied, I could use the curiously recurring template pattern. But I see no way to extend that to arbitrary combinations of traits. I tried doing it using boost::enable_if, etc.. The specialized state info was easy. I managed to get the functions done, but only by resorting to non-friend external functions that have the this-pointer as a parameter. I never even figured out how to make the functions friends, much less member functions. The compiler (vc++ 2008) always complained that things didn't match. I would yell, "SFINAE, you moron!" but the moron is probably me. Perhaps tag-dispatch is the key. I haven't gotten very deeply into that. Surely it's possible, right? If so, what is best practice?

Read the article

Flash caroussel xml parse html link

- by Marvin

Hello I am trying to modify a carousel script I have in flash. Its normal function is making some icons rotate and when clicked they zoom in, fade all others and display a little text. On that text I would like to have a link like a "read more". If I use CDATA it wont display a thing, if I use alt char like <a href="www.google.com"> Read more + </a> It just displays the text as: <a href="www.google.com"> Read more + </a>. The flash dynamic text box wont render it as html. I dont enough as2 to figure out how to add this. My code: var xml:XML = new XML(); xml.ignoreWhite = true; //definições do xml xml.onLoad = function() { var nodes = this.firstChild.childNodes; numOfItems = nodes.length; for(var i=0;i<numOfItems;i++) { var t = home.attachMovie("item","item"+i,i+1); t.angle = i * ((Math.PI*2)/numOfItems); t.onEnterFrame = mover; t.toolText = nodes[i].attributes.tooltip; t.content = nodes[i].attributes.content; t.icon.inner.loadMovie(nodes[i].attributes.image); t.r.inner.loadMovie(nodes[i].attributes.image); t.icon.onRollOver = over; t.icon.onRollOut = out; t.icon.onRelease = released; } } And the xml: <?xml version="1.0" encoding="UTF-8"?> <icons> <icon image="images/product.swf" tooltip="Product" content="Hello this is some random text <a href="www.google.com"> Read More + </a> "/> </icons> Any suggestions? Thanks.

Read the article

Can I avoid a threaded UDP socket in Python dropping data?

- by 666craig

First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

Read the article

How can I create a Base64-Encoded string from an GDI+ Image in C++?

- by Schnapple

I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

Read the article

Stubbing a before_filter with RSpec

- by TheDelChop

Guys, I'm having trouble understanding why I can't seem to stub this controller method :load_user, since all of my tests fail if I change the actual implementation of :load_user to not return and instance of @user. Can anybody see why my stub (controller.stub!(:load_user).and_return(@user)) seems to fail to actually get called when RSpec makes a request to the controller? require 'spec_helper' describe TasksController do before(:each) do @user = Factory(:user) sign_in @user @task = Factory(:task) User.stub_chain(:where, :first).and_return(@user) controller.stub!(:load_user).and_return(@user) end #GET Index describe "GET Index" do before(:each) do @tasks = 7.times{Factory(:task, :user = @user)} @user.stub!(:tasks).and_return(@tasks) end it "should should find all of the tasks owned by a user" do @user.should_receive(:tasks).and_return(@tasks) get :index, :user_id = @user.id end it "should assign all of the user's tasks to the view" do get :index, :user_id = @user.id assigns[:tasks].should be(@tasks) end end #GET New describe "GET New" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should return a new Task" do @user.tasks.should_receive(:new).and_return(@task) get :new, :user_id = @user.id end end #POST Create describe "POST Create" do before(:each) do @user.stub_chain(:tasks, :new).and_return(@task) end it "should create a new task" do @user.tasks.should_receive(:new).and_return(@task) post :create, :user_id = @user.id, :task = @task.to_s end it "saves the task" do @task.should_receive(:save) post :create, :user_id = @user.id, :task = @task end context "when the task is saved successfully" do before(:each) do @task.stub!(:save).and_return(true) end it "should set the flash[:notice] message to 'Task Added Successfully'"do post :create, :user_id = @user.id, :task = @task flash[:notice].should == "Task Added Successfully!" end it "should redirect to the user's task page" do post :create, :user_id = @user.id, :task = @task response.should redirect_to(user_tasks_path(@user.id)) end end context "when the task isn't saved successfully" do before(:each) do @task.stub(:save).and_return(false) end it "should return to the 'Create New Task' page do" do post :create, :user_id = @user.id, :task = @task response.should render_template('new') end end end it "should attempt to authenticate and load the user who owns the tasks" do context "when the tasks belong to the currently logged in user" do it "should set the user instance variable to the currently logged in user" do pending end end context "when the tasks belong to another user" do it "should set the flash[:notice] to 'Sorry but you can't view other people's tasks.'" do pending end it "should redirect to the home page" do pending end end end end class TasksController < ApplicationController before_filter :load_user def index @tasks = @user.tasks end def new @task = @user.tasks.new end def create @task = @user.tasks.new if @task.save flash[:notice] = "Task Added Successfully!" redirect_to user_tasks_path(@user.id) else render :action => 'new' end end private def load_user if current_user.id == params[:user_id].to_i @user = User.where(:id => params[:user_id]).first else flash[:notice] = "Sorry but you can't view other people's tasks." redirect_to root_path end end end Can anybody see why my stub doesnt' work? Like I said, my tests only pass if I make sure that load_user works, if not, all my tests fail which makes my think that RSpec isn't using the stub I created. Thanks, Joe

Read the article

Efficient file buffering & scanning methods for large files in python

- by eblume

The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

Read the article

xml append issue in ie,chrome

- by 3gwebtrain

Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

Read the article

Slow MySQL query....only sometimes

- by Shane N

I have a query that's used in a reporting system of ours that sometimes runs quicker than a second, and other times takes 1 to 10 minutes to run. Here's the entry from the slow query log: # Query_time: 543 Lock_time: 0 Rows_sent: 0 Rows_examined: 124948974 use statsdb; SELECT count(distinct Visits.visitorid) as 'uniques' FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime>=1275721200 and visittime<=1275807599 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9 AND Visits.visitorid NOT IN (SELECT Visits.visitorid FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime<1275721200 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9); It's basically counting unique visitors, and it's doing that by counting the visitors for today and then substracting those that have been here before. If you know of a better way to do this, let me know. I just don't understand why sometimes it can be so quick, and other times takes so long - even with the same exact query under the same server load. Here's the EXPLAIN on this query. As you can see it's using the indexes I've set up: id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY Visits range visittime_visitorid,visitorid visittime_visitorid 4 NULL 82500 Using where; Using index 1 PRIMARY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where 2 DEPENDENT SUBQUERY Visits ref visittime_visitorid,visitorid visitorid 8 func 1 Using where 2 DEPENDENT SUBQUERY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where I tried to optimize the query a few weeks ago and came up with a variation that consistently took about 2 seconds, but in practice it ended up taking more time since 90% of the time the old query returned much quicker. Two seconds per query is too long because we are calling the query up to 50 times per page load, with different time periods. Could the quick behavior be due to the query being saved in the query cache? I tried running 'RESET QUERY CACHE' and 'FLUSH TABLES' between my benchmark tests and I was still getting quick results most of the time. Note: last night while running the query I got an error: Unable to save result set. My initial research shows that may be due to a corrupt table that needs repair. Could this be the reason for the behavior I'm seeing? In case you want server info: Accessing via PHP 4.4.4 MySQL 4.1.22 All tables are InnoDB We run optimize table on all tables weekly The sum of both the tables used in the query is 500 MB MySQL config: key_buffer = 350M max_allowed_packet = 16M thread_stack = 128K sort_buffer = 14M read_buffer = 1M bulk_insert_buffer_size = 400M set-variable = max_connections=150 query_cache_limit = 1048576 query_cache_size = 50777216 query_cache_type = 1 tmp_table_size = 203554432 table_cache = 120 thread_cache_size = 4 wait_timeout = 28800 skip-external-locking innodb_file_per_table innodb_buffer_pool_size = 3512M innodb_log_file_size=100M innodb_log_buffer_size=4M

Search Results

Search found 19603 results on 785 pages for 'variable length'.

Page 728/785 | < Previous Page | 724 725 726 727 728 729 730 731 732 733 734 735 | Next Page >

- by Harfleur

- by Trey Jackson

- by wdow88

- by Eddy

- by MikeH

- by Ian Leslie

- by zchtodd

- by Jack Roscoe

- by Jamie Keeling

- by lommaj

- by ldigas

- by C. Karunarathne

- by netrise

- by Alejandra Meraz

- by Ankur

- by divakar

- by Scott Yu - UX designer

- by Jive Dadson

- by Marvin

- by 666craig

- by Schnapple

- by TheDelChop

- by eblume

- by 3gwebtrain

- by Shane N

< Previous Page | 724 725 726 727 728 729 730 731 732 733 734 735 | Next Page >