Search Results

Search found 65206 results on 2609 pages for 'real time'.

Page 768/2609 | < Previous Page | 764 765 766 767 768 769 770 771 772 773 774 775  | Next Page >

• Adding a search box to a windows forms web browser control that highlights text

  - by evan

  I have a windows forms (using c#) application. It displays a webpage and has a textbox/botton combination which can be used to search for text displayed to the user. Currently I search the inner text of all elements for the text in the textbox. And then I weed out the elements that are redundant (for example a word could be in a 'p' and 'b' element where the 'b' is a child element of 'p' so the element returned should be 'b'). Finally I run the ScrollIntoView(true) method on the found element. I'd now like to add a function that highlights the text (like if you search for a term in a real webbrowser). My first thought was to just inject html and or javascript code around the text but that seems like a messy solution. Any ideas on how I should do this? Thanks for your help!

  Read the article

• Django "Page not found" error page shows only one of two expected urls

  - by Frank V

  I'm working with Django, admittedly for the first time doing anything real. The URL config looks like the following: urlpatterns = patterns('my_site.core_prototype.views', (r'^newpost/$', 'newPost'), (r'^$', 'NewPostAndDisplayList'), # capture nothing... #more here... - perhaps the perma-links? ) This is in an app's url.py which is loaded from the project's url.py via: urlpatterns = patterns('', # only app for now. (r'^$', include('my_site.core_prototype.urls')), ) The problem is, when I receive a 404 attempting to utilize newpost, the error page only shows the ^$ -- it seems to ignore the newpost pattern... I'm sure the solution is probably stupid-simple but right now I'm missing it. Can someone help get me on the right track...

  Read the article

• Finding final/effective web.config values (from inherited configurations)

  - by gregmac

  Are there any apps that can show the final configuration as applied to a particular application directory? What I'm picturing is something along the lines of FireBug's CSS viewer. Basically, it should show the equivalent single web.config file (as if you only had one), with all the values that apply to the directory in question, with each element (or even attribute) annotated with its source (the real .config file it came from). This would greatly help deploying applications into foreign environments (eg, customer sites) where they sometimes have strange configs, that add in global includes (eg, they put the include in machine.config, instead of the web.config for that app) or have allowOverride=false, etc.

  Read the article

• Why does SQLAlchemy with psycopg2 use_native_unicode have poor performance?

  - by Bob Dover

  I'm having a difficult time figuring out why a simple SELECT query is taking such a long time with sqlalchemy using raw SQL (I'm getting 14600 rows/sec, but when running the same query through psycopg2 without sqlalchemy, I'm getting 38421 rows/sec). After some poking around, I realized that toggling sqlalchemy's use_native_unicode parameter in the create_engine call actually makes a huge difference. This query takes 0.5secs to retrieve 7300 rows: from sqlalchemy import create_engine engine = create_engine("postgresql+psycopg2://localhost...", use_native_unicode=True) r = engine.execute("SELECT * FROM logtable") fetched_results = r.fetchall() This query takes 0.19secs to retrieve the same 7300 rows: engine = create_engine("postgresql+psycopg2://localhost...", use_native_unicode=False) r = engine.execute("SELECT * FROM logtable") fetched_results = r.fetchall() The only difference between the 2 queries is use_native_unicode. But sqlalchemy's own docs state that it is better to keep use_native_unicode=True (http://docs.sqlalchemy.org/en/latest/dialects/postgresql.html). Does anyone know why use_native_unicode is making such a big performance difference? And what are the ramifications of turning off use_native_unicode?

  Read the article

• How should important terms be emphasized in documentation?

  - by John Rasch

  Software will often introduce and formalize concepts that may have ambiguous definitions in the real world. For example, in an attendance tracking system, an Occurrence refers to an Excused Absence, an Unexcused Absence, or a Tardy. In technical documentation (both in helper text and in user guides, etc), should these concepts be proper nouns, and as such, should they be capitalized in usage? In other words, which of the following examples is more appropriate: After an Occurrence has been created, it may be converted into an Excused Absence once the Approval Form has been uploaded. or After an occurrence has been created, it may be converted into an excused absence once the approval form has been uploaded.

  Read the article

• What's the proper way of importing option lists into an Android app?

  - by Scott

  I have been storing option lists for my Android app in a cloud table. For example, categories like "historical fiction","biography","science fiction", etc. I see the following pros and cons: Pro: I can make changes to the list without sending an app update to Google Play Not normalized - I can use the text in my other data tables instead of a reference ID Con: App needs to take time to download from the web each time (or at least check for changes) English only I believe the "proper" way to do this is the use the XML resource files. But I need to make sure the selection references correctly with my data. That is, my app needs to understand that "Poetry" and "Poesía" are the same thing. Is the correct thing to do: Forget about it since I'll never get to the point where I'm translating my app anyway Use a string-array and use the index (0...x) to know what the selection is Use a 2-dimensional string-array with a reference ID in the first column and the text in the second?

  Read the article

• expand a varchar column very slowly , why?

  - by francs

  Hi We need to modify a column of a big product table , usually normall ddl statments will be excutely fast ,but the above ddl statmens takes about 10 minnutes?I wonder know the reason! I just want to expand a varchar column?The following is the detailsl --table size wapreader_log= select pg_size_pretty(pg_relation_size('log_foot_mark')); pg_size_pretty ---------------- 5441 MB (1 row) --table ddl wapreader_log= \d log_foot_mark Table "wapreader_log.log_foot_mark" Column | Type | Modifiers -------------+-----------------------------+----------- id | integer | not null create_time | timestamp without time zone | sky_id | integer | url | character varying(1000) | refer_url | character varying(1000) | source | character varying(64) | users | character varying(64) | userm | character varying(64) | usert | character varying(64) | ip | character varying(32) | module | character varying(64) | resource_id | character varying(100) | user_agent | character varying(128) | Indexes: "pk_log_footmark" PRIMARY KEY, btree (id) --alter column wapreader_log= \timing Timing is on. wapreader_log= ALTER TABLE wapreader_log.log_foot_mark ALTER column user_agent TYPE character varying(256); ALTER TABLE Time: 603504.835 ms

  Read the article

• How and when to log account access login with PHP?

  - by Nazgulled

  I want to implement a basic login system in some PHP app where no cookies will be involved. I mean, the user closes the browser and the login expires, it will remain active during the browser session (or if the user explicitly logs out) otherwise. I want to log all this activity and I'm thinking that every time the user refreshes the page, opens a different link or logs out, I record that time as the last access made by that user, overwriting the previous access log. But my problem is when and how should I insert another record into the database instead of overwriting the last one? Should I just define a timeout and if the last access was made above that timeout, another log should be inserted into the database? Should the session expire too after that timeout? Or is there a better way? Ideally, I would like to log the "log out action" when the browser was closed, but I don't think there's a way to detect that is there? Suggestions?

  Read the article

• Learning Objective-C 2.0 and ASP.NET 4.0 simultaneously?

  - by Sahat

  (HOBBY) I own a Macbook Pro and iPod Touch so developing iPhone/iPod/iPad apps seems like a logical thing to do in order to get some experience in the programming field. Besides I want to write a new application similar to the Capsuleer (Character skills monitor app for EVE Online MMO) but with more features. It's something I'd love to have on my own iPod Touch and I am sure other people will welcome a new EVE Online app for their iPhone or iPod Touch. (CAREER) I want to learn ASP.NET (and possibly Silverlight later on) for my potential future job. I plan to work in the .NET field, so it's a good idea for me to start learning C# and ASP.NET ASAP. Is it a good idea to learn completely unrelated technologies at the same time? Or would it be better to learn one thing at a time? Objective-C first, and ASP.NET second. Or vice versa. Thanks, Sahat

  Read the article

• Where is the best place to run initialization code for a UITabBarController?

  - by bobobobo

  I have a UITabBarController in my application. I have to perform some customization to the NIB file using code the first time a view embedded in that UITabBarController gets loaded. When applicationDidFinishLaunching occurs, the UITabBarController's views apparently are not loaded -- if I try to modify the view controllers inside a tab bar that the tab bar is to load in applicationDidFinishLaunching, then those changes are ignored. I'm assuming this is because the tab bar didn't finish loading yet. So, I need a good place to put code that will run immediately after a tabbar is fully ready -- i.e. after it has loaded all the views from their respective nib files. I'm finding the only place I can do this is to track the first time viewDidAppear on each individual view controller. Note I can't use viewWillAppear because I need the value of tabBarController.selectedIndex to be accurate, and it is only actually updated after viewDidAppear gets fired, not when viewWillAppear gets fired.

  Read the article

• The case against Maven?

  - by Asgeir S. Nilsen

  Time and time again I've read and heard people frustrated over Maven and how complicated it is. And that it's much easier to use Ant to build code. However, in order to: Compile code Run tests Package a deployable unit This is all you need from Maven: <project> <modelVersion>4.0.0</modelVersion> <groupId>type something here</groupId> <artifactId>type something here</artifactId> <version>type something here</version> </project> What would be the corresponding minimal Ant build file?

  Read the article

• Remove items from SWT tables

  - by Dima

  This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How do I make this ASP.NET MVC controller more testable?

  - by Ragesh

  I have a controller that overrides OnActionExecuting and does something like this: protected override void OnActionExecuting(ActionExecutingContext filterContext) { base.OnActionExecuting(filterContext); string tenantDomain = filterContext.RouteData.Values["tenantDomain"] as string; if (!string.IsNullOrWhiteSpace(tenantDomain)) { using (var tx = BeginTransaction()) { this.Tenant = repo.FindOne(t => t.Domain == tenantDomain); } } } Tenant is a protected property with a private setter. The class itself is an abstract base controller that my real controllers derive from. I have code in other controllers that looks a lot like this: if (Tenant == null) { // Do something } else { // Do something else } How do I test this code? What I need to do is to somehow set the Tenant property, but I can't because: It's a protected property, and It has a private setter Changing the visibility of Tenant doesn't "feel" right. What are my alternatives to unit test my derived controllers?

  Read the article

• Selecting keys based on metadata, possible with Amazon S3?

  - by nbv4

  I'm sending files to my S3 bucket that are basically gzipped database dumps. They keys are a human readable date ("2010-05-04.dump"), and along with that, I'm setting a metadata field to the UNIX time of the dump. I want to write a script that retrieve the latest dump from the bucket. That is to say I want the the key with the largest unix time metadata value. Is this possible with Amazon S3, or is this not how S3 is meant to work? I'm using both the command line tool aws, and the python library boto

  Read the article

• Getting Started with Fluent NHibernate

  - by Andy

  I'm trying to get into using Fluent NHibernate, and I have a couple questions. I'm finding the documentation to be lacking. I understand that Fluent NHibernate / NHibernate allows you to auto-generate a database schema. Do people usually only do this for Test/Dev databases? Or is that OK to do for a production database? If it's ok for production, how do you make sure that you're not blowing away production data every time you run your app? Once the database schema is already created, and you have production data, when new tables/columns/etc. need to be added to the Test and/or Production database, do people allow NHibernate to do this, or should this be done manually? Is there any REALLY GOOD documentation on Fluent NHibernate? (Please don't point me to the wiki because in following along with the "Your first project" code building it myself, I was getting run-time errors because they forget to tell you to add a reference. Not cool.) Thanks, Andy

  Read the article

• How do i stop the android garbage collector? Is it possible?

  - by Sponge

  Is there any way to stop the garbage collector for some time?

  Read the article

• Sum in array with match value

  - by user325504

  Dear all, I would like to do a simple sum per salesid in php - mysql after cross calculation between date (2 table) to get the real time commission, all the value already come out correctly but I got problem with final sum per sales id. salesid-commission aa0001 - 1000 bb0001 - 500 aa0001 - 200 bb0001 - 50 I already try with few sample in this web but still cannot meet the correct result. I cannot do the sum in mysql because of some reason (need calculation with other table) the result will be: aa0001 - 1200 bb0001 - 550 I aprreciated for any help to complated the test. Thank you so much.

  Read the article

• prevent race condition without using locks C++

  - by Hristo

  How do I prevent a race condition with locking or using mutexes/semaphors in C++? I'm dealing with a nested for loop in which I will be setting a value in an array: for (int i = 0; i < m; ++i) for (int j = 0; j < n; ++j) for (int k = 0; k < o; ++k) array[k] += foo(...); More or less, I want to deal with this so that I can ensure different threads running at the same time don't write to array[k] at the same time. Any suggestions on how to approach this? Thanks, Hristo

  Read the article

• Has anyone noticed that a WPF file dialog will pass through a click to the UI when double clicking t

  - by Ben

  I have some buttons on my WPF UI and I also need to choose files from time to time. I kept noticing strange problems where when I double-click an item in the file dialog, a button on the main UI would also get clicked. After experimenting, it seems that if you line up an item in the file dialog with a button behind it on the main UI and double click to select the file, it will single-click the button behind it as well. Has anyone else noticed this, or is it just a freak bug with the way I have my UI laid out?

  Read the article

• SQL query root parent child records

  - by Vish

  Hi, We have nested folders with parent-child relationship. We use MySQL MyISAM DB. The data is stored in the DB in the following manner. Every time a child folder is created in the nested structure, the previous parentID is added. I want to get the RootFolderID of a folder which is added in the hierarchy as tabulated below. FoldID ParentID |RootFolderID -----------------|------------------- 1 0 | 0 2 1 | 1 3 2 | 1 4 3 | 1 5 4 | 1 Please let me know how to get the root folderID and populate it in the RootFolderID column after a folder is created each time. Thanks.

  Read the article

• install CakePHP on Mac osx: apache problems

  - by ed209

  First time cake user and I'm having real apache problems. For some reason the .htaccess is trying to find File does not exist: /Library/WebServer/Documents/Users but there is no such directory as Users. I have tried setting up the following also: /etc/apache2/extra/httpd-vhosts.conf <VirtualHost *:80 > DocumentRoot "/Users/username/Sites/mysite/app/webroot" ServerName mysite.dev ServerAlias www.mysite.dev mysite.dev *.mysite.dev <Directory "/Users/username/Sites/mysite/app/webroot"> Options Indexes FollowSymLinks AllowOverride All </Directory> </VirtualHost> /etc/hosts 127.0.0.1 mysite.dev /etc/apache2/users/username.conf <Directory "/Users/username/Sites/"> Options Indexes MultiViews FollowSymlinks AllowOverride All Order allow,deny Allow from all </Directory> That also hasn't worked, but with a different error Failed opening required 'cake/libs/cache/file.php' Although I'd rather not use virtual hosts, and just run it off localhost

  Read the article

• Does this Maven plugin really have an invalid descriptor?

  - by ovr

  COMMAND: mvn org.apache.maven.plugins:maven-archetype-plugin:2.0-alpha-4:generate -DarchetypeGroupId=org.beardedgeeks -DarchetypeArtifactId =gae-eclipse-maven-archetype -DarchetypeVersion=1.1.2 -DarchetypeRepository=http://beardedgeeks.googlecode.com/svn/repository/release s OUTPUT: [INFO] Scanning for projects... [INFO] ------------------------------------------------------------------------ [ERROR] BUILD ERROR [INFO] ------------------------------------------------------------------------ [INFO] Internal error in the plugin manager getting plugin 'org.apache.maven.plugins:maven-archetype-plugin': Plugin 'org.apache.maven .plugins:maven-archetype-plugin:2.0-alpha-4' has an invalid descriptor: 1) Plugin's descriptor contains the wrong group ID: net.kindleit 2) Plugin's descriptor contains the wrong artifact ID: maven-gae-plugin 3) Plugin's descriptor contains the wrong version: 0.5.9 [INFO] ------------------------------------------------------------------------ [INFO] For more information, run Maven with the -e switch [INFO] ------------------------------------------------------------------------ [INFO] Total time: < 1 second [INFO] Finished at: Wed Jun 09 20:48:35 CEST 2010 [INFO] Final Memory: 3M/15M [INFO] ------------------------------------------------------------------------ I have a hard time believing this Maven plugin has an invalid descriptor since other people seem to be using it with no problem. Am I doing something wrong?

  Read the article

• Mysql select - improve performances

  - by realshadow

  Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

  Read the article

• Sending bulk notification emails without blocking

  - by FreshCode

  For my client's custom-built CRM, I want users (technicians) to be notified of changes to marked cases via email. This warrants a simple subscription mapping table between users and cases and automated emails to be sent every time a change is made to a case from within the logging method. How do I send 10-100 emails to subscribed users without bogging down my logging method? My SMTP server is on a peer on my LAN, so sends should be quick, but ideally this should be handled by an external queuing process. I can have a cron job send any outstanding emails every 10 minutes, but for this specific client cases are quite time-sensitive and instant notification (as instant as email can be) would be great. How can I send bulk notification emails from within ASP.NET MVC without bogging down my logging method?

  Read the article

< Previous Page | 764 765 766 767 768 769 770 771 772 773 774 775  | Next Page >