Search Results

Search found 20359 results on 815 pages for 'fixed length record'.

Page 769/815 | < Previous Page | 765 766 767 768 769 770 771 772 773 774 775 776  | Next Page >

  • Correlation formula explanation needed d3.js

    - by divakar
    function getCorrelation(xArray, yArray) { alert(xArray); alert(yArray); function sum(m, v) {return m + v;} function sumSquares(m, v) {return m + v * v;} function filterNaN(m, v, i) {isNaN(v) ? null : m.push(i); return m;} // clean the data (because we know that some values are missing) var xNaN = _.reduce(xArray, filterNaN , []); var yNaN = _.reduce(yArray, filterNaN , []); var include = _.intersection(xNaN, yNaN); var fX = _.map(include, function(d) {return xArray[d];}); var fY = _.map(include, function(d) {return yArray[d];}); var sumX = _.reduce(fX, sum, 0); var sumY = _.reduce(fY, sum, 0); var sumX2 = _.reduce(fX, sumSquares, 0); var sumY2 = _.reduce(fY, sumSquares, 0); var sumXY = _.reduce(fX, function(m, v, i) {return m + v * fY[i];}, 0); var n = fX.length; var ntor = ( ( sumXY ) - ( sumX * sumY / n) ); var dtorX = sumX2 - ( sumX * sumX / n); var dtorY = sumY2 - ( sumY * sumY / n); var r = ntor / (Math.sqrt( dtorX * dtorY )); // Pearson ( http://www.stat.wmich.edu/s216/book/node122.html ) var m = ntor / dtorX; // y = mx + b var b = ( sumY - m * sumX ) / n; // console.log(r, m, b); return {r: r, m: m, b: b}; } I have finding correlation between the points i plot using this function which is not written by me. my xarray=[120,110,130,132,120,118,134,105,120,0,0,0,0,137,125,120,127,120,160,120,148] yarray=[80,70,70,80,70,62,69,70,70,62,90,42,80,72,0,0,0,0,78,82,68,60,58,82,60,76,86,82,70] I can t able to understand the function perfectly. Can anybody explain it with the data i pasted here. I also wanted to remove the zeros getting calculated from this function.

    Read the article

  • How can I determine if an image has loaded, using Javascript/jQuery?

    - by Kip
    I'm writing some Javascript to resize the large image to fit into the user's browser window. (I don't control the size of the source images unfortunately.) So something like this would be in the HTML: <img id="photo" src="a_really_big_file.jpg" alt="this is some alt text" title="this is some title text" /> Is there a way for me to determine if the src image in an img tag has been downloaded? I need this because I'm running into a problem if $(document).ready() is executed before the browser has loaded the image. $("#photo").width() and $("#photo").height() will return the size of the placeholder (the alt text). In my case this is something like 134 x 20. Right now I'm just checking if the photo's height is less than 150, and assuming that if so it is just alt text. But this is quite a hack, and it would break if a photo is less than 150 pixels tall (not likely in my particular case), or if the alt text is more than 150 pixels tall (could possibly happen on a small browser window). Edit: For anyone wanting to see the code: $(function() { var REAL_WIDTH = $("#photo").width(); var REAL_HEIGHT = $("#photo").height(); $(window).resize(adjust_photo_size); adjust_photo_size(); function adjust_photo_size() { if(REAL_HEIGHT < 150) { REAL_WIDTH = $("#photo").width(); REAL_HEIGHT = $("#photo").height(); if(REAL_HEIGHT < 150) { //image not loaded.. try again in a quarter-second setTimeout(adjust_photo_size, 250); return; } } var new_width = . . . ; var new_height = . . . ; $("#photo").width(Math.round(new_width)); $("#photo").height(Math.round(new_height)); } }); Update: Thanks for the suggestions. There is a risk of the event not being fired if I set a callback for the $("#photo").load event, so I have defined an onLoad event directly on the image tag. For the record, here is the code I ended up going with: <img id="photo" onload="photoLoaded();" src="a_really_big_file.jpg" alt="this is some alt text" title="this is some title text" /> Then in Javascript: //This must be outside $() because it may get called first var isPhotoLoaded = false; function photoLoaded() { isPhotoLoaded = true; } $(function() { //Hides scrollbars, so we can resize properly. Set with JS instead of // CSS so that page doesn't break with JS disabled. $("body").css("overflow", "hidden"); var REAL_WIDTH = -1; var REAL_HEIGHT = -1; $(window).resize(adjust_photo_size); adjust_photo_size(); function adjust_photo_size() { if(!isPhotoLoaded) { //image not loaded.. try again in a quarter-second setTimeout(adjust_photo_size, 250); return; } else if(REAL_WIDTH < 0) { //first time in this function since photo loaded REAL_WIDTH = $("#photo").width(); REAL_HEIGHT = $("#photo").height(); } var new_width = . . . ; var new_height = . . . ; $("#photo").width(Math.round(new_width)); $("#photo").height(Math.round(new_height)); } });

    Read the article

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Using jQuery or javascript to render json into multi-column table

    - by Scott Yu - UX designer
    I am trying to render a JSON into a HTML table. But the difficulty is making it so it loops through JSON and renders multiple columns if necessary. For the example below, what I want is this: Result wanted Result Wanted <table> <tr><th>AppName</th><td>App 1</td><td>App 2</td></tr> <tr><th>Last Modified</th><td>10/1/2012</td><td></td></tr> <tr><th>App Logo</th><td>10/1/2012</td><td></td></tr> blahblah </table> <table> <tr><th>AppName</th><td>App 1</td></tr> blahblah </table> JSON Example "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "Dan North", "ShipTo_Address": "Dan North", "ShipTo_Terms": "Dan North", "ShipTo_DueDate": "Dan North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] }, { "AppName": "App 2", "AppLogo": "http://www.google.com/logo.png", "LastModified": "10/1/2012, 9:30AM", "BillTo_Name": "Steve North", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], "Records": [ { "AppName": "App 1", "LastModified": "10/1/2012, 9:30AM", "ShipTo_Name": "222", "ShipTo_Address": "333 ", "ShipTo_Terms": "444", "ShipTo_DueDate": "5555", "Items 1": [ { "Item_Name": "Repairs", "Item_Description": "Repair Work" } ] } ], Code I am using now function CreateComparisonTable (arr,level,k) { var dumped_text = ""; if(!level) level = 0; //The padding given at the beginning of the line. var level_padding = ""; for(var j=0;j<level+1;j++) level_padding = "--"; if(typeof(arr) == 'object') { //Array/Hashes/Objects for (var item in arr) { var value = arr[item]; if (typeof(value) == 'object') { //If it is an array, if(item !=0) { dumped_text += '<tr><td>' + item + '<br>'; dumped_text += CreateComparisonTable(value,level+1); dumped_text += '</td></tr>'; } else { dumped_text += CreateComparisonTable(value,level, value.length); } } else { dumped_text += '<tr><td>' + level_padding + item + '</td><td>' + value + '</td></tr>'; } } } return dumped_text; } Jsfiddle here

    Read the article

  • Flash caroussel xml parse html link

    - by Marvin
    Hello I am trying to modify a carousel script I have in flash. Its normal function is making some icons rotate and when clicked they zoom in, fade all others and display a little text. On that text I would like to have a link like a "read more". If I use CDATA it wont display a thing, if I use alt char like &#60;a href=&#34;www.google.com&#34;&#62; Read more + &#60;/a&#62; It just displays the text as: <a href="www.google.com"> Read more + </a>. The flash dynamic text box wont render it as html. I dont enough as2 to figure out how to add this. My code: var xml:XML = new XML(); xml.ignoreWhite = true; //definições do xml xml.onLoad = function() { var nodes = this.firstChild.childNodes; numOfItems = nodes.length; for(var i=0;i<numOfItems;i++) { var t = home.attachMovie("item","item"+i,i+1); t.angle = i * ((Math.PI*2)/numOfItems); t.onEnterFrame = mover; t.toolText = nodes[i].attributes.tooltip; t.content = nodes[i].attributes.content; t.icon.inner.loadMovie(nodes[i].attributes.image); t.r.inner.loadMovie(nodes[i].attributes.image); t.icon.onRollOver = over; t.icon.onRollOut = out; t.icon.onRelease = released; } } And the xml: <?xml version="1.0" encoding="UTF-8"?> <icons> <icon image="images/product.swf" tooltip="Product" content="Hello this is some random text &#60;a href=&#34;www.google.com&#34;&#62; Read More + &#60;/a&#62; "/> </icons> Any suggestions? Thanks.

    Read the article

  • How can I create a Base64-Encoded string from an GDI+ Image in C++?

    - by Schnapple
    I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

    Read the article

  • clicking a button via javascript does not cause a postback

    - by Andreas Niedermair
    hi there! <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.1//EN" "http://www.w3.org/TR/xhtml11/DTD/xhtml11.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.js"></script> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.2/jquery-ui.js"></script> </head> <body> <form id="fooForm"> <script type="text/javascript"> function FooMethod() { alert('hello'); } var fooButton; var fooForm; $(document).ready(function() { InitializeVariables(); InitiliazeDialog(); InitiliazeForm(); }); function InitializeVariables() { fooButton = $('#fooButton'); fooForm = $('#fooForm'); } function InitiliazeDialog() { var dialog = $('<div/>'); dialog.css('display', 'none'); var content = $('<p/>'); var icon = $('<span/>'); icon.addClass('ui-icon ui-icon-alert'); icon.css('float', 'left'); icon.css('margin', '0px 7px 20px 0px'); content.text('do you really want to hurt me?'); icon.prependTo(content); content.appendTo(dialog); var dialogOpenMethod = function () { dialog.dialog('open'); return false; }; var dialogOpenHandlerMethod = function (event, ui) { var widget = dialog.dialog('widget'); widget.appendTo(fooForm); var overlay = widget.prev(); overlay.css('z-index', 999); overlay.appendTo(fooForm); widget.css('position', 'fixed'); widget.css('top', '50%'); widget.css('margin-top', widget.height() / 2 * -1); widget.css('left', '50%'); widget.css('margin-left', widget.width() / 2 * -1); }; var submitMethod = function () { dialog.dialog('option', 'closeOnEscape', false); var widget = dialog.dialog('widget'); var yesButton = $(':button:eq(0)', widget); var noButton = $(':button:eq(1)', widget); var closeButton = $('a.ui-dialog-titlebar-close', widget); noButton.remove(); closeButton.remove(); fooButton.unbind('click', dialogOpenMethod); fooButton.click(); }; dialog.dialog({ autoOpen: false, modal: true, buttons: { 'Ja': submitMethod, 'Nein': function () { dialog.dialog('close'); } }, open: dialogOpenHandlerMethod }); fooButton.bind('click', dialogOpenMethod); } function InitiliazeForm() { fooButton.button(); fooForm.submit(function () { alert('doing a submit'); }); } </script> <input type="submit" id="fooButton" value="submit it!" onclick="FooMethod();"></input> </form> </body> </html> what am i doing? i want a modal-confirmation: user clicks on button, confirmation "do you really want to...?", user clicks "yes", this click unbinds the original click-handler and clicks the button again (which should cause a submit). what/why is not working? indeed you need a special case. this demo won't work, unless you set modal: false. interesting to mention: the original handler (onclick="FooMethod();") is called in modal and non-modal dialog. can anybody help me out? thanks in advance!

    Read the article

  • More localized, efficient Lowest Common Ancestor algorithm given multiple binary trees?

    - by mstksg
    I have multiple binary trees stored as an array. In each slot is either nil (or null; pick your language) or a fixed tuple storing two numbers: the indices of the two "children". No node will have only one child -- it's either none or two. Think of each slot as a binary node that only stores pointers to its children, and no inherent value. Take this system of binary trees: 0 1 / \ / \ 2 3 4 5 / \ / \ 6 7 8 9 / \ 10 11 The associated array would be: 0 1 2 3 4 5 6 7 8 9 10 11 [ [2,3] , [4,5] , [6,7] , nil , nil , [8,9] , nil , [10,11] , nil , nil , nil , nil ] I've already written simple functions to find direct parents of nodes (simply by searching from the front until there is a node that contains the child) Furthermore, let us say that at relevant times, both all trees are anywhere between a few to a few thousand levels deep. I'd like to find a function P(m,n) to find the lowest common ancestor of m and n -- to put more formally, the LCA is defined as the "lowest", or deepest node in which have m and n as descendants (children, or children of children, etc.). If there is none, a nil would be a valid return. Some examples, given our given tree: P( 6,11) # => 2 P( 3,10) # => 0 P( 8, 6) # => nil P( 2,11) # => 2 The main method I've been able to find is one that uses an Euler trace, which turns the given tree, with a node A to be the invisible parent of 0 and 1 with a depth of -1, into: A-0-2-6-2-7-10-7-11-7-2-0-3-0-A-1-4-1-5-8-5-9-5-1-A And from that, simply find the node between your given m and n that has the lowest number; For example, to find P(6,11), look for a 6 and an 11 on the trace. The number between them that is the lowest is 2, and that's your answer. If A is in between them, return nil. -- Calculating P(6,11) -- A-0-2-6-2-7-10-7-11-7-2-0-3-0-A-1-4-1-5-8-5-9-5-1-A ^ ^ ^ | | | m lowest n Unfortunately, I do believe that finding the Euler trace of a tree that can be several thousands of levels deep is a bit machine-taxing...and because my tree is constantly being changed throughout the course of the programming, every time I wanted to find the LCA, I'd have to re-calculate the Euler trace and hold it in memory every time. Is there a more memory efficient way, given the framework I'm using? One that maybe iterates upwards? One way I could think of would be the "count" the generation/depth of both nodes, and climb the lowest node until it matched the depth of the highest, and increment both until they find someone similar. But that'd involve climbing up from level, say, 3025, back to 0, twice, to count the generation, and using a terribly inefficient climbing-up algorithm in the first place, and then re-climbing back up. Are there any other better ways?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • xml append issue in ie,chrome

    - by 3gwebtrain
    Hi, I am creating a html page, using xml data. in which i am using the following function. It works fine with firefox,opera,safari. but in case of ie7,ie8, and chrome the data what i am getting from xml, is not appending properly. any one help me to solve this issue? in case any special thing need to concentrate on append funcation as well let me know.. $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); $('ul.level'+count).append($(this).children()); }); }); }); }) Thanks for advance..

    Read the article

  • Tag Cloud JS + Flash. Actual Tags In Cloud Not Clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("some/swfObject/url", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); } </script>

    Read the article

  • Reason why UIImageView gives me a 'distorted' image sometimes

    - by Cedric Vandendriessche
    I have a custom UIView with a UILabel and a UIImageView subview. (tried using UIImageView subclass aswell). I assign an image to it and add the view to the screen. I wrote a function which adds the amount of LetterBoxes to the screen as there are letters in the word: - (void)drawBoxesForWord:(NSString *)word { if(boxesContainer == nil) { /* Create a container for the LetterBoxes (animation purposes) */ boxesContainer = [[UIView alloc] initWithFrame:CGRectMake(0, 205, 320, 50)]; [self.view addSubview:boxesContainer]; } /* Calculate width of letterboxes */ NSInteger numberOfCharacters = [word length]; CGFloat totalWidth = numberOfCharacters * 28 + (numberOfCharacters - 1) * 3; CGFloat leftCap = (320 - totalWidth) / 2; [letters removeAllObjects]; /* Draw the boxes to the screen */ for (int i = 0; i < numberOfCharacters; i++) { LetterBox *letter = [[LetterBox alloc] initWithFrame:CGRectMake(leftCap + i * 31 , 0, 28, 40)]; [letters addObject:letter]; [boxesContainer addSubview:letter]; [letter release]; }} This gives me the image below: http://www.imgdumper.nl/uploads2/4ba3b2c72bb99/4ba3b2c72abfd-Goed.png But sometimes it gives me this: imgdumper.nl/uploads2/4ba3b2d888226/4ba3b2d88728a-Fout.png I add them to the same boxesContainer but they first remove themselves from the superview, so it's not like you see them double or something. What I find weird is that they are all good or all bad.. This is the init function for my LetterBox: if (self == [super initWithFrame:aRect]) { /* Create the box image with same frame */ boxImage = [[UIImageView alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; boxImage.contentMode = UIViewContentModeScaleAspectFit; boxImage.image = [UIImage imageNamed:@"SpaceOpen.png"]; [self addSubview:boxImage]; /* Create the label with same frame */ letterLabel = [[UILabel alloc] initWithFrame:CGRectMake(0, 0, self.bounds.size.width, self.bounds.size.height)]; letterLabel.backgroundColor = [UIColor clearColor]; letterLabel.font = [UIFont fontWithName:@"ArialRoundedMTBold" size:26]; letterLabel.textColor = [UIColor blackColor]; letterLabel.textAlignment = UITextAlignmentCenter; [self addSubview:letterLabel]; } return self;} Does anyone have an idea why this could be? I'd rather have them display correctly every time :)

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • What are the pros and cons of using manual list iteration vs recursion through fail

    - by magus
    I come up against this all the time, and I'm never sure which way to attack it. Below are two methods for processing some season facts. What I'm trying to work out is whether to use method 1 or 2, and what are the pros and cons of each, especially large amounts of facts. methodone seems wasteful since the facts are available, why bother building a list of them (especially a large list). This must have memory implications too if the list is large enough ? And it doesn't take advantage of Prolog's natural backtracking feature. methodtwo takes advantage of backtracking to do the recursion for me, and I would guess would be much more memory efficient, but is it good programming practice generally to do this? It's arguably uglier to follow, and might there be any other side effects? One problem I can see is that each time fail is called, we lose the ability to pass anything back to the calling predicate, eg. if it was methodtwo(SeasonResults), since we continually fail the predicate on purpose. So methodtwo would need to assert facts to store state. Presumably(?) method 2 would be faster as it has no (large) list processing to do? I could imagine that if I had a list, then methodone would be the way to go.. or is that always true? Might it make sense in any conditions to assert the list to facts using methodone then process them using method two? Complete madness? But then again, I read that asserting facts is a very 'expensive' business, so list handling might be the way to go, even for large lists? Any thoughts? Or is it sometimes better to use one and not the other, depending on (what) situation? eg. for memory optimisation, use method 2, including asserting facts and, for speed use method 1? season(spring). season(summer). season(autumn). season(winter). % Season handling showseason(Season) :- atom_length(Season, LenSeason), write('Season Length is '), write(LenSeason), nl. % ------------------------------------------------------------- % Method 1 - Findall facts/iterate through the list and process each %-------------------------------------------------------------- % Iterate manually through a season list lenseason([]). lenseason([Season|MoreSeasons]) :- showseason(Season), lenseason(MoreSeasons). % Findall to build a list then iterate until all done methodone :- findall(Season, season(Season), AllSeasons), lenseason(AllSeasons), write('Done'). % ------------------------------------------------------------- % Method 2 - Use fail to force recursion %-------------------------------------------------------------- methodtwo :- % Get one season and show it season(Season), showseason(Season), % Force prolog to backtrack to find another season fail. % No more seasons, we have finished methodtwo :- write('Done').

    Read the article

  • Serialize problem with cookie

    - by cagin
    Hi there, I want use cookie in my web project. I must serialize my classes. Although my code can seralize an int or string value, it cant seralize my classes. This is my seralize and cookie code : public static bool f_SetCookie(string _sCookieName, object _oCookieValue, DateTime _dtimeExpirationDate) { bool retval = true; try { if (HttpContext.Current.Request[_sCookieName] != null) { HttpContext.Current.Request.Cookies.Remove(_sCookieName); } BinaryFormatter bf = new BinaryFormatter(); MemoryStream ms = new MemoryStream(); bf.Serialize(ms, _oCookieValue); byte[] bArr = ms.ToArray(); MemoryStream objStream = new MemoryStream(); DeflateStream objZS = new DeflateStream(objStream, CompressionMode.Compress); objZS.Write(bArr, 0, bArr.Length); objZS.Flush(); objZS.Close(); byte[] bytes = objStream.ToArray(); string sCookieVal = Convert.ToBase64String(bytes); HttpCookie cook = new HttpCookie(_sCookieName); cook.Value = sCookieVal; cook.Expires = _dtimeExpirationDate; HttpContext.Current.Response.Cookies.Add(cook); } catch { retval = false; } return retval; } And here is one of my classes: [Serializable] public class Tahlil { #region Props & Fields public string M_KlinikKodu{ get; set; } public DateTime M_AlinmaTarihi { get; set; } private List<Test> m_Tesler; public List<Test> M_Tesler { get { return m_Tesler; } set { m_Tesler = value; } } #endregion public Tahlil() {} Tahlil(DataRow _rwTahlil){} } I m calling my Set Cookie method: Tahlil t = new Tahlil(); t.M_AlinmaTarihi = DateTime.Now; t.M_KlinikKodu = "2"; t.M_Tesler = new List<Test>(); f_SetCookie("Tahlil", t, DateTime.Now.AddDays(1)); I cant see cookie in Cookie folder and Temporary Internet Files but if i will call method like that: f_SetCookie("TRY", 5, DateTime.Now.AddDays(1)); I can see cookie. What is the problem? I dont understand. Thank you for your helps.

    Read the article

  • Step by Step / Deep explain: The Power of (Co)Yoneda (preferably in scala) through Coroutines

    - by Mzk
    some background code /** FunctorStr: ? F[-]. (? A B. (A -> B) -> F[A] -> F[B]) */ trait FunctorStr[F[_]] { self => def map[A, B](f: A => B): F[A] => F[B] } trait Yoneda[F[_], A] { yo => def apply[B](f: A => B): F[B] def run: F[A] = yo(x => x) def map[B](f: A => B): Yoneda[F, B] = new Yoneda[F, B] { def apply[X](g: B => X) = yo(f andThen g) } } object Yoneda { implicit def yonedafunctor[F[_]]: FunctorStr[({ type l[x] = Yoneda[F, x] })#l] = new FunctorStr[({ type l[x] = Yoneda[F, x] })#l] { def map[A, B](f: A => B): Yoneda[F, A] => Yoneda[F, B] = _ map f } def apply[F[_]: FunctorStr, X](x: F[X]): Yoneda[F, X] = new Yoneda[F, X] { def apply[Y](f: X => Y) = Functor[F].map(f) apply x } } trait Coyoneda[F[_], A] { co => type I def fi: F[I] def k: I => A final def map[B](f: A => B): Coyoneda.Aux[F, B, I] = Coyoneda(fi)(f compose k) } object Coyoneda { type Aux[F[_], A, B] = Coyoneda[F, A] { type I = B } def apply[F[_], B, A](x: F[B])(f: B => A): Aux[F, A, B] = new Coyoneda[F, A] { type I = B val fi = x val k = f } implicit def coyonedaFunctor[F[_]]: FunctorStr[({ type l[x] = Coyoneda[F, x] })#l] = new CoyonedaFunctor[F] {} trait CoyonedaFunctor[F[_]] extends FunctorStr[({type l[x] = Coyoneda[F, x]})#l] { override def map[A, B](f: A => B): Coyoneda[F, A] => Coyoneda[F, B] = x => apply(x.fi)(f compose x.k) } def liftCoyoneda[T[_], A](x: T[A]): Coyoneda[T, A] = apply(x)(a => a) } Now I thought I understood yoneda and coyoneda a bit just from the types – i.e. that they quantify / abstract over map fixed in some type constructor F and some type a, to any type B returning F[B] or (Co)Yoneda[F, B]. Thus providing map fusion for free (? is this kind of like a cut rule for map ?). But I see that Coyoneda is a functor for any type constructor F regardless of F being a Functor, and that I don't fully grasp. Now I'm in a situation where I'm trying to define a Coroutine type, (I'm looking at https://www.fpcomplete.com/school/to-infinity-and-beyond/pick-of-the-week/coroutines-for-streaming/part-2-coroutines for the types to get started with) case class Coroutine[S[_], M[_], R](resume: M[CoroutineState[S, M, R]]) sealed trait CoroutineState[S[_], M[_], R] object CoroutineState { case class Run[S[_], M[_], R](x: S[Coroutine[S, M, R]]) extends CoroutineState[S, M, R] case class Done[R](x: R) extends CoroutineState[Nothing, Nothing, R] class CoroutineStateFunctor[S[_], M[_]](F: FunctorStr[S]) extends FunctorStr[({ type l[x] = CoroutineState[S, M, x]})#l] { override def map[A, B](f : A => B) : CoroutineState[S, M, A] => CoroutineState[S, M, B] = { ??? } } } and I think that if I understood Coyoneda better I could leverage it to make S & M type constructors functors way easy, plus I see Coyoneda potentially playing a role in defining recursion schemes as the functor requirement is pervasive. So how could I use coyoneda to make type constructors functors like for example coroutine state? or something like a Pause functor ?

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • disable dates using jquery inside gridview control

    - by bladerunner
    Hi there, I have a gridview which contains a textbox control. I need to show the calendar for the user to pick the date and certain dates are to be disabled using jquery. I found a post on stackoverflow that talked about how to disable certain dates. I am done with that part, except not sure how to pass the textbox control to this jquery function. Here is the code. <script type="text/javascript" language="javascript"> function pageLoad(sender, args) { var enabledDays = ['09/21/2011', '10/05/2011', '10/19/2011', '11/02/2011', '11/16/2011']; /* utility functions */ function editDays(date) { for (var i = 0; i < enabledDays.length; i++) { if (new Date(enabledDays[i]).toString() == date.toString()) { return [true]; } } return [false]; } /* create datepicker */ $(document).ready(function() { $('#<%= txtInHomeDate.ClientID %>').datepicker({ beforeShow: springDate, beforeShowDay: editDays, dateFormat: 'mm/dd/yy', buttonImage: 'images/cal.gif', buttonText: 'Choose date', firstDay: 1, buttonImageOnly: true, showOn: 'both', showAnim: 'fadeIn', onSelect: function() { $(this).trigger("onchange", null); } }); function springDate() { var defaultMin = new Date(); var defaultMax = new Date(); var Min = defaultMin; var Max = defaultMax; // make valid date from hiddenfied value format is MM/dd/yyyy dateMin = $('#<%= hfStDate.ClientID %>').val(); dateMin = new Date(dateMin); dateMax = $('#<%= hfEndDate.ClientID %>').val(); dateMax = new Date(dateMax); if (dateMin && dateMax) { Min = new Date(dateMin.getFullYear(), dateMin.getMonth(), dateMin.getDate()); Max = new Date(dateMax.getFullYear(), dateMax.getMonth(), dateMax.getDate()); } return { minDate: Min, maxDate: Max }; } }); } <.... <asp:TemplateField HeaderText="In-Home Date"> <ItemStyle HorizontalAlign="Center" /> <ItemTemplate> <asp:HiddenField ID="hfStDate" runat="server" Value="09/01/2011" /> <asp:HiddenField ID="hfEndDate" runat="server" Value="11/30/2011" /> <asp:TextBox ID="txtInHomeDate" runat="server" /> </ItemTemplate> </asp:TemplateField> Currently, it errors out since the jquery function won't find the txtInHomeDate. Could I get some help as I am pretty close to get this done? Thanks!!

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • Forced closed only when put alphabetical string in edit text

    - by Abdullah Al Mubarok
    So, I make a checker if an id is in the database or not, the id is in numerical string, the type in database is char(6) though. So this is my code public class input extends Activity{ /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.input); final EditText edittext = (EditText)findViewById(R.id.editText1); Button button = (Button)findViewById(R.id.button1); button.setOnClickListener(new OnClickListener(){ @Override public void onClick(View arg0) { // TODO Auto-generated method stub String nopel = edittext.getText().toString(); if(nopel.length() == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ List<NameValuePair> pairs = new ArrayList<NameValuePair>(); pairs.add(new BasicNameValuePair("nopel", nopel)); JSON json_dp = new JSON(); JSONObject jobj_dp = json_dp.getJSON("http://10.0.2.2/KP/pdam/nopel.php", pairs); try { if(jobj_dp.getInt("row") == 0){ Toast.makeText(getApplicationContext(), "error", Toast.LENGTH_SHORT).show(); }else{ String snopel = jobj_dp.getString("nopel"); String snama = jobj_dp.getString("nama"); String salamat = jobj_dp.getString("alamat"); String sgolongan = jobj_dp.getString("golongan"); Intent i = new Intent(input.this, list.class); i.putExtra("nopel", snopel); i.putExtra("nama", snama); i.putExtra("alamat", salamat); i.putExtra("golongan", sgolongan); startActivity(i); } } catch (JSONException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } }); } } the first check is to check if an input is null, it's going right for now, the second check is to check if an id in the database, and it's the problem. When I try some id in numerical value like "0001" or "02013" it's fine, and can run. but when I just got to put "abushd" it forced close. anyone know why I got this?

    Read the article

  • Div width: auto and IE

    - by Andrew Heath
    I'm using the jQuery qTip to show individual users and their votes when an average rating is mousedover. qTip calls a PHP file which grabs all the users and votes for the item from the MySQL database and builds a 3 column table, which appears as the tooltip. In Firefox, the tooltip displays properly. In IE7 (haven't tested on IE8 yet), the tooltip is the proper height, but the width is only 2 or 3 characters - not the entire table. If I set the width of the div to a fixed number, say width: 300px; I can coax IE into displaying it properly. However, the length of my users' names varies considerably, and I'd rather not nail down the div to its maximum possible width and then have a crapload of whitespace when you look at an item voted on only by "Joe". Using width: auto; has no effect in IE7. Are there alternatives? Sorry if I've overlooked a similar question. I searched for a bit before posting but didn't find anything suitable. EDIT TO ADD CODE: <div style="-moz-border-radius: 0pt 0pt 0pt 0pt; position: absolute; width: 358px; display: none; top: 384.617px; left: 463.5px; z-index: 6000;" class="qtip qtip-defaults" qtip="0"> <div style="position: relative; overflow: hidden; text-align: left;" class="qtip-wrapper"> <div style="overflow: hidden; background: none repeat scroll 0% 0% white; border: 1px solid rgb(211, 211, 211);" class="qtip-contentWrapper"> <div class="qtip-content qtip-content" style="background: none repeat scroll 0% 0% white; color: rgb(17, 17, 17); overflow: hidden; text-align: left; padding: 5px 9px;"> <div id="WhoResults"> <table> <tbody> <tr> <td>guy1</td> <td>guy2</td> <td>guy3</td> </tr> <tr> <td>guy4</td> <td>guy5</td> <td>guy6</td> </tr> </tbody> </table> </div> </div> </div> </div> </div> I have applied no CSS styling. That's all been handled by qTip. I tried to format it as best I could. Thanks for any help you can provide.

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Select latest group by in nhibernate

    - by Kendrick
    I have Canine and CanineHandler objects in my application. The CanineHandler object has a PersonID (which references a completely different database), an EffectiveDate (which specifies when a handler started with the canine), and a FK reference to the Canine (CanineID). Given a specific PersonID, I want to find all canines they're currently responsible for. The (simplified) query I'd use in SQL would be: Select Canine.* from Canine inner join CanineHandler on(CanineHandler.CanineID=Canine.CanineID) inner join (select CanineID,Max(EffectiveDate) MaxEffectiveDate from caninehandler group by CanineID) as CurrentHandler on(CurrentHandler.CanineID=CanineHandler.CanineID and CurrentHandler.MaxEffectiveDate=CanineHandler.EffectiveDate) where CanineHandler.HandlerPersonID=@PersonID Edit: Added mapping files below: <class name="CanineHandler" table="CanineHandler" schema="dbo"> <id name="CanineHandlerID" type="Int32"> <generator class="identity" /> </id> <property name="EffectiveDate" type="DateTime" precision="16" not-null="true" /> <property name="HandlerPersonID" type="Int64" precision="19" not-null="true" /> <many-to-one name="Canine" class="Canine" column="CanineID" not-null="true" access="field.camelcase-underscore" /> </class> <class name="Canine" table="Canine"> <id name="CanineID" type="Int32"> <generator class="identity" /> </id> <property name="Name" type="String" length="64" not-null="true" /> ... <set name="CanineHandlers" table="CanineHandler" inverse="true" order-by="EffectiveDate desc" cascade="save-update" access="field.camelcase-underscore"> <key column="CanineID" /> <one-to-many class="CanineHandler" /> </set> <property name="IsDeleted" type="Boolean" not-null="true" /> </class> I haven't tried yet, but I'm guessing I could do this in HQL. I haven't had to write anything in HQL yet, so I'll have to tackle that eventually anyway, but my question is whether/how I can do this sub-query with the criterion/subqueries objects. I got as far as creating the following detached criteria: DetachedCriteria effectiveHandlers = DetachedCriteria.For<Canine>() .SetProjection(Projections.ProjectionList() .Add(Projections.Max("EffectiveDate"),"MaxEffectiveDate") .Add(Projections.GroupProperty("CanineID"),"handledCanineID") ); but I can't figure out how to do the inner join. If I do this: Session.CreateCriteria<Canine>() .CreateCriteria("CanineHandler", "handler", NHibernate.SqlCommand.JoinType.InnerJoin) .List<Canine>(); I get an error "could not resolve property: CanineHandler of: OPS.CanineApp.Model.Canine". Obviously I'm missing something(s) but from the documentation I got the impression that should return a list of Canines that have handlers (possibly with duplicates). Until I can make this work, adding the subquery isn't going to work... I've found similar questions, such as http://stackoverflow.com/questions/747382/only-get-latest-results-using-nhibernate but none of the answers really seem to apply with the kind of direct result I'm looking for. Any help or suggestion is greatly appreciated.

    Read the article

  • Problem with script to add/delete from database

    - by Jason
    Ok - the user enters a product code, price and name using a form - the script then either adds it to the database or deletes it from the database. If the user is trying to delete a product that is not in the database they get a error message. Upon successful adding/deleting they also get a message. However, when I test it - I just get a blank page. Perl doesnt come up with any warnings, syntax errors or anything - says everything is fine... but I still just get a blank page. The script... #!/usr/bin/perl #c09ex5.cgi - saves data to and removes data from a database print "Content-type: text/html\n\n"; use CGI qw(:standard); use SDBM_File; use Fcntl; use strict; #declare variables my ($code, $name, $price, $button, $codes, $names, $prices); #assign values to variables $code = param('Code'); $name = param('Name'); $price = param('Price'); $button = param('Button'); ($code, $name, $price) = format_input(); ($codes, $names, $prices) = ($code, $name, $price); if ($button eq "Save") { add(); } elsif ($button eq "Delete") { remove(); } exit; sub format_input { $codes =~ s/^ +//; $codes =~ s/ +$//; $codes =~ tr/a-z/A-Z/; $codes =~ tr/ //d; $names =~ s/^ +//; $names =~ s/ +$//; $names =~ tr/ //d; $names = uc($names); $prices =~ s/^ +//; $prices =~ s/ +$//; $prices =~ tr/ //d; $prices =~ tr/$//d; } sub add { #declare variable my %candles; #open database, format and add record, close database tie(%candles, "SDBM_File", "candlelist", O_CREAT|O_RDWR, 0666) or die "Error opening candlelist. $!, stopped"; format_vars(); $candles{$codes} = "$names,$prices"; untie(%candles); #create web page print "<HTML>\n"; print "<HEAD><TITLE>Candles Unlimited</TITLE></HEAD>\n"; print "<BODY>\n"; print "<FONT SIZE=4>Thank you, the following product has been added.<BR>\n"; print "Candle: $codes $names $prices</FONT>\n"; print "</BODY></HTML>\n"; } #end add sub remove { #declare variables my (%candles, $msg); tie(%candles, "SDBM_File", "candlelist", O_RDWR, 0) or die "Error opening candlelist. $!, stopped"; format_vars(); #determine if the product is listed if (exists($candles{$codes})) { delete($candles{$codes}); $msg = "The candle $codes $names $prices has been removed."; } else { $msg = "The product you entered is not in the database"; } #close database untie(%candles); #create web page print "<HTML>\n"; print "<HEAD><TITLE>Candles Unlimited</TITLE></HEAD>\n"; print "<BODY>\n"; print "<H1>Candles Unlimited</H1>\n"; print "$msg\n"; print "</BODY></HTML>\n"; }

    Read the article

  • How to prevent PHP variables from being arrays or objects?

    - by MJB
    I think that (the title) is the problem I am having. I set up a MySQL connection, I read an XML file, and then I insert those values into a table by looping through the elements. The problem is, instead of inserting only 1 record, sometimes I insert 2 or 3 or 4. It seems to depend on the previous values I have read. I think I am reinitializing the variables, but I guess I am missing something -- hopefully something simple. Here is my code. I originally had about 20 columns, but I shortened the included version to make it easier to read. $ctr = 0; $sql = "insert into csd (id,type,nickname,hostname,username,password) ". "values (?,?,?,?,?,?)"; $cur = $db->prepare($sql); for ($ctr = 0; $ctr < $expected_count; $ctr++) { unset($bind_vars,$dat); $lbl = "csd_{$ctr}"; $dat['type'] = (string) $ref->itm->csds->$lbl->type; $dat['nickname'] = (string) $ref->itm->csds->$lbl->nickname; $dat['hostname'] = (string) $ref->itm->csds->$lbl->hostname; $dat['username'] = (string) $ref->itm->csds->$lbl->username; $dat['password'] = (string) $ref->itm->csds->$lbl->password; $bind_vars = array( $id,$dat['$type'], $dat['$nickname'], $dat['$hostname'], $dat['$username'], $dat['$password']); print_r ($bind_vars); $res = $db->execute($cur, $bind_vars); } P.S. I also tagged this SimpleXML because that is how I am reading the file, though that code is not included above. It looks like this: $ref = simplexml_load_file($file); UPDATE: I've changed the code around as per suggestions, and now it is not always the same pattern, but it is equally broken. When I display the bind array before inserting, it looks like this. Note that I also count the rows before and after, so there are 0 rows, then I insert 1, then there are 2: 0 CSDs on that ITEM now. Array ( [0] => 2 [1] => 0 [2] => [3] => X [4] => XYZ [5] => [6] => [7] => [8] => audio [9] => [10] => 192.168.0.50 [11] => 192.168.0.3 [12] => 255.255.255.0 [13] => 255.255.255.0 [14] => [15] => [16] => [17] => 21 [18] => 5 [19] => Y [20] => /dir ) 2 CSDs on that ITEM now.

    Read the article

< Previous Page | 765 766 767 768 769 770 771 772 773 774 775 776  | Next Page >