Search Results

Search found 1965 results on 79 pages for 'quantum computing'.

Page 75/79 | < Previous Page | 71 72 73 74 75 76 77 78 79  | Next Page >

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

  • Varnish VCL - Regular Expression Evaluation

    - by Hugues ALARY
    I have been struggling for the past few days with this problem: Basically, I want to send to a client browser a cookie of the form foo[sha1oftheurl]=[randomvalue] if and only if the cookie has not already been set. e.g. If a client browser requests "/page.html", the HTTP response will be like: resp.http.Set-Cookie = "foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD;" then, if the same client request "/index.html", the HTTP response will contain a header: resp.http.Set-Cookie = "foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY;" In the end, the client browser will have 2 cookies: foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY Now, that, is not complicated in itself. The following code does it: import digest; import random; ##This vmod does not exist, it's just for the example. sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); } sub vcl_deliver() { ## We create a cookie on the client browser by creating a "Set-Cookie" header ## In our case the cookie we create is of the form foo[sha1]=[randomvalue] ## e.g for a URL "/page.html" the cookie will be foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=[randomvalue] set resp.http.Set-Cookie = {""} + resp.http.Set-Cookie + "foo"+req.http.Url-Sha1+"="+req.http.random-value; } However, this code does not take into account the case where the Cookie already exists. I need to check that the Cookie does not exists before generating a random value. So I thought about this code: import digest; import random; sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); set req.http.regex = "abtest"+req.http.Url-Sha1; if(!req.http.Cookie ~ req.http.regex) { set req.http.random-value = random.get_rand(); } } The problem is that Varnish does not compute Regular expression at run time. Which leads to this error when I try to compile: Message from VCC-compiler: Expected CSTR got 'req.http.regex' (program line 940), at ('input' Line 42 Pos 31) if(req.http.Cookie !~ req.http.regex) { ------------------------------##############--- Running VCC-compiler failed, exit 1 VCL compilation failed One could propose to solve my problem by matching on the "abtest" part of the cookie or even "abtest[a-fA-F0-9]{40}": if(!req.http.Cookie ~ "abtest[a-fA-F0-9]{40}") { set req.http.random-value = random.get_rand(); } But this code matches any cookie starting by 'abtest' and containing an hexadecimal string of 40 characters. Which means that if a client requests "/page.html" first, then "/index.html", the condition will evaluate to true even if the cookie for the "/index.html" has not been set. I found in bug report phk or someone else stating that computing regular expressions was extremely expensive which is why they are evaluated during compilation. Considering this, I believe that there is no way of achieving what I want the way I've been trying to. Is there any way of solving this problem, other than writting a vmod? Thanks for your help! -Hugues

    Read the article

  • Wordpress Permissions OS X & MAMP

    - by Matt2020
    I have installed several local versions of Wordpress for development purposes. After the install I can create posts, pages and edit admin options. However as soon as try to upload images which would be saved in wp_content/uploads I get an error: Upload Error: Unable to create directory ...../blog/wp-content/uploads/2011/05. Is its parent directory writable by the server? Looks like MAMP server runs as user _www The blog directory is owned by User1 and the group User1 _www is not in the User1 group, should it be? I do not want to chmod 777 or 765 on the directories just to get it going. Googled up a couple of references: http://codex.wordpress.org/Changing_File_Permissions in "Permission Scheme for WordPress" All files should be owned by your user (ftp) account on your web server, and should be writable by that account. On shared hosts, files should never be owned by the webserver process itself (sometimes this is www, or apache, or nobody user). Any file that needs write access from WordPress should be owned or group-owned by the user account used by the WordPress (which may be different than the server account). For example, you may have a user account that lets you FTP files back and forth to your server, but your server itself may run using a separate user, in a separate usergroup, such as dhapache or nobody. If WordPress is running as the FTP account, that account needs to have write access, i.e., be the owner of the files, or belong to a group that has write access. In the latter case, that would mean permissions are set more permissively than default (for example, 775 rather than 755 for folders, and 664 instead of 644). User and group are User1 (which is admin). Running "ps aux | grep httpd" is running as _www So I think this means Wordpress is running as user _www. So the advice seems contradictory: "files should never be owned by the webserver process" i.e. _www but then later it says "Any file that needs write access from WordPress should be owned or group-owned by the user account used by the WordPress" So isn't this _www again? Another search found this url http://dancingengineer.com/computing/2009/07/how-to-install-wordpress-on-mac-os-x-leopard States Which says: My preferred way to do this is to change the group of the wordpress directory and its contents to _www and give write permissions to the group. Keep the owner as your "username". $ cd /Users/"username"/Sites $ sudo chown -R username:_www wordpress_directory $ sudo chmod -R g+w wordpress_directory However, when I tried this, it did not work for automatic upgrades to newer versions of WordPress although it worked for automatically updating the .htaccess file for pretty permalinks. It is not entirely clear to me what should be done. This last suggestion seems to be saying change the group from User1 to _www and give the group write access, but Wordpress upgrades won't work. Is this the right solution? I would have thought there would be a clear way to set this up on OS X 10.6? Be great if there was a plugin that could run a script for each of the main OS's that Wordpress runs on.

    Read the article

  • Scan a Windows PC for Viruses from a Ubuntu Live CD

    - by Trevor Bekolay
    Getting a virus is bad. Getting a virus that causes your computer to crash when you reboot is even worse. We’ll show you how to clean viruses from your computer even if you can’t boot into Windows by using a virus scanner in a Ubuntu Live CD. There are a number of virus scanners available for Ubuntu, but we’ve found that avast! is the best choice, with great detection rates and usability. Unfortunately, avast! does not have a proper 64-bit version, and forcing the install does not work properly. If you want to use avast! to scan for viruses, then ensure that you have a 32-bit Ubuntu Live CD. If you currently have a 64-bit Ubuntu Live CD on a bootable flash drive, it does not take long to wipe your flash drive and go through our guide again and select normal (32-bit) Ubuntu 9.10 instead of the x64 edition. For the purposes of fixing your Windows installation, the 64-bit Live CD will not provide any benefits. Once Ubuntu 9.10 boots up, open up Firefox by clicking on its icon in the top panel. Navigate to http://www.avast.com/linux-home-edition. Click on the Download tab, and then click on the link to download the DEB package. Save it to the default location. While avast! is downloading, click on the link to the registration form on the download page. Fill in the registration form if you do not already have a trial license for avast!. By the time you’ve filled out the registration form, avast! will hopefully be finished downloading. Open a terminal window by clicking on Applications in the top-left corner of the screen, then expanding the Accessories menu and clicking on Terminal. In the terminal window, type in the following commands, pressing enter after each line. cd Downloadssudo dpkg –i avast* This will install avast! on the live Ubuntu environment. To ensure that you can use the latest virus database, while still in the terminal window, type in the following command: sudo sysctl –w kernel.shmmax=128000000 Now we’re ready to open avast!. Click on Applications on the top-left corner of the screen, expand the Accessories folder, and click on the new avast! Antivirus item. You will first be greeted with a window that asks for your license key. Hopefully you’ve received it in your email by now; open the email that avast! sends you, copy the license key, and paste it in the Registration window. avast! Antivirus will open. You’ll notice that the virus database is outdated. Click on the Update database button and avast! will start downloading the latest virus database. To scan your Windows hard drive, you will need to “mount” it. While the virus database is downloading, click on Places on the top-left of your screen, and click on your Windows hard drive, if you can tell which one it is by its size. If you can’t tell which is the correct hard drive, then click on Computer and check out each hard drive until you find the right one. When you find it, make a note of the drive’s label, which appears in the menu bar of the file browser. Also note that your hard drive will now appear on your desktop. By now, your virus database should be updated. At the time this article was written, the most recent version was 100404-0. In the main avast! window, click on the radio button next to Selected folders and then click on the “+” button to the right of the list box. It will open up a dialog box to browse to a location. To find your Windows hard drive, click on the “>” next to the computer icon. In the expanded list, find the folder labelled “media” and click on the “>” next to it to expand it. In this list, you should be able to find the label that corresponds to your Windows hard drive. If you want to scan a certain folder, then you can go further into this hierarchy and select that folder. However, we will scan the entire hard drive, so we’ll just press OK. Click on Start scan and avast! will start scanning your hard drive. If a virus is found, you’ll be prompted to select an action. If you know that the file is a virus, then you can Delete it, but there is the possibility of false positives, so you can also choose Move to chest to quarantine it. When avast! is done scanning, it will summarize what it found on your hard drive. You can take different actions on those files at this time by right-clicking on them and selecting the appropriate action. When you’re done, click Close. Your Windows PC is now free of viruses, in the eyes of avast!. Reboot your computer and with any luck it will now boot up! Alternatives to avast! If avast! and a liberal amount of Googling doesn’t fix your problem, it’s possible that a different virus scanner will fix your obscure issue. Here are a list of other virus scanners available for Ubuntu that are either free or offer free trials. See their support forums for help on installing these virus scanners. Avira AntiVir Personal for Linux / Solaris Panda Antivirus for Linux Installation and usage guide from Ubuntu F-PROT Antivirus for Linux ClamAV installation and usage guide from Ubuntu NOD32 Antivirus for Linux Kaspersky Anti-Virus 2010 Bitdefender Antivirus for Unices Conclusion Running avast! from a Ubuntu Live CD can clean the vast majority of viruses from your Windows PC. This is another reason to always have a Ubuntu Live CD ready just in case something happens to your Windows installation! Similar Articles Productive Geek Tips Secure Computing: Windows Live OneCareHow To Remove Antivirus Live and Other Rogue/Fake Antivirus MalwareUse the Windows Key for the "Start" Menu in Ubuntu LinuxScan Files for Viruses Before You Download With Dr.WebAsk the Readers: Share Your Tips for Defeating Viruses and Malware TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 The Ultimate Guide For YouTube Lovers Will it Blend? iPad Edition Penolo Lets You Share Sketches On Twitter Visit Woolyss.com for Old School Games, Music and Videos Add a Custom Title in IE using Spybot or Spyware Blaster When You Need to Hail a Taxi in NYC

    Read the article

  • Week in Geek: USDA Chooses Microsoft for Cloud Services Edition

    - by Asian Angel
    This week we learned how to create geeky LED holiday lights with old bottles, dig deeper in Windows Defrag via the command prompt, use Google Chrome’s drag/drop feature to upload files easier, find great gift recommendations by looking through the How-To Geek holiday gift guide, and have fun adding Merry Christmas fonts to our computers. Photo by ntr23. Random Geek Links It has been a busy week, so we have extra news link goodness with information that is good for you to know. USDA making the move to Microsoft The U.S. Department of Agriculture has announced that it has chosen Microsoft to host things like e-mail, instant messaging, and collaboration through the software giant’s Business Productivity Online Suite. Google says it was cut off from USDA project bid Google is claiming that it was not given a chance to bid on a cloud-computing project for the U.S. Department of Agriculture, for which the contract was awarded to rival Microsoft. Apache is being forced into a Java Fork When Oracle rolled over Apache and Google’s objections to its Java plans in December, the scene was set for Apache to leave and, eventually, force a Java code fork. Tumblr explains daylong outage After experiencing an outage that started on Sunday afternoon and stretched through most of the day yesterday, Tumblr has explained what happened. Google demos Chrome OS, launches pilot program During a press briefing this week in San Francisco, Google launched the Chrome application store and demonstrated Chrome OS, its browser-centric netbook operating system. Don’t expect Spotify in U.S. this holiday season As of last week, Spotify had yet to sign a single licensing deal with a major label, after spending more than a year negotiating, multiple music sources told CNET. December 2010 Patch Tuesday will come with most bulletins ever According to the Microsoft Security Response Center, Microsoft will issue 17 Security Bulletins addressing 40 vulnerabilities on Tuesday, December 14. It will also host a webcast to address customer questions the following day. Hacker plants back door in Symbian firmware Indian hacker Atul Alex has had a look at the firmware for Symbian S60 smartphones and come up with a back door for it. PC quarantines raise tough complexities The concept of quarantining PCs to prevent widespread infection is “interesting, but difficult to implement, with far too many problems”, said security experts. Symantec: DDoS attacks hard to defend It has surfaced that the distributed denial of service (DDoS) attacks on Visa and MasterCard Web sites on Wednesday were carried out by a toolkit known as low orbit ion cannon (LOIC). Web Sockets and the risks of unfinished standards Enthusiasm for a promising new standard called Web Sockets has quickly cooled in some quarters as a potential security problem led some browser makers to hastily postpone support. Internet Explorer 9 to get tracking protection Microsoft is making changes to Internet Explorer 9’s security features that will better enable users to keep sites from tracking their activity across browsing sessions. NASA sold PCs with sensitive data NASA failed to remove sensitive data from computers that it sold, according to an audit report released this week. Cybercrooks create fake Amazon receipts The bad guys have created yet another online scam, this one involving fake Amazon receipts. World of Warcraft character move fees waived Until December 22, Blizzard will allow free realm transfers from 25 highly populated servers to alleviate log-in queues or performance issues. (The free transfers are one-way and one-time only.) SpaceX Dragon reaches orbit atop a Falcon with a fiery tail The Space Exploration Technologies corporation has become the first nongovernmental entity to put a vehicle into low Earth orbit. Geek Video of the Week If birds have wings, then why are the Angry Birds using slingshots? Photo by Dorkly Bits. Wait… Birds have Wings, Why are the Angry Ones Using Slingshots? Sysadmin Geek Tips How To Setup Email Alerts on Linux Using Gmail or SMTP Linux machines may require administrative intervention in countless ways, but without manually logging into them how would you know about it? Here’s how to setup emails to get notified when your machines want some tender love and attention. Random TinyHacker Links Red Panda Webcam Support Firefox and the Knoxville Zoo’s Red Panda program. Christmas Icons (Icons we like) Superb set of holiday icons by lgp85 at deviantArt. Download the .zip and use as .png or convert to .ico at Convertico.com or with tiny app Imagicon. Super User Questions Enjoy reading the great answers to this week’s popular questions from Super User Useful USB boot disks? DVD/CD burning .zip: is it more reliable, faster, longer lasting to burn a zip of files rather than the files as a folder? What are other ways to backup my files if I do not have an external drive? Anti virus what is the difference between these all? How can I block all Facebook elements/content? How-To Geek Weekly Article Recap Have you had a busy week between work and preparing for the holidays? Get caught up on your HTG reading with our hottest articles of the week. 20 Windows Keyboard Shortcuts You Might Not Know The 50 Best Registry Hacks that Make Windows Better LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology HTG Explains: Which Linux File System Should You Choose? How to Use and Customize Google Chrome Web Apps One Year Ago on How-To Geek This week’s batch of retro geeky goodness is all about customizing Windows 7. ClassicShell Adds Classic Start Menu and Explorer Features to Windows 7 Get an Aero-Styled Classic Start Menu in Windows 7 Customize the Windows 7 Logon Screen Get the Classic Style Network Activity Indicator Back in Windows 7 How To Enable Check Boxes for Items In Windows 7 The Geek Note We would like you to join us in welcoming Jason Fitzpatrick to the writing staff here at How-To Geek. He started with us this past week, so take some time to read through his articles about the Wii, Kindle, & PlayStation 2 Peripherals and leave a friendly comment to say “Hi”! Got a great tip to share? Make sure to send it in to us at [email protected]. Photo by real00. Latest Features How-To Geek ETC The 50 Best Registry Hacks that Make Windows Better The How-To Geek Holiday Gift Guide (Geeky Stuff We Like) LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology The How-To Geek Guide to Learning Photoshop, Part 8: Filters Improve Digital Photography by Calibrating Your Monitor Our Favorite Tech: What We’re Thankful For at How-To Geek Settle into Orbit with the Voyage Theme for Chrome and Iron Awesome Safari Compass Icons Set Escape from the Exploding Planet Wallpaper Move Your Tumblr Blog to WordPress Pytask is an Easy to Use To-Do List Manager for Your Ubuntu System Snowy Christmas House Personas Theme for Firefox

    Read the article

  • Top 10 Reasons SQL Developer is Perfect for Oracle Beginners

    - by thatjeffsmith
    Learning new technologies can be daunting. If you’ve never used a Mac before, you’ll probably be a bit baffled at first. But, you’re probably at least coming from a desktop computing background (Windows), so you common frame of reference. But what if you’re just now learning to use a relational database? Yes, you’ve played with Access a bit, but now your employer or college instructor has charged you with becoming proficient with Oracle database. Here’s 10 reasons why I think Oracle SQL Developer is the perfect vehicle to help get you started. 1. It’s free No need to break into one of these… No start-up costs, no need to wrangle budget dollars from your company. Students don’t have any money after books and lab fees anyway. And most employees don’t like having to ask for ‘special’ software anyway. So avoid all of that and make sure the free stuff doesn’t suit your needs first. Upgrades are available on a regular base, also at no cost, and support is freely available via our public forums. 2. It will run pretty much anywhere Windows – check. OSX (Apple) – check. Unix – check. Linux – check. No need to start up a windows VM to run your Windows-only software in your lab machine. 3. Anyone can install it There’s no installer, no registry to be updated, no admin privs to be obtained. If you can download and extract files to your machine or USB storage device, you can run it. You can be up and running with SQL Developer in under 5 minutes. Here’s a video tutorial to see how to get started. 4. It’s ubiquitous I admit it, I learned a new word yesterday and I wanted an excuse to use it. SQL Developer’s everywhere. It’s had over 2,500,000 downloads in the past year, and is the one of the most downloaded items from OTN. This means if you need help, there’s someone sitting nearby you that can assist, and since they’re in the same tool as you, they’ll be speaking the same language. 5. Simple User Interface Up-up-down-down-Left-right-left-right-A-B-A-B-START will get you 30 lives, but you already knew that, right? You connect, you see your objects, you click on your objects. Or, you can use the worksheet to write your queries and programs in. There’s only one toolbar, and just a few buttons. If you’re like me, video games became less fun when each button had 6 action items mapped to it. I just want the good ole ‘A’, ‘B’, ‘SELECT’, and ‘START’ controls. If you’re new to Oracle, you shouldn’t have the double-workload of learning a new complicated tool as well. 6. It’s not a ‘black box’ Click through your objects, but also get the SQL that drives the GUI As you use the wizards to accomplish tasks for you, you can view the SQL statement being generated on your behalf. Just because you have a GUI, doesn’t mean you’re ceding your responsibility to learn the underlying code that makes the database work. 7. It’s four tools in one It’s not just a query tool. Maybe you need to design a data model first? Or maybe you need to migrate your Sybase ASE database to Oracle for a new project? Or maybe you need to create some reports? SQL Developer does all of that. So once you get comfortable with one part of the tool, the others will be much easier to pick up as your needs change. 8. Great learning resources available Videos, blogs, hands-on learning labs – you name it, we got it. Why wait for someone to train you, when you can train yourself at your own pace? 9. You can use it to teach yourself SQL Instead of being faced with the white-screen-of-panic, you can visually build your queries by dragging and dropping tables and views into the Query Builder. Yes, ‘just like Access’ – only better. And as you build your query, toggle to the Worksheet panel and see the SQL statement. Again, SQL Developer is not a black box. If you prefer to learn by trial and error, the worksheet will attempt to suggest the next bit of your SQL statement with it’s completion insight feature. And if you have syntax errors, those will be highlighted – just like your misspelled words in your favorite word processor. 10. It scales to match your experience level You won’t be a n00b forever. In 6-8 months, when you’re ready to tackle something a bit more complicated, like XML DB or Oracle Spatial, the tool is already there waiting on you. No need to go out and find the ‘advanced’ tool. 11. Wait, you said this was a ‘Top 10′ list? Yes. Yes, I did. I’m using this ‘trick’ to get you to continue reading because I’m going to say something you might not want to hear. Are you ready? Tools won’t replace experience, failure, hard work, and training. Just because you have the keys to the car, doesn’t mean you’re ready to head out on the race track. While SQL Developer reduces the barriers to entry, it does not completely remove them. Many experienced folks simply do not like tools. Rather, they don’t like the people that pick up tools without the know-how to properly use them. If you don’t understand what ‘TRUNCATE’ means, don’t try it out. Try picking up a book first. Of course, it’s very nice to have your own sandbox to play in, so you don’t upset the other children. That’s why I really like our Dev Days Database Virtual Box image. It’s your own database to learn and experiment with.

    Read the article

  • Introducing Oracle VM Server for SPARC

    - by Honglin Su
    As you are watching Oracle's Virtualization Strategy Webcast and exploring the great virtualization offerings of Oracle VM product line, I'd like to introduce Oracle VM Server for SPARC --  highly efficient, enterprise-class virtualization solution for Sun SPARC Enterprise Systems with Chip Multithreading (CMT) technology. Oracle VM Server for SPARC, previously called Sun Logical Domains, leverages the built-in SPARC hypervisor to subdivide supported platforms' resources (CPUs, memory, network, and storage) by creating partitions called logical (or virtual) domains. Each logical domain can run an independent operating system. Oracle VM Server for SPARC provides the flexibility to deploy multiple Oracle Solaris operating systems simultaneously on a single platform. Oracle VM Server also allows you to create up to 128 virtual servers on one system to take advantage of the massive thread scale offered by the CMT architecture. Oracle VM Server for SPARC integrates both the industry-leading CMT capability of the UltraSPARC T1, T2 and T2 Plus processors and the Oracle Solaris operating system. This combination helps to increase flexibility, isolate workload processing, and improve the potential for maximum server utilization. Oracle VM Server for SPARC delivers the following: Leading Price/Performance - The low-overhead architecture provides scalable performance under increasing workloads without additional license cost. This enables you to meet the most aggressive price/performance requirement Advanced RAS - Each logical domain is an entirely independent virtual machine with its own OS. It supports virtual disk mutipathing and failover as well as faster network failover with link-based IP multipathing (IPMP) support. Moreover, it's fully integrated with Solaris FMA (Fault Management Architecture), which enables predictive self healing. CPU Dynamic Resource Management (DRM) - Enable your resource management policy and domain workload to trigger the automatic addition and removal of CPUs. This ability helps you to better align with your IT and business priorities. Enhanced Domain Migrations - Perform domain migrations interactively and non-interactively to bring more flexibility to the management of your virtualized environment. Improve active domain migration performance by compressing memory transfers and taking advantage of cryptographic acceleration hardware. These methods provide faster migration for load balancing, power saving, and planned maintenance. Dynamic Crypto Control - Dynamically add and remove cryptographic units (aka MAU) to and from active domains. Also, migrate active domains that have cryptographic units. Physical-to-virtual (P2V) Conversion - Quickly convert an existing SPARC server running the Oracle Solaris 8, 9 or 10 OS into a virtualized Oracle Solaris 10 image. Use this image to facilitate OS migration into the virtualized environment. Virtual I/O Dynamic Reconfiguration (DR) - Add and remove virtual I/O services and devices without needing to reboot the system. CPU Power Management - Implement power saving by disabling each core on a Sun UltraSPARC T2 or T2 Plus processor that has all of its CPU threads idle. Advanced Network Configuration - Configure the following network features to obtain more flexible network configurations, higher performance, and scalability: Jumbo frames, VLANs, virtual switches for link aggregations, and network interface unit (NIU) hybrid I/O. Official Certification Based On Real-World Testing - Use Oracle VM Server for SPARC with the most sophisticated enterprise workloads under real-world conditions, including Oracle Real Application Clusters (RAC). Affordable, Full-Stack Enterprise Class Support - Obtain worldwide support from Oracle for the entire virtualization environment and workloads together. The support covers hardware, firmware, OS, virtualization, and the software stack. SPARC Server Virtualization Oracle offers a full portfolio of virtualization solutions to address your needs. SPARC is the leading platform to have the hard partitioning capability that provides the physical isolation needed to run independent operating systems. Many customers have already used Oracle Solaris Containers for application isolation. Oracle VM Server for SPARC provides another important feature with OS isolation. This gives you the flexibility to deploy multiple operating systems simultaneously on a single Sun SPARC T-Series server with finer granularity for computing resources.  For SPARC CMT processors, the natural level of granularity is an execution thread, not a time-sliced microsecond of execution resources. Each CPU thread can be treated as an independent virtual processor. The scheduler is naturally built into the CPU for lower overhead and higher performance. Your organizations can couple Oracle Solaris Containers and Oracle VM Server for SPARC with the breakthrough space and energy savings afforded by Sun SPARC Enterprise systems with CMT technology to deliver a more agile, responsive, and low-cost environment. Management with Oracle Enterprise Manager Ops Center The Oracle Enterprise Manager Ops Center Virtualization Management Pack provides full lifecycle management of virtual guests, including Oracle VM Server for SPARC and Oracle Solaris Containers. It helps you streamline operations and reduce downtime. Together, the Virtualization Management Pack and the Ops Center Provisioning and Patch Automation Pack provide an end-to-end management solution for physical and virtual systems through a single web-based console. This solution automates the lifecycle management of physical and virtual systems and is the most effective systems management solution for Oracle's Sun infrastructure. Ease of Deployment with Configuration Assistant The Oracle VM Server for SPARC Configuration Assistant can help you easily create logical domains. After gathering the configuration data, the Configuration Assistant determines the best way to create a deployment to suit your requirements. The Configuration Assistant is available as both a graphical user interface (GUI) and terminal-based tool. Oracle Solaris Cluster HA Support The Oracle Solaris Cluster HA for Oracle VM Server for SPARC data service provides a mechanism for orderly startup and shutdown, fault monitoring and automatic failover of the Oracle VM Server guest domain service. In addition, applications that run on a logical domain, as well as its resources and dependencies can be controlled and managed independently. These are managed as if they were running in a classical Solaris Cluster hardware node. Supported Systems Oracle VM Server for SPARC is supported on all Sun SPARC Enterprise Systems with CMT technology. UltraSPARC T2 Plus Systems ·   Sun SPARC Enterprise T5140 Server ·   Sun SPARC Enterprise T5240 Server ·   Sun SPARC Enterprise T5440 Server ·   Sun Netra T5440 Server ·   Sun Blade T6340 Server Module ·   Sun Netra T6340 Server Module UltraSPARC T2 Systems ·   Sun SPARC Enterprise T5120 Server ·   Sun SPARC Enterprise T5220 Server ·   Sun Netra T5220 Server ·   Sun Blade T6320 Server Module ·   Sun Netra CP3260 ATCA Blade Server Note that UltraSPARC T1 systems are supported on earlier versions of the software.Sun SPARC Enterprise Systems with CMT technology come with the right to use (RTU) of Oracle VM Server, and the software is pre-installed. If you have the systems under warranty or with support, you can download the software and system firmware as well as their updates. Oracle Premier Support for Systems provides fully-integrated support for your server hardware, firmware, OS, and virtualization software. Visit oracle.com/support for information about Oracle's support offerings for Sun systems. For more information about Oracle's virtualization offerings, visit oracle.com/virtualization.

    Read the article

  • Thursday Community Keynote: "By the Community, For the Community"

    - by Janice J. Heiss
    Sharat Chander, JavaOne Community Chairperson, began Thursday's Community Keynote. As part of the morning’s theme of "By the Community, For the Community," Chander noted that 60% of the material at the 2012 JavaOne conference was presented by Java Community members. "So next year, when the call for papers starts, put-in your submissions," he urged.From there, Gary Frost, Principal Member of Technical Staff, AMD, expanded upon Sunday's Strategy Keynote exploration of Project Sumatra, an OpenJDK project targeted at bringing Java to heterogeneous computing platforms (which combine the CPU and the parallel processor of the GPU into a single piece of silicon). Sumatra entails enhancing the JVM to make maximum use of these advanced platforms. Within this development space, AMD created the Aparapi API, which converts Java bytecode into OpenCL for execution on such GPU devices. The Aparapi API was open sourced in September 2011.Whether it was zooming-in on a Mandelbrot set, "the game of life," or a swarm of 10,000 Dukes in a space-bound gravitational dance, Frost's demos, using an Aparapi/OpenCL implementation, produced stunningly faster display results. He indicated that the Java 9 timeframe is where they see Project Sumatra coming to ultimate fruition, employing the Lamdas of Java 8.Returning to the theme of the keynote, Donald Smith, Director, Java Product Management, Oracle, explored a mind map graphic demonstrating the importance of Community in terms of fostering innovation. "It's the sharing and mixing of culture, the diversity, and the rapid prototyping," he said. Within this topic, Smith, brought up a panel of representatives from Cloudera, Eclipse, Eucalyptus, Perrone Robotics, and Twitter--ideal manifestations of community and innovation in the world of Java.Marten Mickos, CEO, Eucalyptus Systems, explored his company's open source cloud software platform, written in Java, and used by gaming companies, technology companies, media companies, and more. Chris Aniszczyk, Operations Engineering,Twitter, noted the importance of the JVM in terms of their multiple-language development environment. Mike Olson, CEO, Cloudera, described his company's Apache Hadoop-based software, support, and training. Mike Milinkovich, Executive Director, Eclipse Foundation, noted that they have about 270 tools projects at Eclipse, with 267 of them written in Java. Milinkovich added that Eclipse will even be going into space in 2013, as part of the control software on various experiments aboard the International Space Station. Lastly, Paul Perrone, CEO, Perrone Robotics, detailed his company's robotics and automation software platform built 100% on Java, including Java SE and Java ME--"on rat, to cat, to elephant-sized systems." Milinkovic noted that communities are by nature so good at innovation because of their very openness--"The more open you make your innovation process, the more ideas are challenged, and the more developers are focused on justifying their choices all the way through the process."From there, Georges Saab, VP Development Java SE OpenJDK, continued the topic of innovation and helping the Java Community to "Make the Future Java." Martijn Verburg, representing the London Java Community (winner of a Duke's Choice Award 2012 for their activity in OpenJDK and JCP), soon joined Saab onstage. Verburg detailed the LJC's "Adopt a JSR" program--"to get day-to-day developers more involved in the innovation that's happening around them."  From its London launching pad, the innovative program has spread to Brazil, Morocco, Latvia, India, and more.Other active participants in the program joined Verburg onstage--Ben Evans, London Java Community; James Gough, Stackthread; Bruno Souza, SOUJava; Richard Warburton, jClarity; and Cecelia Borg, Oracle--OpenJDK Onboarding. Together, the group explored the goals and tasks inherent in the Adopt a JSR program--from organizing hack days (testing prototype implementations), to managing mailing lists and forums, to triaging issues, to evangelism—all with the goal of fostering greater community/developer involvement, but equally importantly, building better open standards. “Come join us, and make your ecosystem better!" urged Verburg.Paul Perrone returned to profile the latest in his company's robotics work around Java--including the AARDBOTS family of smaller robotic vehicles, running the Perrone MAX platform on top of the Java JVM. Perrone took his "Rumbles" four-wheeled robot out for a spin onstage--a roaming, ARM-based security-bot vehicle, complete with IR, ultrasonic, and "cliff" sensors (the latter, for the raised stage at JavaOne). As an ultimate window into the future of robotics, Perrone displayed a "head-set" controller--a sensor directed at the forehead to monitor brainwaves, for the someday-implementation of brain-to-robot control.Then, just when it seemed this might be the end of the day's futuristic offerings, a mystery voice from offstage pronounced "I've got some toys"--proving to be guest-visitor James Gosling, there to explore his cutting-edge work with Liquid Robotics. While most think of robots as something with wheels or arms or lasers, Gosling explained, the Liquid Robotics vehicle is an entirely new and innovative ocean-going 'bot. Looking like a floating surfboard, with an attached set of underwater wings, the autonomous devices roam the oceans using only the energy of ocean waves to propel them, and a single actuated rudder to steer. "We have to accomplish all guidance just by wiggling the rudder," Gosling said. The devices offer applications from self-installing weather buoy, to pollution monitoring station, to marine mammal monitoring device, to climate change data gathering, to even ocean life genomic sampling. The early versions of the vehicle used C code on very tiny industrial micro controllers, where they had to "count the bytes one at a time."  But the latest generation vehicles, which just hit the water a week or so ago, employ an ARM processor running Linux and the ARM version of JDK 7. Gosling explained that vehicle communication from remote locations is achieved via the Iridium satellite network. But because of the costs of this communication path, the data must be sent in very small bursts--using SBD short burst data. "It costs $1/kb, so that rules everything in the software design,” said Gosling. “If you were trying to stream a Netflix video over this, it would cost a million dollars a movie. …We don't have a 'big data' problem," he quipped. There are currently about 150 Liquid Robotics vehicles out traversing the oceans. Gosling demonstrated real time satellite tracking of several vehicles currently at sea, noting that Java is actually particularly good at AI applications--due to the language having garbage collection, which facilitates complex data structures. To close-out his time onstage, Gosling of course participated in the ceremonial Java tee-shirt toss out to the audience…In parting, Chander passed the JavaOne Community Chairperson baton to Stephen Chin, Java Technology Evangelist, Oracle. Onstage in full motorcycle gear, Chin noted that he'll soon be touring Europe by motorcycle, meeting Java Community Members and streaming live via UStream--the ultimate manifestation of community and technology!  He also reminded attendees of the upcoming JavaOne Latin America 2012, São Paulo, Brazil (December 4-6, 2012), and stated that the CFP (call for papers) at the conference has been extended for one more week. "Remember, December is summer in Brazil!" Chin said.

    Read the article

  • Hey, Google: It’s Time to Add Multi-Window Multitasking To Android

    - by Chris Hoffman
    In 2012, Google’s Dianne Hackborn threatened to revoke CyanogenMod’s access to the Android Market if they moved forward with adding “Cornerstone” multitasking to their custom ROM. Samsung has since created their own multi-window multitasking feature. Dianne Hackborn said this “is something that needs to be done at the mainline platform level” so apps wouldn’t break. She was right — Android needs this as a standard feature and it’s time for Google to provide it. Doesn’t Android Have Multitasking? Android originally stood out from Apple’s iOS with its powerful multitasking. Applications can continue running in the background while you’re using another application. This makes Android powerful — you can even have BitTorrent clients downloading files in the background while using another app. Android still kept the design of a single app on screen at a time. This made a lot of sense when Android only ran on smartphones with small screens. Today, Android runs on everything from smaller smartphones all the way up to huge “phablets” like the Galaxy Note. Android has gone beyond phones and runs on 12-inch tablets, convertibles with keyboard docks, laptops, and even Android desktops. Android isn’t just a phone operating system. Samsung’s Multi-Window Isn’t Good Enough Samsung has tried to add value to Android by adding a multi-window feature. When you’re using a high-end phone like the Galaxy Note or Galaxy S, or a Galaxy tablet, you have the ability to run certain apps side-by-side with each other. There are big problems here. This only works on Samsung devices, and only on specific Samsung devices. To add support for this feature in a way that doesn’t break other apps, Samsung’s multi-window feature also only works with specific apps. You can’t just run any app in multi-window view, only the apps on the Multi Window bar Samsung provides. This prevents third-party apps from breaking, which is what Google was worried about with CyanogenMod’s Cornerstone feature. A feature that only works with a handful of apps on specific devices from a single manufacturer isn’t good enough. This feature needs to work on every Android device — or at least ones with suitably large screens and powerful enough internals. It needs to be an Android platform feature so application developers can ensure their apps will work properly with it on every device. Android developers shouldn’t have to add support for each manufacturer’s own multi-window feature if other manufacturers decide to copy Samsung. Floating Apps Are a Dirty Hack Floating apps also enable real multitasking. Remember that Android allows apps to run in the background while you’re using an app in the foreground. These apps can present interfaces that appear floating above the current app — think of it like using “always on top” to make a window always appear over every other app on a desktop operating system. You can install floating apps to browse the web, take notes, chat, and watch videos while using any app. Only apps specifically designed to run as floating apps will work, so you have to seek them out. Floating apps are also awkward to use because they float over the app you’re using, blocking parts of its interface. Microsoft added floating-window support to Skype for Android. You can have a video conversation and the other person’s face will always appear on your screen, even when you leave the Skype app. Microsoft is using more of Android’s multi-window multitasking power than Google is. Custom ROMs and Root-Only Tweaks Aren’t Acceptable Some custom ROMs are adding this feature to Android. Google threatened to revoke CyanogenMod’s access to the Android Market (now known as Google Play) if they added this feature because it could potentially break third-party apps. Today, other custom ROMs are working on split-screen multitasking. Samsung added their own version to their own devices. You can also get this feature by using a root-only Xposed Framework tweak known as XMultiWindow. If you have root access, you can get multi-window multitasking or any app on your device. This shouldn’t require rooting your device or installing a custom ROM. These third-party solutions often have awkward interfaces and bugs. We need an integrated, supported solution that works the same on every device. Why Multi-Window is Important Microsoft’s Windows 8.1 stands out among tablet operating systems for its powerful multitasking support, allowing you to view several apps side-by-side at the same time. Apple is also reported to be working on adding side-by-side apps to the iPad with iOS 8. On every competitor’s operating system, you’ll be able to view a web page while you write an email, watch a video while you browse the web, or chat with someone while you do anything else. But Android’s still remained frozen in time. Despite all Android’s underlying power — and despite the way Android allows apps to adapt to different screen sizes — Google is resisting adding this feature. Large-screen Android tablets like the Nexus 10 (remember that tablet Google hasn’t updated in over 18 months?) need this feature. So do huge phones, convertibles, laptops, and Android desktops. If tablets are the future of personal computing, we should be able to do more than one thing at a time on our tablets’ big screens. Microsoft, Samsung, and even Apple are realizing this — now it’s Google’s turn. Image Credit: Sergey Galyonkin on Flickr, Karlis Dambrans on Flickr

    Read the article

  • Using a "white list" for extracting terms for Text Mining

    - by [email protected]
    In Part 1 of my post on "Generating cluster names from a document clustering model" (part 1, part 2, part 3), I showed how to build a clustering model from text documents using Oracle Data Miner, which automates preparing data for text mining. In this process we specified a custom stoplist and lexer and relied on Oracle Text to identify important terms.  However, there is an alternative approach, the white list, which uses a thesaurus object with the Oracle Text CTXRULE index to allow you to specify the important terms. INTRODUCTIONA stoplist is used to exclude, i.e., black list, specific words in your documents from being indexed. For example, words like a, if, and, or, and but normally add no value when text mining. Other words can also be excluded if they do not help to differentiate documents, e.g., the word Oracle is ubiquitous in the Oracle product literature. One problem with stoplists is determining which words to specify. This usually requires inspecting the terms that are extracted, manually identifying which ones you don't want, and then re-indexing the documents to determine if you missed any. Since a corpus of documents could contain thousands of words, this could be a tedious exercise. Moreover, since every word is considered as an individual token, a term excluded in one context may be needed to help identify a term in another context. For example, in our Oracle product literature example, the words "Oracle Data Mining" taken individually are not particular helpful. The term "Oracle" may be found in nearly all documents, as with the term "Data." The term "Mining" is more unique, but could also refer to the Mining industry. If we exclude "Oracle" and "Data" by specifying them in the stoplist, we lose valuable information. But it we include them, they may introduce too much noise. Still, when you have a broad vocabulary or don't have a list of specific terms of interest, you rely on the text engine to identify important terms, often by computing the term frequency - inverse document frequency metric. (This is effectively a weight associated with each term indicating its relative importance in a document within a collection of documents. We'll revisit this later.) The results using this technique is often quite valuable. As noted above, an alternative to the subtractive nature of the stoplist is to specify a white list, or a list of terms--perhaps multi-word--that we want to extract and use for data mining. The obvious downside to this approach is the need to specify the set of terms of interest. However, this may not be as daunting a task as it seems. For example, in a given domain (Oracle product literature), there is often a recognized glossary, or a list of keywords and phrases (Oracle product names, industry names, product categories, etc.). Being able to identify multi-word terms, e.g., "Oracle Data Mining" or "Customer Relationship Management" as a single token can greatly increase the quality of the data mining results. The remainder of this post and subsequent posts will focus on how to produce a dataset that contains white list terms, suitable for mining. CREATING A WHITE LIST We'll leverage the thesaurus capability of Oracle Text. Using a thesaurus, we create a set of rules that are in effect our mapping from single and multi-word terms to the tokens used to represent those terms. For example, "Oracle Data Mining" becomes "ORACLEDATAMINING." First, we'll create and populate a mapping table called my_term_token_map. All text has been converted to upper case and values in the TERM column are intended to be mapped to the token in the TOKEN column. TERM                                TOKEN DATA MINING                         DATAMINING ORACLE DATA MINING                  ORACLEDATAMINING 11G                                 ORACLE11G JAVA                                JAVA CRM                                 CRM CUSTOMER RELATIONSHIP MANAGEMENT    CRM ... Next, we'll create a thesaurus object my_thesaurus and a rules table my_thesaurus_rules: CTX_THES.CREATE_THESAURUS('my_thesaurus', FALSE); CREATE TABLE my_thesaurus_rules (main_term     VARCHAR2(100),                                  query_string  VARCHAR2(400)); We next populate the thesaurus object and rules table using the term token map. A cursor is defined over my_term_token_map. As we iterate over  the rows, we insert a synonym relationship 'SYN' into the thesaurus. We also insert into the table my_thesaurus_rules the main term, and the corresponding query string, which specifies synonyms for the token in the thesaurus. DECLARE   cursor c2 is     select token, term     from my_term_token_map; BEGIN   for r_c2 in c2 loop     CTX_THES.CREATE_RELATION('my_thesaurus',r_c2.token,'SYN',r_c2.term);     EXECUTE IMMEDIATE 'insert into my_thesaurus_rules values                        (:1,''SYN(' || r_c2.token || ', my_thesaurus)'')'     using r_c2.token;   end loop; END; We are effectively inserting the token to return and the corresponding query that will look up synonyms in our thesaurus into the my_thesaurus_rules table, for example:     'ORACLEDATAMINING'        SYN ('ORACLEDATAMINING', my_thesaurus)At this point, we create a CTXRULE index on the my_thesaurus_rules table: create index my_thesaurus_rules_idx on        my_thesaurus_rules(query_string)        indextype is ctxsys.ctxrule; In my next post, this index will be used to extract the tokens that match each of the rules specified. We'll then compute the tf-idf weights for each of the terms and create a nested table suitable for mining.

    Read the article

  • WWDC and Tech Ed: A Tale of Two DevCons

    - by andrewbrust
    Next week marks the first full week of June.  Summer will feel in full swing and it will be a pretty big season for technology.  In seeming acknowledgement of that very fact, both Apple and Microsoft will be holding large developers conferences starting Monday.  Apple will hold its annual Worldwide Developers Conference (WWDC) in lovely San Francisco and Microsoft will hold its Tech Ed conference in muggy, oil-laden yet soulful New Orleans.  A brief survey of each show reveals much about the differences in each company’s offerings, strategy, and approach to customers and partners. In the interest of full disclosure, I must explain that I will be speaking at Microsoft’s Tech Ed show, and have done so, on and off, since 2003.  I have never been to an Apple conference and, as readers of this blog may know, I acquired my first ever Apple product 2 months ago when I bought an iPad on the day of that product’s launch.  I think I have keen insights into Microsoft’s conference.  My ability to comment on Apple’s event ranges somewhere between backseat driver and naive observer.  Just so you know. Although both shows cater to their respective company’s developers, there are a number of differences in the events’ purposes and content approaches.  First off, let’s consider each show as a news and PR vehicle.  WWDC will feature Steve Jobs’ keynote address and most likely will be where Apple officially reveals details of its 4th-generation iPhone. Jobs will likely also provide deep background information on the corresponding iPhone OS release.  These presumed announcements will make the show a magnet for the tech press and tech blogger elite.  Apple’s customers will be interested too, especially since the iPhone OS release will likely be made available to owners of existing iPhone, iPod Touch and iPad devices. Tech Ed, on the other hand, may not be especially newsworthy at all.  The keynote address will be given by Bob Muglia, who is President of the company’s Server and Tools Division, and he’ll likely be reviewing things more than previewing them. That’s because the company has, in the last 6-8 months, already released new versions of a majority of its products, including Windows, Office, SharePoint, SQL Server, Exchange, its Azure cloud platform, its .NET software development layer, its Silverlight Rich Internet Application (RIA) technology and its Visual Studio developer suite.  Redmond’s product pipeline has functioned more like a firehose of late, and the company has a ton of work to do to get developers up to speed on everything that’s new. I know I keep saying “developers,” but in Tech Ed’s case, that’s not really accurate.  In North America, Tech Ed caters to both developers and IT pros (i.e. technologists who work with physical IT infrastructure, as well as security and administration of the server software that runs on it).  This pairing has, since its inception, struck some as anomalous and others, including many exhibitors, as very smart. Certainly, it means Tech Ed ends up being a confab for virtually all professionals in Microsoft’s ecosystem.  And this year, Microsoft’s Business Intelligence (BI) conference will be co-located with Tech Ed, further enhancing that fusion effect. Clearly then, Microsoft’s show will focus on education, as its name assures us.  Apple’s will serve as both a press event and an opportunity to get its own App Store developer channel synced up with its newest technology advances.  For example, we already know that iPhone OS 4.0 will provide for a limited multitasking capability; that will only work well if people know how to code to it in a capable way.  Apple also told us its iAd advertising platform will be part of the new OS, and Steve Jobs insists that’s to provide a revenue opportunity for developers.  This too, then, needs to be explicated and soaked up buy the faithful. A look at each show’s breakout session lineup provides some interesting takeaways.  WWDC will have very few Mac-specific sessions on offer, and virtually no sessions that at are IT- or “Enterprise-“ related.  It’s all about the phone, music players and tablets.  However, WWDC will have plenty of low-level, hardcore tech coverage of such things as Advanced Memory Analysis and Creating Secure Applications, as well as lots of rich media-related content like Core Animation and Game Design and Development.  Beyond Apple’s proprietary platform, WWDC will also feature an array of sessions on HTML 5 and other Web standards.  In all, WWDC offers over 100 technical sessions and hands-on labs. What about Tech Ed’s editorial content?  Like the target audience, it really runs the gamut.  The show has 21 tracks (versus WWDC’s 5) and more than 745 “learning opportunities” which include breakout sessions, demo stations, hands-on labs and BIrds of a Feather discussion sessions.  Topics range from Architecture talks like Patterns of Parallel Programming to cloud computing talks like Building High Capacity Compute Applications with Windows Azure to IT-focused topics like Virtualization of Microsoft SharePoint 2010 Farm Architecture.  I also count 19 sessions on Windows Phone 7.  Unfortunately, with regard to Web standards and HTML 5, only a few sessions are offered, all of them specific to Internet Explorer. All-in-all, Apple’s show looks more exciting and “sexier” than Tech Ed. Microsoft’s show seems a lot more enterprise-focused than WWDC. This is, of course, well in sync with each company’s approach and products.  Microsoft’s content is much wider ranging and bests WWDC in sheer volume of sessions and labs.  I suppose some might argue that less is more; others that Apple’s consumer-focused offerings simply don’t provide for the same depth of coverage to a business audience.  Microsoft has a serious focus on the cloud and  a paucity of coverage on client-side Web standards; Apple has virtually no cloud offering at all.  Again, this reflects each tech titan’s go-to-market strategy. My own take is that employees of each company should attend the other’s event.  The amount of mutual exclusivity in content may make sense in terms of corporate philosophy, but the reality is that each company could stand to diversify into the other’s territory, at least somewhat. My own talk at Tech Ed will focus on competitive analysis around Microsoft’s BI products.  Apple does not today figure into that analysis. Maybe one day it will.

    Read the article

  • Visiting the Emtel Data Centre

    Back in February at the first event of the Emtel Knowledge Series (EKS) I spoke to various people at Emtel about their data centre here on the island. I was trying to see whether it would be possible to arrange a meeting over there for a selected group of our community members. Well, let's say it like this... My first approach wasn't that promising and far from successful but during the following months there were more and more occasions to get in touch with the "right" contact persons at Emtel to make it happen... Setting up an appointment and pre-requisites The major improvement came during a Boot Camp for Windows Phone 8.1 App development organised by Microsoft Indian Ocean Islands in cooperation with Emtel at the Emtel World, Ebene. Apart from learning bits and pieces regarding Universal Apps I took the opportunity to get in touch with Arvin Lockee, Sales Executive - Data, during our lunch break. And this really kicked off the whole procedure. Prior to get access to the Emtel data centre it is requested that you provide full name and National ID of anyone going to visit. Also, it should be noted that there was only a limited amount of seats available. Anyways, packed with this information I posted through the usual social media channels. Responses came in very quickly and based on First-come, first-serve (FCFS) principle I noted down the details and forwarded them to Emtel in order to fix a date and time for the visit. In preparation on our side, all attendees exchanged contact details and we organised transport options to go to the data centre in Arsenal. The day before and on the day of our meeting, Arvin send me a reminder to check whether everything is still confirmed and ready to go... Of course, it was! Arriving at the Emtel Data Centre As I'm coming from Flic En Flac towards the North, we agreed that I'm going to pick up a couple of young fellows near the old post office in Port Louis. All went well, except that Sean eventually might be living in another time zone compared to the rest of us. Anyway, after some extended stop we were complete and arrived just in time in Arsenal to meet and greet with Ish and Veer. Again, Emtel is taking access procedures to their data centre very serious and the gate stayed close until all our IDs had been noted and compared to the list of registered attendees. Despite having a good laugh at the mixture of old and new ID cards it was a straight-forward processing. The ward was very helpful and guided us to the waiting area at the entrance section of the building. Shortly after we were welcomed by Kamlesh Bokhoree, the Data Centre Officer. He gave us brief introduction into the rules and regulations during our visit, like no photography allowed, not touching the buttons, and following his instructions through the whole visit. Of course! Inside the data centre Next, he explained us the multi-factor authentication system using a combination of bio-metric data, like finger print reader, and "classic" pin panel. The Emtel data centre provides multiple services and next to co-location for your own hardware they also offer storage options for your backup and archive data in their massive, fire-resistant vault. Very impressive to get to know about the considerations that have been done in choosing the right location and how to set up the whole premises. It should also be noted that there is 24/7 CCTV surveillance inside and outside the buildings. Strengths of the Emtel TIER 3 Data Centre, Mauritius Finally, we were guided into the first server room. And wow, the whole setup is cleverly planned and outlined in the architecture. From the false floor and ceilings in order to provide optimum air flow, over to the separation of cold and hot aisles between the full-size server racks, and of course the monitored air conditions in order to analyse and watch changes in temperature, smoke detection and other parameters. And not surprisingly everything has been implemented in two independent circuits. There is a standardised classification for the construction and operation of data centres world-wide, and the Emtel's one has been designed to be a TIER 4 building but due to the lack of an alternative power supplier on the island it is officially registered as a TIER 3 compliant data centre. Maybe in the long run there might be a second supplier of energy next to CEB... time will tell. Luckily, the data centre is integrated into the National Fibre Optic Gigabit Ring and Emtel already connects internationally through diverse undersea cable routes like SAFE & LION/LION2 out of Mauritius and through several other providers for onwards connectivity. The data centre is part of the National Fibre Optic Gigabit Ring and has redundant internet connectivity onwards. Meanwhile, Arvin managed to join our little group of geeks and he supported Kamlesh in answering our technical questions regarding the capacities and general operation of the data centre. Visiting the NOC and its dedicated team of IT professionals was surely one of the visual highlights. Seeing their wall of screens to monitor any kind of activities on the data lines, the managed servers and the activity in and around the building was great. Even though I'm using a multi-head setup since years I cannot keep it up with that setup... ;-) But I got a couple of ideas on how to improve my work spaces here at the office. Clear advantages of hosting your e-commerce and mobile backends locally After the completely isolated NOC area we continued our Q&A session with Kamlesh and Arvin in the second server room which is dedictated to shared environments. On first thought it should be well-noted that there is lots of space for full-sized racks and therefore co-location of your own hardware. Actually, given the feedback that there will be upcoming changes in prices the facilities at the Emtel data centre are getting more and more competitive and interesting for local companies, especially small and medium enterprises. After seeing this world-class infrastructure available on the island, I'm already considering of moving one of my root servers abroad to be co-located here on the island. This would provide an improved user experience in terms of site performance and latency. This would be a good improvement, especially for upcoming e-commerce solutions for two of my local clients. Later on, we actually started the conversation of additional services that could be a catalyst for the local market in order to attract more small and medium companies to take the data centre into their evaluations regarding online activities. Until today Emtel does not provide virtualised server environments but there might be ongoing plans in the future to cover this field as well. Emtel is a mobile operator and internet connectivity provider in the first place, entering a market of managed and virtualised server infrastructures including capacities in terms of cloud storage and computing are rather new and there is a continuous learning curve at Emtel, too. You cannot just jump into a new market and see how it works out... And I appreciate Emtel's approach towards a solid fundament and then building new services on top of that. Emtel as a future one-stop-shop service provider for all your internet and telecommunications needs. Emtel's promotional video about their TIER 3 data centre in Arsenal, Mauritius More details are thoroughly described in Emtel's brochure of their data centre. Check out their PDF document here. Thanks for this opportunity Visiting and walking through the Emtel data centre for more than 2 hours was a great experience. As representative of the Mauritius Software Craftsmanship Community (MSCC) I would like to thank anyone at Emtel involved in the process of making it happen, and especially to Arvin Lockee and Kamlesh Bokhoree for their time and patience in explaining the infrastructure and answering all the endless questions from our members. Thank You!

    Read the article

< Previous Page | 71 72 73 74 75 76 77 78 79  | Next Page >