Search Results

Search found 12077 results on 484 pages for 'node js'.

Page 73/484 | < Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • Get current node's local-name in XSL

    - by green67
    Here's the structure of my XML <FileRoot> <UserSet1> <User> <FirstName></FirstName> <LastName></LastName> </User> <User> <FirstName></FirstName> <LastName></LastName> </User> ... </UserSet1> <InactiveUsers> <User> <FirstName></FirstName> <LastName></LastName> </User> <User> <FirstName></FirstName> <LastName></LastName> </User> ... </InactiveUsers> </FileRoot> In my XSL template <xsl:template match="/*/*"> <File> <xsl attribute name="Name"> <xsl:value-of select="local-name(/*/*)"/> </xsl:attribute> </File> </xsl> After transforming, for both UserSet1 and InactiveUsers, gave me "UserSet1". The expected results should be "UserSet1" for UserSet1, and "InactiveUsers" for InactiveUsers. How do I correctly retrieve the value? Thanks

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • Exclude notes based on attribute wildcard in XSL node selection

    - by C A
    Using cruisecontrol for continuous integration, I have some annoyances with Weblogic Ant tasks and how they think that server debug information are warnings rather than debug, so are shown in my build report emails. The XML output from cruise is similar to: <cruisecontrol> <build> <target name="compile-xxx"> <task name="xxx" /> </target> <target name="xxx.weblogic"> <task name="wldeploy"> <message priority="warn">Message which isn't really a warning"</message> </task> </target> </build> </cruisecontrol> In the cruisecontrol XSL template the current selection for the task list is: <xsl:variable name="tasklist" select="/cruisecontrol/build//target/task"/> What I would like is something which selects the tasklist in the same way, but doesn't include any target nodes which have the attribute name="*weblogic" where * is a wildcard. I have tried <xsl:variable name="tasklist" select="/cruisecontrol/build//target[@name!='*weblogic']/task"/> but this doesn't seem to have worked. I'm not an expert with XSLT, and just want to get this fixed so I can carry on the real development of the project. Any help is much appreciated.

    Read the article

  • Linq Return node level of hierarchical xml

    - by Ryan
    In a treeview you can retrieve the level of an item. I am trying to accomplish the same thing with the given input being an object. The XML data I will use for this example would be something like the following <?xml version="1.0" encoding="utf-8" ?> <Testing> <Numbers> <Number val="1"> <Number val="1.1"> <Number val="1.1.1"> <Number val="1.1.2" /> <Number val="1.1.3" /> <Number val="1.1.4" /> </Number> </Number> <Number val="1.2" /> <Number val="1.3" /> <Number val="1.4" /> </Number> <Number val="2" /> <Number val="3" /> <Number val="4" /> </Numbers> <Numbers> <Number val="5" /> <Number val="6" /> <Number val="7" /> <Number val="8" /> </Numbers> </Testing> This one is kicking my butt!

    Read the article

  • Alligator tags(<% %>) inside js string?

    - by bangoker
    I am trying to redirect a page reading the url from the config file. However, when I try this: <script type="text/javascript"> <%string redirectUrl = System.Web.Configuration.WebConfigurationManager.AppSettings["RedirectURL"];%> window.parent.location.replace("<%=redirectUrl%>"); </script> the alligator tags <% % are Not being highlighted, and when I run I get the following error in the yellow screen: the controls collection cannot be modified because the control contains code blocks (i.e. <% ... %>). What am I doing wrong?? Thanks!

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • JS regular expression to find a substring surrounded by double quotes

    - by 2619
    I need to find a substring surrounded by double quotes, for example, like "test", "te\"st" or "", but not """ neither "\". To achieve this, which is the best way to go for it in the following 1) /".*"/g 2) /"[^"\\]*(?:\\[\S\s][^"\\]*)*"/g 3) /"(?:\\?[\S\s])*?"/g 4) /"([^"\\]*("|\\[\S\s]))+/g I was asked this question yesterday during an interview, and would like to know the answer for future reference.

    Read the article

  • Return node level of hierarchical xml

    - by Ryan
    In a treeview you can retrieve the level of an item. I am trying to accomplish the same thing with the given input being an object. The XML data I will use for this example would be something like the following <?xml version="1.0" encoding="utf-8" ?> <Testing> <Numbers> <Number val="1"> <Number val="1.1"> <Number val="1.1.1"> <Number val="1.1.2" /> <Number val="1.1.3" /> <Number val="1.1.4" /> </Number> </Number> <Number val="1.2" /> <Number val="1.3" /> <Number val="1.4" /> </Number> <Number val="2" /> <Number val="3" /> <Number val="4" /> </Numbers> <Numbers> <Number val="5" /> <Number val="6" /> <Number val="7" /> <Number val="8" /> </Numbers> </Testing> This one is kicking my butt!

    Read the article

  • XElement return node value

    - by theDawckta
    I have an XElement that looks like this; <VideoFiles> <VideoFileInfo> <VideoType>1000</VideoType> <FormatCode>1000</FormatCode> <Url>http://www.idontwantthisvalue.com</Url> </VideoFileInfo> <VideoFileInfo> <VideoType>WMVOriginal</VideoType> <FormatCode>1004</FormatCode> <Url>http://www.iwanthitsvalue.com</Url> </VideoFile> I need to grab the value that has a sibling with a value of 1004. Can anyone help on this?

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

< Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >