Search Results

Search found 6715 results on 269 pages for 'preg match'.

Page 74/269 | < Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Substitute all matches with values in Ruby regular expression

    - by Lewisham
    Hi all, I'm having a problem with getting a Ruby string substitution going. I'm writing a preprocessor for a limited language that I'm using, that doesn't natively support arrays, so I'm hacking in my own. I have a line: x[0] = x[1] & x[1] = x[2] I want to replace each instance with a reformatted version: x__0 = x__1 & x__1 = x__2 The line may include square brackets elsewhere. I've got a regex that will match the array use: array_usage = /(\w+)\[(\d+)\]/ but I can't figure out the Ruby construct to replace each instance one by one. I can't use .gsub() because that will match every instance on the line, and replace every array declaration with whatever the first one was. .scan() complains that the string is being modified if you try and use scan with a .sub()! inside a block. Any ideas would be appreciated!

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • SQL Server FTS: possible to get information how/why rows were matched?

    - by jimmy_keen
    Is it possible to get the information why/how given row returned by FTS query was matched (or which substring caused row to match)? For example, consider simpliest table with id and text columns, with FTS index on the later one. SELECT * FROM Example WHERE CONTAINS(text, 'FORMSOF(INFLECTIONAL, jump)'); This examplary query could return, say row {1, 'Jumping Jack'}. Now, is it possible to somehow get information that this very row was matched because of 'Jumping' word? It doesn't even have to be exact information, more of a which substring caused row to match. Why I'm asking - I got C# app that builds up those queries basing on user input (keywords to search for), and I need the very basic information why/how row was matched back, to use further in C# code. If it's not possible, any alternatives?

    Read the article

  • Unable to replace & with &amp; in XML uses Preg_replace in PHP

    - by Raind
    Hi, Need help here. Am not able to replace the '&' with '&' uses Preg_replace in PhP. But, if i do it manually (edited) on the xml file, it works out fine. Here are the sample: $XMLCharactersPreg = "/[&<\"\'()^*@+]/"; $XMLPregReplace = "&"; $d_Description = "50% offer & 20% further reduction for member"; if (preg_match($XMLCharactersPreg, $d_Description)) { echo "A match was found."; $XMLDealDescription = preg_replace($XMLCharactersPreg , $XMLPregReplace, $d_Description); echo "$XMLDealDescription "; } else { echo "A match was not found."; } Thanks.

    Read the article

  • Where is the 'indeterminate type'?

    - by Daniel
    I'm defining the following type extension: type System.Reflection.MemberInfo with member x.GetAttribute<'T when 'T :> Attribute>(required, inherit') = match required, Attribute.GetCustomAttribute(x, typeof<'T>, inherit') with | true, null -> invalidOp (sprintf "Missing required attribute: %s" typeof<'T>.FullName) | _, attr -> attr :> 'T The last match expression (attr :> 'T) gives the error: The static coercion from Attribute to 'T involves an indeterminate type based on information prior to this program point. Static coercions are not allowed on some types. Further type annotations are needed. I've tried annotating the function return type, but got the same result. I would hate to change this to a dynamic cast. Is there a way to make the static cast work?

    Read the article

  • extracting string occurrence in c

    - by David78
    I have a string from a text file that look something like this: long_str = "returns between paragraphs 20102/34.23" - 9203 1232 "test" "basic HTML" Note: Quotes are part of the string. int match(char *long_str){ char * str; if ((str = strchr(long_str, '"')) != NULL) str++; // last " ? else return 1; return 0; } Using strstr I'm trying to get the whole substring between the last two quotes: "basic HTML". I'm just not quite sure what would be a good and efficient way of getting that match. I'm open to any other ideas on how to approach this. Thanks

    Read the article

  • VS2010 (older) installer project - two or more objects have the same target location.

    - by Hamish Grubijan
    This installer project was created back in 2004 and upgraded ever since. There are two offending dll files, which produce a total of 4 errors. I have searched online for this warning message and did not find a permanent fix (I did manage to make it go away once until I have done something like a clean, or built in Release, and then in Debug). I also tried cleaning, and then refreshing the dependencies. The duplicated entries are still in there. I also did not find a good explanation for what this error means. Additional warnings are of this nature: Warning 36 The version of the .NET Framework launch condition '.NET Framework 4' does not match the selected .NET Framework bootstrapper package. Update the .NET Framework launch condition to match the version of the .NET Framework selected in the Prerequisites Dialog Box. So, where is this prerequisites box? I want to make both things agree on .Net 4.0, just having a hard time locating both of them.

    Read the article

  • Rails Routes Mappings

    - by rdasxy
    I'm a rails newbie, and I have a controller called resource_links that I've mapped to resources: resources :resources, :as => :resource_links, :controller => :resource_links And this works (basically /resources works as /resource_links). However, trying to go to /resources/tags does not work. To get around this, I added more mappings as: match 'resource_links/tag/:tag(.:format)' => 'resource_links#tag', :via => :get, :as => 'resource_links_tagged', :constraints => {:tag => /.*/} match 'resource_links/tags' => 'resource_links#tags', :via => :get, :as => 'resource_links_tags' Is there any way I can get /resources/tags to be mapped to /resource_links/tag?

    Read the article

  • C# matching two text files, case sensitive issue

    - by Mike
    What i have is two files, sourcecolumns.txt and destcolumns.txt. What i need to do is compare source to dest and if the text doesnt match write out to a new file. The code below works except i have case sensitive issues like this: CPI Cpi These say they dont match because of captial letters, any help is always thanked! string[] sourcelinestotal = File.ReadAllLines(@"C:\testdirectory\" + "sourcecolumns.txt"); string[] destlinestotal = File.ReadAllLines(@"C:\testdirectory\" + "destcolumns.txt"); foreach (string sline in sourcelinestotal) { if(destlinestotal.Contains(sline)) { } else { File.AppendAllText(@"C:\testdirectory\" + "missingcolumns.txt", sline); } }

    Read the article

  • Strange SQL problem selecting multiple values for same column

    - by Nubber
    Hello there, Been at this for a few hours now and I can't make any sense of it. I've used this way of selecting multiple values for same column a few times, but there is something weird with this one. SELECT * FROM employee as s INNER JOIN works AS w1 ON w1.name = s.name INNER JOIN employee AS w2 ON w2.name = s.name INNER JOIN employee AS w3 ON w3.name = s.name WHERE w2.city = 'Washington' Basically what I want to do is find all companies which have people in all the cities. The company name is under 'works'. The problem is however that if I have the WHERE w2.city='Washington' it will make ALL the cities match Washington when it should only touch w2 and leave w3 alone so I could match it with another value. Anyone know why its doing this? Or know a better way to do it. Thank you very much in advance.

    Read the article

  • Prototype setStyle not working in IE6.

    - by Smickie
    Hi, I'm using prototype and setStyle in IE6 is just messing everything up. It's throwing a big error. I've Googled it but cant find a solution. I've identified the line in prototype with the IE script debugger, it's the final else block: setStyle: function(element, styles) { element = $(element); var elementStyle = element.style, match; if (Object.isString(styles)) { element.style.cssText += ';' + styles; return styles.include('opacity') ? element.setOpacity(styles.match(/opacity:\s*(\d?\.?\d*)/)[1]) : element; } for (var property in styles) if (property == 'opacity') element.setOpacity(styles[property]); else elementStyle[(property == 'float' || property == 'cssFloat') ? (Object.isUndefined(elementStyle.styleFloat) ? 'cssFloat' : 'styleFloat') : property] = styles[property]; return element; }, Anyone had this problem? P.S. normally I would use jQuery however this is someone else code I've had to update.

    Read the article

  • Getting all matches for a regexp on clojure

    - by Deleteman
    I'm trying to parse an HTML file and get all href's inside it. So far, the code I'm using is: (map #(println (str "Match: " %)) (re-find #"(?sm)href=\"([a-zA-Z.:/]+)\"" str_response)) str_response being the string with the HTML code inside it. According to my basic understanding of Clojure, that code should print a list of matches, but so far, no luck. It doens't crash, but it doens't match anything either. I've tried using re-seq instead of re-find, but with no luck. Any help? Thanks!

    Read the article

  • Android search list, String

    - by NightSky
    Hey guys what is the best way to search through my list of objects, they return a few strings, last name and first name for example. Here how i'm currently searching but my search needs to match the entire string which I don't want. The search needs it to match part of the string like our contacts list on our phone and ignore the case. if (searchQ.equalsIgnoreCase(child.first_name)) { addChildToList(child); } Ive tried contains and starts with for example, they did not work. Whats going on? Thanks! Cheers!

    Read the article

  • Port forwarding DD-WRT

    - by Pawel
    Hi, I'am runing locally service on port 81 (192.168.1.101) I would like to access server from outside MY.WAN.IP.ADDR:81. Everything is working fine on my local network, However can't access it from outside. Below iptables rules on the router. I am using dd-wrt and asus rt-n16 (everything is setup through standard port range forwarding in dd-wrt ) It might be something obvious, but I don't have any experience with routing. Any help will be really appreciated. Thanks. #iptables -t nat -vnL Chain PREROUTING (policy ACCEPT 1285 packets, 148K bytes) pkts bytes target prot opt in out source destination 3 252 DNAT icmp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR to:192.168.1.1 5 300 DNAT tcp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR tcp dpt:81 to:192.168.1.101 0 0 DNAT udp -- * * 0.0.0.0/0 MY.WAN.IP.ADDR udp dpt:81 to:192.168.1.101 298 39375 TRIGGER 0 -- * * 0.0.0.0/0 MY.WAN.IP.ADDR TRIGGER type:dnat match:0 relate:0 Chain POSTROUTING (policy ACCEPT 7 packets, 433 bytes) pkts bytes target prot opt in out source destination 747 91318 SNAT 0 -- * vlan2 0.0.0.0/0 0.0.0.0/0 to:MY.WAN.IP.ADDR 0 0 RETURN 0 -- * br0 0.0.0.0/0 0.0.0.0/0 PKTTYPE = broadcast Chain OUTPUT (policy ACCEPT 86 packets, 5673 bytes) pkts bytes target prot opt in out source destination # iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination DROP tcp -- anywhere anywhere tcp dpt:webcache DROP tcp -- anywhere anywhere tcp dpt:www DROP tcp -- anywhere anywhere tcp dpt:https DROP tcp -- anywhere anywhere tcp dpt:69 DROP tcp -- anywhere anywhere tcp dpt:ssh DROP tcp -- anywhere anywhere tcp dpt:ssh DROP tcp -- anywhere anywhere tcp dpt:telnet DROP tcp -- anywhere anywhere tcp dpt:telnet Chain FORWARD (policy ACCEPT) target prot opt source destination ACCEPT 0 -- anywhere anywhere TCPMSS tcp -- anywhere anywhere tcp flags:SYN,RST/SYN TCPMSS clamp to PMTU lan2wan 0 -- anywhere anywhere ACCEPT 0 -- anywhere anywhere state RELATED,ESTABLISHED logaccept tcp -- anywhere pawel-ubuntu tcp dpt:81 logaccept udp -- anywhere pawel-ubuntu udp dpt:81 TRIGGER 0 -- anywhere anywhere TRIGGER type:in match:0 relate:0 trigger_out 0 -- anywhere anywhere logaccept 0 -- anywhere anywhere state NEW Chain OUTPUT (policy ACCEPT) target prot opt source destination Chain advgrp_1 (0 references) target prot opt source destination Chain advgrp_10 (0 references) target prot opt source destination Chain advgrp_2 (0 references) target prot opt source destination Chain advgrp_3 (0 references) target prot opt source destination Chain advgrp_4 (0 references) target prot opt source destination Chain advgrp_5 (0 references) target prot opt source destination Chain advgrp_6 (0 references) target prot opt source destination Chain advgrp_7 (0 references) target prot opt source destination Chain advgrp_8 (0 references) target prot opt source destination Chain advgrp_9 (0 references) target prot opt source destination Chain grp_1 (0 references) target prot opt source destination Chain grp_10 (0 references) target prot opt source destination Chain grp_2 (0 references) target prot opt source destination Chain grp_3 (0 references) target prot opt source destination Chain grp_4 (0 references) target prot opt source destination Chain grp_5 (0 references) target prot opt source destination Chain grp_6 (0 references) target prot opt source destination Chain grp_7 (0 references) target prot opt source destination Chain grp_8 (0 references) target prot opt source destination Chain grp_9 (0 references) target prot opt source destination Chain lan2wan (1 references) target prot opt source destination Chain logaccept (3 references) target prot opt source destination ACCEPT 0 -- anywhere anywhere Chain logdrop (0 references) target prot opt source destination DROP 0 -- anywhere anywhere Chain logreject (0 references) target prot opt source destination REJECT tcp -- anywhere anywhere tcp reject-with tcp-reset Chain trigger_out (1 references) target prot opt source destination #iptables -vnL FORWARD Chain FORWARD (policy ACCEPT 130 packets, 5327 bytes) pkts bytes target prot opt in out source destination 15 900 ACCEPT 0 -- br0 br0 0.0.0.0/0 0.0.0.0/0 390 20708 TCPMSS tcp -- * * 0.0.0.0/0 0.0.0.0/0 tcp flags:0x06/0x02 TCPMSS clamp to PMTU 182K 130M lan2wan 0 -- * * 0.0.0.0/0 0.0.0.0/0 179K 129M ACCEPT 0 -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED 0 0 logaccept tcp -- * * 0.0.0.0/0 192.168.1.101 tcp dpt:81 0 0 logaccept udp -- * * 0.0.0.0/0 192.168.1.101 udp dpt:81 0 0 TRIGGER 0 -- vlan2 br0 0.0.0.0/0 0.0.0.0/0 TRIGGER type:in match:0 relate:0 2612 768K trigger_out 0 -- br0 * 0.0.0.0/0 0.0.0.0/0 2482 762K logaccept 0 -- br0 * 0.0.0.0/0 0.0.0.0/0 state NEW

    Read the article

  • What's the difference between find and findstr commands in Windows?

    - by Prashant Bhate
    In Windows, what are the differences between find and findstr commands? Both seems to search text in files: find c:\>find /? Searches for a text string in a file or files. FIND [/V] [/C] [/N] [/I] [/OFF[LINE]] "string" [[drive:][path]filename[ ...]] /V Displays all lines NOT containing the specified string. /C Displays only the count of lines containing the string. /N Displays line numbers with the displayed lines. /I Ignores the case of characters when searching for the string. /OFF[LINE] Do not skip files with offline attribute set. "string" Specifies the text string to find. [drive:][path]filename Specifies a file or files to search. If a path is not specified, FIND searches the text typed at the prompt or piped from another command. findstr c:\>findstr /? Searches for strings in files. FINDSTR [/B] [/E] [/L] [/R] [/S] [/I] [/X] [/V] [/N] [/M] [/O] [/P] [/F:file] [/C:string] [/G:file] [/D:dir list] [/A:color attributes] [/OFF[LINE]] strings [[drive:][path]filename[ ...]] /B Matches pattern if at the beginning of a line. /E Matches pattern if at the end of a line. /L Uses search strings literally. /R Uses search strings as regular expressions. /S Searches for matching files in the current directory and all subdirectories. /I Specifies that the search is not to be case-sensitive. /X Prints lines that match exactly. /V Prints only lines that do not contain a match. /N Prints the line number before each line that matches. /M Prints only the filename if a file contains a match. /O Prints character offset before each matching line. /P Skip files with non-printable characters. /OFF[LINE] Do not skip files with offline attribute set. /A:attr Specifies color attribute with two hex digits. See "color /?" /F:file Reads file list from the specified file(/ stands for console). /C:string Uses specified string as a literal search string. /G:file Gets search strings from the specified file(/ stands for console). /D:dir Search a semicolon delimited list of directories strings Text to be searched for. [drive:][path]filename Specifies a file or files to search. Use spaces to separate multiple search strings unless the argument is prefixed with /C. For example, 'FINDSTR "hello there" x.y' searches for "hello" or "there" in file x.y. 'FINDSTR /C:"hello there" x.y' searches for "hello there" in file x.y. Regular expression quick reference: . Wildcard: any character * Repeat: zero or more occurances of previous character or class ^ Line position: beginning of line $ Line position: end of line [class] Character class: any one character in set [^class] Inverse class: any one character not in set [x-y] Range: any characters within the specified range \x Escape: literal use of metacharacter x \<xyz Word position: beginning of word xyz\> Word position: end of word For full information on FINDSTR regular expressions refer to the online Command Reference.

    Read the article

  • Address bar showing long URL

    - by Abel
    I recently upgraded my hosting account to Deluxe where I can host multiple websites. I added a domain name and created a folder in the root directory giving it the same name as my domain name and uploaded my files. Now when I navigate the site the address bar shows: 'http://mywebsite/mywebsite/default.aspx' I want it to display: 'http://mywebsite/default.aspx' My thinking in creating folders that match the domain names is to keep them somewhat organized; never intended to have my domain names listed twice in the address bar.

    Read the article

  • How to add EXTRA_CFLAGS to indigo eclipse cdt?

    - by jacknad
    I used the instructions here to install eclipse and the here to create an eclipse project but I suspect the instructions were written for an older version of eclipse. Specifically, there is no Build (Incremental Build): build install EXTRA_CFLAGS+=-g... in this version of eclipse. I have created the project without the EXTRA_CFLAGS and have been poking around in it looking for a place to add or set them. I see a number of things that look close in Project Properties but nothing that seems like a match.

    Read the article

  • Desktop Fun: Triple Monitor Wallpaper Collection Series 1

    - by Asian Angel
    Triple monitor setups provide spacious amounts of screen real-estate but can be extremely frustrating to find good wallpapers for. Today we present the first in a series of wallpaper collections to help decorate your triple monitor setup with lots of wallpaper goodness. Note: Click on the picture to see the full-size image—these wallpapers vary in size so you may need to crop, stretch, or place them on a colored background in order to best match them to your screen’s resolution. Special Note: The screen resolution sizes available for each of these wallpapers has been included to help you match them up to your individual settings as easily as possible. All images shown here are thumbnail screenshots of the largest size available for download. Available in the following resolutions: 3840*1024, 4096*1024, 4320*900, 4800*1200, 5040*1050, and 5760*1200. Available in the following resolutions: 4800*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, and 4800*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, and 4800*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, 5040*1050, and 5760*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, and 4800*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, and 5040*1050. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, and 5040*1050. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, and 4800*1200. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, and 5040*1050. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4800*1200, and 5040*1050. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, 5040*1050, 5760*1200, and 7680*1600. Available in the following resolutions: 3840*960, 3840*1024, 4096*1024, 4320*900, 4800*1200, 5040*1050, and 5760*1200. Available in the following resolutions: 5760*1200. Available in the following resolutions: 5760*1200. More Triple Monitor Goodness Beautiful 3 Screen Multi-Monitor Space Wallpaper Span the same wallpaper across multiple monitors or use a different wallpaper for each. Dual Monitors: Use a Different Wallpaper on Each Desktop in Windows 7, Vista or XP For more wallpapers be certain to see our great collections in the Desktop Fun section. Latest Features How-To Geek ETC How to Upgrade Windows 7 Easily (And Understand Whether You Should) The How-To Geek Guide to Audio Editing: Basic Noise Removal Install a Wii Game Loader for Easy Backups and Fast Load Times The Best of CES (Consumer Electronics Show) in 2011 The Worst of CES (Consumer Electronics Show) in 2011 HTG Projects: How to Create Your Own Custom Papercraft Toy Firefox 4.0 Beta 9 Available for Download – Get Your Copy Now The Frustrations of a Computer Literate Watching a Newbie Use a Computer [Humorous Video] Season0nPass Jailbreaks Current Gen Apple TVs IBM’s Jeopardy Playing Computer Watson Shows The Pros How It’s Done [Video] Tranquil Juice Drop Abstract Wallpaper Pulse Is a Sleek Newsreader for iOS and Android Devices

    Read the article

  • Coherence Based WebLogic Server Session Management

    - by [email protected]
    Specifications Supported Configurations WebLogic Server 10.3.2( or 10.3.1 ) Coherence 3.5.2/463 If you use other verion above, then please check the following matrix:   WebLogic Server 9.2 MP1 Weblogic Server 10.3 WebLogic Smart Update Patch ID: AJQB Patch ID: 6W2W Minimum Coherence Release Level/MetaLink Patch ID 3.4.2 Patch 2-Patch ID:8429415 3.4.2 Patch6-Patch ID:11399293 Environment Variables %COHERENCE_HOME%: coherence installation directory %DOMAIN_HOME%: weblogic domain foler. Instructions We Will create to weblogic domains: domain_a, domain_b. To configure those domains with coherence-based session management . Then the changings of session variable value in one domain will propagate to another domain. Main Steps WebLogic Server create domain_a The process is ignored copy %COHERENCE_HOME%\lib\coherence.jar to %DOMAIN_HOME%\lib startup domain deploy %COHERENCE_HOME%\lib\coherence-web-spi.war as a Shared Library repeat step 1~4 at domain_b Coherence duplicate %COHERENCE_HOME%\bin\cache-server.cmd at the same folder and rename it to web-cache-server.cmd modify web-cache-server.cmd java -server -Xms512m -Xmx512m -cp %coherence_home%/lib/coherence.jar;%coherence_home%/lib/coherence-web-spi.war -Dtangosol.coherence.management.remote=true -Dtangosol.coherence.cacheconfig=WEB-INF/classes/session-cache-config.xml -Dtangosol.coherence.session.localstorage=true com.tangosol.net.DefaultCacheServer startup web-cache-server.cmd Testing develop a web app  with OEPE or JDeveloper and implment functions: changing, viewing, listing  session variables. ( or download sample codes here ) modify weblogic.xml with following content: <?xml version="1.0" encoding="UTF-8"?> <wls:weblogic-web-app xmlns:wls=http://xmlns.oracle.com/weblogic/weblogic-web-app xmlns:xsi=http://www.w3.org/2001/XMLSchema-instance xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_2_5.xsd http://xmlns.oracle.com/weblogic/weblogic-web-app http://xmlns.oracle.com/weblogic/weblogic-web-app/1.0/weblogic-web-app.xsd"> <wls:weblogic-version>10.3.2</wls:weblogic-version> <wls:context-root>CoherenceWeb</wls:context-root> <wls:library-ref> <wls:library-name>coherence-web-spi</wls:library-name> <wls:specification-version>1.0.0.0</wls:specification-version> <wls:exact-match>true</wls:exact-match> </wls:library-ref> </wls:weblogic-web-app> deploy the web app to domain_a and domain_b change session varaible vlaue at domain_a and check whethe if changed at domain_b References Using Oracle Coherence*Web 3.4.2 with Oracle WebLogic Server 10gR3 Oracle Coherence*Web 3.4.2 with Oracle WebLogic Server 10gR3

    Read the article

  • An XEvent a Day (20 of 31) – Mapping Extended Events to SQL Trace

    - by Jonathan Kehayias
    One of the biggest problems that I had with getting into Extended Events was mapping the Events available in Extended Events to the Events that I knew from SQL Trace. With so many Events to choose from in Extended Events, and a different organization of the Events, it is really easy to get lost when trying to find things. Add to this the fact that Event names don’t match up to Trace Event names in SQL Server 2008 and 2008 R2, and not all of the Events from Trace are implemented in SQL Server 2008...(read more)

    Read the article

  • SSIS Catalog, Windows updates and deployment failures due to System.Core mismatch

    - by jamiet
    This is a heads-up for anyone doing development on SSIS. On my current project where we are implementing a SQL Server Integration Services (SSIS) 2012 solution we recently encountered a situation where we were unable to deploy any of our projects even though we had successfully deployed in the past. Any attempt to use the deployment wizard resulted in this error dialog: The text of the error (for all you search engine crawlers out there) was: A .NET Framework error occurred during execution of user-defined routine or aggregate "create_key_information": System.IO.FileLoadException: Could not load file or assembly 'System.Core, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089' or one of its dependencies. The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040) ---> System.IO.FileLoadException: The located assembly's manifest definition does not match the assembly reference. (Exception from HRESULT: 0x80131040) System.IO.FileLoadException: System.IO.FileLoadException:     at Microsoft.SqlServer.IntegrationServices.Server.Security.CryptoGraphy.CreateSymmetricKey(String algorithm)    at Microsoft.SqlServer.IntegrationServices.Server.Security.CryptoGraphy.CreateKeyInformation(SqlString algorithmName, SqlBytes& key, SqlBytes& IV) . (Microsoft SQL Server, Error: 6522) After some investigation and a bit of back and forth with some very helpful members of the SSIS product team (hey Matt, Wee Hyong) it transpired that this was due to a .Net Framework fix that had been delivered via Windows Update. I took a look at the server update history and indeed there have been some recently applied .Net Framework updates: This fix had (in the words of Matt Masson) “somehow caused a mismatch on System.Core for SQLCLR” and, as you may know, SQLCLR is used heavily within the SSIS Catalog. The fix was pretty simple – restart SQL Server. This causes the assemblies to be upgraded automatically. If you are using Data Quality Services (DQS) you may have experienced similar problems which are documented at Upgrade SQLCLR Assemblies After .NET Framework Update. I am hoping the SSIS team will follow-up with a more thorough explanation on their blog soon. You DBAs out there may be questioning why Windows Update is set to automatically apply updates on our production servers. We’re checking that out with our hosting provider right now You have been warned! @Jamiet

    Read the article

  • Performance Improvement: Session State

    Performance is critical to today's successful applications and web sites. If you design with an awareness of the session state management challenges you can always change your strategies to match your performance needs.

    Read the article

  • Performance Improvement: Session State

    Performance is critical to today's successful applications and web sites. If you design with an awareness of the session state management challenges you can always change your strategies to match your performance needs.

    Read the article

< Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >