Search Results

Search found 4636 results on 186 pages for 'jedi master spooky'.

Page 78/186 | < Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >

  • Thunderbird doesn't show folders on a new Dovecot install

    - by Zoran Zaric
    Hey, I set up a new mailserver with postfix and Dovecot some days ago, everything is working except for Thunderbird not showing any folders. Evolution shows me all folders. I migrated from a Courier install using imapsync. In the filesystem the folders don't have a INBOX in their name, so the tho folders ar called .Folder 1 not .INBOX.Folder 1. This is the output of dovecot -n: # 1.0.10: /etc/dovecot/dovecot.conf Warning: mail_extra_groups setting was often used insecurely so it is now deprecated, use mail_access_groups or mail_privileged_group instead base_dir: /var/run/dovecot/ log_timestamp: “%Y-%m-%d %H:%M:%S ” protocols: imap pop3 listen(default): *:143 listen(imap): *:143 listen(pop3): *:110 disable_plaintext_auth: no login_dir: /var/run/dovecot//login login_executable(default): /usr/lib/dovecot/imap-login login_executable(imap): /usr/lib/dovecot/imap-login login_executable(pop3): /usr/lib/dovecot/pop3-login first_valid_uid: 1001 last_valid_uid: 1001 mail_extra_groups: vmail mail_access_groups: vmail mail_location: maildir:/var/vmail/%d/%u maildir_copy_with_hardlinks: yes mail_executable(default): /usr/lib/dovecot/imap mail_executable(imap): /usr/lib/dovecot/imap mail_executable(pop3): /usr/lib/dovecot/pop3 mail_plugin_dir(default): /usr/lib/dovecot/modules/imap mail_plugin_dir(imap): /usr/lib/dovecot/modules/imap mail_plugin_dir(pop3): /usr/lib/dovecot/modules/pop3 pop3_uidl_format(default): pop3_uidl_format(imap): pop3_uidl_format(pop3): %08Xu%08Xv auth default: user: nobody passdb: driver: sql args: /etc/dovecot/dovecot-sql.conf userdb: driver: sql args: /etc/dovecot/dovecot-sql.conf socket: type: listen client: path: /var/spool/postfix/private/auth mode: 432 user: postfix group: postfix master: path: /var/run/dovecot/auth-master mode: 432 user: vmail group: vmail Thanks!

    Read the article

  • Verification of files on backup media - after the backup

    - by Greg Sansom
    I have a system in place where I back up my work files daily to a portable hard drive. I actually have two portable hard drives - one is stored off-site and I swap them regularly. I also keep my family photos and other historical files backed up, but I only back the photos up occasionally (ie when I have new photos). The backup media is for backup only, and it is unlikely I will ever read the files from the backup media unless a disaster occurs and I lose the master. It worries me that my backed up files could become corrupt without me knowing it. It is also feasible that my master files could become corrupt, and eventually the corrupt files would be replicated to the backup media. I'm currently using Cobian Backup, but I'm open to alternatives. Is there a tool I can use to confirm that the backed up files are identical to the files that were first copied? I know it would be possible to generate a checksum and periodically validate the backup files against the original checksum, but I'm looking for a tool which will do this automatically.

    Read the article

  • Fedora 16 can connect to samba share using smbclient but not in nautilus 3.2.1

    - by Nathan Jones
    I have a machine running Ubuntu 11.10 Server acting as a Samba server to share my home directory. Everything works fine on my Windows 7 machine, but on my Fedora 16 laptop, if I use Nautilus to try to access the share using smb://192.168.0.8/nathan in the location bar, it just has the loading cursor and does nothing. It never shows any errors, nothing. Using smbclient works just fine, but I'd like to get it working in Nautilus. I know that there can be problems with SELinux and Samba, so I created a file called booleans.local that contains samba_enable_home_dirs=1. My smb.conf file looks like this: # For Unix password sync to work on a Debian GNU/Linux system, the following # parameters must be set (thanks to Ian Kahan <<[email protected]> for # sending the correct chat script for the passwd program in Debian Sarge). passwd program = /usr/bin/passwd %u passwd chat = *Enter\snew\s*\spassword:* %n\n *Retype\snew\s*\spassword:* %n\n *password\supdated\ssuccessfully* . # This boolean controls whether PAM will be used for password changes # when requested by an SMB client instead of the program listed in # 'passwd program'. The default is 'no'. pam password change = yes # This option controls how unsuccessful authentication attempts are mapped # to anonymous connections map to guest = bad user ########## Domains ########### # Is this machine able to authenticate users. Both PDC and BDC # must have this setting enabled. If you are the BDC you must # change the 'domain master' setting to no # ; domain logons = yes # # The following setting only takes effect if 'domain logons' is set # It specifies the location of the user's profile directory # from the client point of view) # The following required a [profiles] share to be setup on the # samba server (see below) ; logon path = \\%N\profiles\%U # Another common choice is storing the profile in the user's home directory # (this is Samba's default) # logon path = \\%N\%U\profile # The following setting only takes effect if 'domain logons' is set # It specifies the location of a user's home directory (from the client # point of view) ; logon drive = H: # logon home = \\%N\%U # The following setting only takes effect if 'domain logons' is set # It specifies the script to run during logon. The script must be stored # in the [netlogon] share # NOTE: Must be store in 'DOS' file format convention ; logon script = logon.cmd # This allows Unix users to be created on the domain controller via the SAMR # RPC pipe. The example command creates a user account with a disabled Unix # password; please adapt to your needs ; add user script = /usr/sbin/adduser --quiet --disabled-password --gecos "" %u # This allows machine accounts to be created on the domain controller via the # SAMR RPC pipe. # The following assumes a "machines" group exists on the system ; add machine script = /usr/sbin/useradd -g machines -c "%u machine account" -d /var/lib/samba -s /bin/false %u # This allows Unix groups to be created on the domain controller via the SAMR # RPC pipe. ; add group script = /usr/sbin/addgroup --force-badname %g ########## Printing ########## # If you want to automatically load your printer list rather # than setting them up individually then you'll need this # load printers = yes # lpr(ng) printing. You may wish to override the location of the # printcap file ; printing = bsd ; printcap name = /etc/printcap # CUPS printing. See also the cupsaddsmb(8) manpage in the # cupsys-client package. ; printing = cups ; printcap name = cups ############ Misc ############ # Using the following line enables you to customise your configuration # on a per machine basis. The %m gets replaced with the netbios name # of the machine that is connecting ; include = /home/samba/etc/smb.conf.%m # Most people will find that this option gives better performance. # See smb.conf(5) and /usr/share/doc/samba-doc/htmldocs/Samba3-HOWTO/speed.html # for details # You may want to add the following on a Linux system: # SO_RCVBUF=8192 SO_SNDBUF=8192 # socket options = TCP_NODELAY # The following parameter is useful only if you have the linpopup package # installed. The samba maintainer and the linpopup maintainer are # working to ease installation and configuration of linpopup and samba. ; message command = /bin/sh -c '/usr/bin/linpopup "%f" "%m" %s; rm %s' & # Domain Master specifies Samba to be the Domain Master Browser. If this # machine will be configured as a BDC (a secondary logon server), you # must set this to 'no'; otherwise, the default behavior is recommended. # domain master = auto # Some defaults for winbind (make sure you're not using the ranges # for something else.) ; idmap uid = 10000-20000 ; idmap gid = 10000-20000 ; template shell = /bin/bash # The following was the default behaviour in sarge, # but samba upstream reverted the default because it might induce # performance issues in large organizations. # See Debian bug #368251 for some of the consequences of *not* # having this setting and smb.conf(5) for details. ; winbind enum groups = yes ; winbind enum users = yes # Setup usershare options to enable non-root users to share folders # with the net usershare command. # Maximum number of usershare. 0 (default) means that usershare is disabled. ; usershare max shares = 100 # Allow users who've been granted usershare privileges to create # public shares, not just authenticated ones usershare allow guests = yes #======================= Share Definitions ======================= # Un-comment the following (and tweak the other settings below to suit) # to enable the default home directory shares. This will share each # user's home director as \\server\username [homes] comment = Home Directories browseable = yes # By default, the home directories are exported read-only. Change the # next parameter to 'no' if you want to be able to write to them. read only = no # File creation mask is set to 0700 for security reasons. If you want to # create files with group=rw permissions, set next parameter to 0775. ; create mask = 0775 # Directory creation mask is set to 0700 for security reasons. If you want to # create dirs. with group=rw permissions, set next parameter to 0775. ; directory mask = 0775 # By default, \\server\username shares can be connected to by anyone # with access to the samba server. Un-comment the following parameter # to make sure that only "username" can connect to \\server\username # The following parameter makes sure that only "username" can connect # # This might need tweaking when using external authentication schemes valid users = %S # Un-comment the following and create the netlogon directory for Domain Logons # (you need to configure Samba to act as a domain controller too.) ;[netlogon] ; comment = Network Logon Service ; path = /home/samba/netlogon ; guest ok = yes ; read only = yes # Un-comment the following and create the profiles directory to store # users profiles (see the "logon path" option above) # (you need to configure Samba to act as a domain controller too.) # The path below should be writable by all users so that their # profile directory may be created the first time they log on ;[profiles] ; comment = Users profiles ; path = /home/samba/profiles ; guest ok = no ; browseable = no ; create mask = 0600 ; directory mask = 0700 [printers] comment = All Printers browseable = no path = /var/spool/samba printable = yes guest ok = no read only = no create mask = 0700 # Windows clients look for this share name as a source of downloadable # printer drivers [print$] comment = Printer Drivers path = /var/lib/samba/printers browseable = yes read only = yes guest ok = no # Uncomment to allow remote administration of Windows print drivers. # You may need to replace 'lpadmin' with the name of the group your # admin users are members of. # Please note that you also need to set appropriate Unix permissions # to the drivers directory for these users to have write rights in it ; write list = root, @lpadmin # A sample share for sharing your CD-ROM with others. ;[cdrom] ; comment = Samba server's CD-ROM ; read only = yes ; locking = no ; path = /cdrom ; guest ok = yes # The next two parameters show how to auto-mount a CD-ROM when the # cdrom share is accesed. For this to work /etc/fstab must contain # an entry like this: # # /dev/scd0 /cdrom iso9660 defaults,noauto,ro,user 0 0 # # The CD-ROM gets unmounted automatically after the connection to the # # If you don't want to use auto-mounting/unmounting make sure the CD # is mounted on /cdrom # ; preexec = /bin/mount /cdrom ; postexec = /bin/umount /cdrom smbusers: <nathan> = <"nathan"> Any help would be very much appreciated! Thanks!

    Read the article

  • Problem setting command-line console resolution. vbeinfo in grub2 does not report all resolutions

    - by Kent
    I have a Asus EEE PC 1005P which I installed a Command-line system on using the Alternate Installer CD of Ubuntu Lucid Lynx. Altough I think this is a general linux and grub2 question. I do not have (or want) the X Window System installed. I want to change my console screen resolution (not inside X) to 1024x600. But it isn't reported when I use vbeinfo inside grub: grub> vbeinfo VBE info: version: 3.0 OEM software rev: 1.0 total memory: 8128 KiB List of compatible video modes: Legend: P=Packed pixel, D=Direct color, mask/pos=R/G/B/reserved 0x112: 640 x 480 x 32 Direct, mask: 8/8/8/8 pos: 16/8/0/24 0x114: 800 x 600 x 16 Direct, mask: 5/6/5/0 pos: 11/5/0/0 0x115: 800 x 600 x 32 Direct, mask: 8/8/8/8 pos: 16/8/0/24 0x101: 640 x 480 x 8 Packed 0x103: 800 x 600 x 8 Packed 0x111: 640 x 480 x 16 Direct, mask: 5/6/5/0 pos: 11/5/0/0 Configured VBE mode (vbe_mode) = ox101 grub> Relevant parts of sudo lspci -v: ... ... 00:02.0 VGA compatible controller: Intel Corporation N10 Family Integrated Graphics Controller Subsystem: ASUSTeK Computer Inc. Device 83ac Flags: bus master, fast devsel, latency 0, IRQ 28 ... Kernel driver in use: i915 Kernel modules: i915 00:02.1 Display controller: Intel Corporation N10 Family Integrated Graphics Controller Subsystem: ASUSTeK Computer Inc. Device 83ac Flags: bus master, fast devsel, latency 0, IRQ 28 ... ... ... Any ideas on how I can set the console resultion like I want it?

    Read the article

  • Where should CentOS users get /usr/share/virtio-win/drivers for virt-v2v?

    - by Philip Durbin
    I need to migrate a number of virtual machines from VMware ESX to CentOS 6 KVM hypervisors. Ultimately, I wrote an RPM spec file that solved my problem at https://github.com/fasrc/virtio-win/blob/master/virtio-win.spec but I'm not sure if there's another RPM in base CentOS or EPEL (something standard) I should be using instead. Originally, I was getting this "No root device found in this operating system image" error when attemting to migrate a Window 2008 VM. . . [root@kvm01b ~]# virt-v2v -ic 'esx://my-vmware-hypervisor.example.com/' \ -os transferimages --network default my-vm virt-v2v: No root device found in this operating system image. . . . but I solved this with a simply yum install libguestfs-winsupport since the docs say: If you attempt to convert a virtual machine using NTFS without the libguestfs-winsupport package installed, the conversion will fail. Next I got an error about missing drivers for Windows 2008. . . [root@kvm01b ~]# virt-v2v -ic 'esx://my-vmware-hypervisor.example.com/' \ -os transferimages --network default my-vm my-vm_my-vm: 100% [====================================]D virt-v2v: Installation failed because the following files referenced in the configuration file are required, but missing: /usr/share/virtio-win/drivers/amd64/Win2008 . . . and I resolved this by grabbing an iso from Fedora at http://alt.fedoraproject.org/pub/alt/virtio-win/latest/ as recommended by http://www.linux-kvm.org/page/WindowsGuestDrivers/Download_Drivers and building an RPM from it with this spec file: https://github.com/fasrc/virtio-win/blob/master/virtio-win.spec Now, virt-v2v exits without error: [root@kvm01b ~]# virt-v2v -ic 'esx://my-vmware-hypervisor.example.com/' \ -os transferimages --network default my-vm my-vm_my-vm: 100% [====================================]D virt-v2v: my-vm configured with virtio drivers. [root@kvm01b ~]# Now, my question is, rather that the virtio-win RPM from the spec file I wrote, is there some other more standard RPM in base CentOS or EPEL that will resolve the error above? Here's a bit more detail about my setup: [root@kvm01b ~]# cat /etc/redhat-release CentOS release 6.2 (Final) [root@kvm01b ~]# rpm -q virt-v2v virt-v2v-0.8.3-5.el6.x86_64 See also Bug 605334 – VirtIO driver for windows does not show specific OS: Windows 7, Windows 2003

    Read the article

  • award phoenix bios not recognizing my sata hdd.

    - by josh
    What am I doing wrong? I have a custom built comp with a Fatal1ty AA8XE mobo. It has 4 SATA ports and one IDE port. When i first got it, I had a really hard time putting in more than one hard drive. Right now i have one 120gb IDE HDD on master and my DVD+-RW on slave connected to the one IDE spot on the mobo. I ripped a bunch of movies and filled up my HDD, so I got a WD 80gb SATA drive. I plugged it into SATA1 and hooked up the power, turned on comp, went into bios. The only thing in any option in any of the menues in this crazy lookin bios is a thing that says "SATA mode". i put it on IDE, set it so PATA is primary, SATA is secondary. booted up my comp, nothin. Not recognizing the SATA. I went back into the bios and checked it all again. I saw that it says SATA2 and SATA4 are the secondaries so i put it on SATA2, booted, nothing, same with SATA4, same with SATA3, all same as SATA1. Bios and wt os are not recognizing the drive as being there at all. I even downloaded and printed the almost 100 page manual for the mobo, read the entire thing, and still can't figure it out. I know there are a lot of people out there smarter than me when it comes to computers. So please, somebody, anybody, please tell me something that I'm not seeing. Some setting somewhere that I didn't configure right. There is something, obviously, but I can't find it. As far as i can tell, everything is set perfectly fine for my 120gb to be the master and the SATA to be the slave. I don't know what I'm doing wrong but I'm seriously about to throw this computer out the window. thankyou in advance to whoever attempts to help.

    Read the article

  • MySQL replication - rapidly growing relay bin logs

    - by Rob Forrest
    Morning all, I've got a really strange situation here this morning much like a reportedly fixed MySQL bug. http://bugs.mysql.com/bug.php?id=28421 My relay bin logs are rapidly filling with an infinite loop of junk made of this sort of thing. #121018 5:40:04 server id 101 end_log_pos 15598207 #Append_block: file_id: 2244 block_len: 8192 # at 15598352 #121018 5:40:04 server id 101 end_log_pos 15606422 #Append_block: file_id: 2244 block_len: 8192 # at 15606567 ... # at 7163731 #121018 5:38:39 server id 101 end_log_pos 7171801 #Append_block: file_id: 2243 block_len: 8192 WARNING: Ignoring Append_block as there is no Create_file event for file_id: 2243 # at 7171946 #121018 5:38:39 server id 101 end_log_pos 7180016 #Append_block: file_id: 2243 block_len: 8192 WARNING: Ignoring Append_block as there is no Create_file event for file_id: 2243 These log files grow to 1Gb within about a minute before rotating and starting again. These big files are interspersed with 1 or 2 smaller files with just this in /*!40019 SET @@session.max_insert_delayed_threads=0*/; /*!50003 SET @OLD_COMPLETION_TYPE=@@COMPLETION_TYPE,COMPLETION_TYPE=0*/; DELIMITER /*!*/; # at 4 #121023 9:43:05 server id 100 end_log_pos 106 Start: binlog v 4, server v 5.1.61-log created 121023 9:43:05 BINLOG ' mViGUA9kAAAAZgAAAGoAAAAAAAQANS4xLjYxLWxvZwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAEzgNAAgAEgAEBAQEEgAAUwAEGggAAAAICAgC '/*!*/; # at 106 #121023 9:43:05 server id 100 end_log_pos 156 Rotate to mysqld-relay-bin.000003 pos: 4 DELIMITER ; # End of log file ROLLBACK /* added by mysqlbinlog */; /*!50003 SET COMPLETION_TYPE=@OLD_COMPLETION_TYPE*/; We're running a master-master replication setup with the problematic server running mysql 5.1.61. The other server which is, for the moment, stable is running 5.1.58. Has anyone got any ideas what the solution is to this and moreover, what might have caused this?

    Read the article

  • DNS configuration issues. Clients inside network unable to resolve DNS server's name

    - by hydroparadise
    Setup the DNS service on Ubuntu 12.04 64 and all apears to be well except that my dhcp clients do not recognize my DNS servers hostname. When doing a nslookup on one of my Windows clients, I get C:\Users\chad>nslookup Default Server: UnKnown Address: 192.168.1.2 Where I would expect the FQDN in the spot where UnKnown is seen. The DNS server know's itself pretty well, but I think only because I have an entry in the /etc/hosts file to resolve. There's so many places to look I don't even know where to begin. Are there any logs I can look at? Something. Places I've looked at and configured: /etc/bind/zones/domain.com.db /etc/bind/zones/rev.1.168.192.in-addr.arpa /etc/bind/named.conf.local EDIT: '/etc/bind/zones/rev.1.168.192.in-addr.arpa' @ IN SOA dns-serv1.mydomain.com [email protected]. ( 2006081401; 28800; 604800; 604800; 86400 ) IN NS dns-serv1.mydomain.com. 2 IN PTR dns-serv1 2 IN PTR mydomain.com EDIT 2: '/etc/bind/named.conf.local' zone "mydomain.com" { type master; file "/etc/bind/zones/mydomain.com.db"; }; zone "1.168.192.in-addr.arpa" { type master; file "/etc/bind/zones/rev.0.168.192.in-addr.arpa"; };

    Read the article

  • netlogon errors

    - by rorr
    I have two instances of mssql 2005 and am using CA XOSoft replication. The master is a failover cluster and the replica is a standalone server. They are all running Server 2003 sp2 x64. Same patch levels on all servers. This setup has worked great for several months until we recently restricted the RPC ports on both nodes of the master(5000 - 6000 using rpccfg.exe). We have to implement egress filtering, thus the limiting of the ports. We began receiving login errors for sql windows authentication and NETLOGON Event ID: 5719: This computer was not able to set up a secure session with a domain controller in domain due to the following: Not enough storage is available to process this command. This may lead to authentication problems. Make sure that this computer is connected to the network. If the problem persists, please contact your domain administrator. We also see group policies failing to update and cluster file shares go offline at the same time. The RPC ports were set back to default when we started seeing these problems and the servers rebooted, but the problems persist. The domain controllers are not showing any errors. Running dcdiag and netdiag shows everything is fine. We have noticed that the XOSoft service ws_rep.exe is using a lot of handles(8 - 9k), about the same number that sqlserver is using. As soon as xosoft replication is stopped the login errors cease and everything functions correctly. I have opened a ticket with CA for XOSoft, but I'm not sure that the problem is actually xosoft, but that it is the one bringing the problem to light. I'm looking for tips on debugging RPC problems. Specifically on limiting the ports and then reverting the changes.

    Read the article

  • DNS Server on Fedora 11

    - by Funky Si
    I recently upgraded my Fedora 10 server to Fedora 11 and am getting the following error in my DNS/named config. named[27685]: not insecure resolving 'fedoraproject.org/A/IN: 212.104.130.65#53 This only shows for certain addresses some are resolved fine and I can ping and browse to them fine, while others produce the error above. This is my named.conf file acl trusted-servers { 192.168.1.10; }; options { directory "/var/named"; forwarders {212.104.130.9 ; 212.104.130.65; }; forward only; allow-transfer { 127.0.0.1; }; # dnssec-enable yes; # dnssec-validation yes; # dnssec-lookaside . trust-anchor dlv.isc.org.; }; # Forward Zone for hughes.lan domain zone "funkygoth" IN { type master; file "funkygoth.zone"; allow-transfer { trusted-servers; }; }; # Reverse Zone for hughes.lan domain zone "1.168.192.in-addr.arpa" IN { type master; file "1.168.192.zone"; }; include "/etc/named.dnssec.keys"; include "/etc/pki/dnssec-keys/dlv/dlv.isc.org.conf"; include "/etc/pki/dnssec-keys//named.dnssec.keys"; include "/etc/pki/dnssec-keys//dlv/dlv.isc.org.conf"; Anyone know what I have set wrong here?

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Flash Media Server won't run on RHEL 6.2 EC2 instance - _defaultRoot__edge1 experienced 1 failure

    - by edoloughlin
    I've got a fresh Redhat Enterprise 6.2 64-bit instance on EC2. I've turned off the firewall and have installed an FMS 4.5 dev server. The FMS install failed, complaining about a missing libcap.so until I installed the libcap.i686 package. The following libcap packages are now installed: libcap.i686 2.16-5.5.el6 @rhui-us-east-1-rhel-server-releases libcap.x86_64 2.16-5.5.el6 @koji-override-0/$releasever libcap-ng.x86_64 0.6.4-3.el6_0.1 @koji-override-0/$releasever libpcap.x86_64 14:1.0.0-6.20091201git117cb5.el6 In the logs directory I have admin and master logs (only). The admin logs look ok: #Fields: date time x-pid x-status x-ctx x-comment 2012-02-29 09:24:26 1144 (i)2581173 FMS detected IPv6 protocol stack! - 2012-02-29 09:24:26 1144 (i)2581173 FMS config <NetworkingIPv6 enable=false> - 2012-02-29 09:24:26 1144 (i)2581173 FMS running in IPv4 protocol stack mode! - 2012-02-29 09:24:26 1144 (i)2581173 Host: ip-10-204-143-55 IPv4: 10.204.143.55 - 2012-02-29 09:24:26 1144 (i)2571011 Server starting... - 2012-02-29 09:24:26 1144 (i)2631174 Listener started ( FCSAdminIpcProtocol ) : localhost:11110/v4 - 2012-02-29 09:24:27 1144 (i)2631174 Listener started ( FCSAdminAdaptor ) : 1111/v4 - 2012-02-29 09:24:28 1144 (i)2571111 Server started (./conf/Server.xml). - I can't connect an RTMP client to the FMS. The master logs contain these lines, repeating every 5 seconds: 2012-02-29 10:43:17 1076 (i)2581226 Edge (2790) is no longer active. - 2012-02-29 10:43:17 1076 (w)2581255 Edge (2790) _defaultRoot__edge1 experienced 1 failure[s]! - 2012-02-29 10:43:17 1076 (i)2581224 Edge (2793) started, arguments : -edgeports ":1935,80" -coreports "localhost:19350" -conf "/opt/adobe/fms/conf/Server.xml" -adaptor "_defaultRoot_" -name "_defaultRoot__edge1" -edgename "edge1". -

    Read the article

  • Puppet file transfer slow

    - by Noodles
    I have a puppet master and slaves in different datacenters. The latency between them is ~40ms. When I run "puppet agent --test" on a slave to apply the latest manifest it takes ~360 seconds to finish. After doing some digging I can see the main cause of the slow down is file transfers. It seems it's taking ~10 seconds to transfer each file. The files are only small (configuration files) so I can't understand why they would take so long. This is an example of a file in my manifest: file { "/etc/rsyncd.conf" : owner => "root", group => "root", mode => 644, source => "puppet:///files/rsyncd/rsyncd.conf" } Running puppet-profiler I see this: 10.21s - File[/etc/rsyncd.conf] It also seems I cannot update more than one server at once using puppet. If I run two servers at the same time then puppet takes twice as long. I have changed the puppet master from using webrick to mongrel, but this doesn't seem to help. This is making deploying changes painful. A simple config change can take an hour to roll out to all servers.

    Read the article

  • Linux NIC Bonding Issue (CentOS 4 / RHEL 3)

    - by jinanwow
    I am having an issue with bonding NICs on CentOS 4. It appears the bonding driver does work, but it is stuck in round-robin mode and I am trying to get to active-backup. The current config is: ifcfg-bond0 DEVICE=bond0 IPADDR=192.168.204.18 NETMASK=255.255.255.0 ONBOOT=yes BOOTPROTO=none USERCTL=no TYPE=Bonding BONDING_OPTS="mode=1 miimon=100" ifcfg-eth1 DEVICE=eth1 BOOTPROTO=none ONBOOT=yes TYPE=Ethernet MASTER=bond0 SLAVE=yes ifcfg-eth3 DEVICE=eth3 ONBOOT=yes BOOTPROTO=none TYPE=Ethernet MASTER=bond0 SLAVE=yes cat /proc/net/bonding/bond0 Ethernet Channel Bonding Driver: v2.6.3-rh (June 8, 2005) Bonding Mode: load balancing (round-robin) MII Status: up MII Polling Interval (ms): 0 Up Delay (ms): 0 Down Delay (ms): 0 Slave Interface: eth1 MII Status: up Link Failure Count: 0 Permanent HW addr: 00:17:a4:8f:94:b1 Slave Interface: eth3 MII Status: up Link Failure Count: 0 Permanent HW addr: 00:1b:21:56:b8:69 cat /etc/modprobe.conf alias eth0 tg3 alias eth1 tg3 alias eth3 e1000 alias eth2 e1000 alias bond0 bonding options bond0 mode=1 miimon=100 I have tried moving the bonding information out of the ifcfg-bond0 into the modprobe configuration file. It seems that it is stuck in RR and I am trying to get it into the Active-backup (mode 1) state. Any ideas what would be causing this issue?

    Read the article

  • Gittornado with Nginx fails to push and pull

    - by Josh Buell
    I'm making a simple website to host git repositories, much like github. I'm using Gittornado to handle git Smart HTTP requests, and it works perfectly locally; I can clone, push, pull, etc... But when I put it behind Nginx, git commands stop working, giving no errors except: "fatal: The remote end hung up unexpectedly" I know that it's Nginx that's causing the trouble because if I open the port that tornado is running on and try my git commands through that (i.e. "git pull \http://mysite.com:8000/myrepository master" instead of "git pull \http://mysite.com/myrepository master" [backslashes added because Server Fault says I have too many links]) everything works as expected. The Nginx access and error logs don't seem to say anything interesting, so I'm reasonably sure that it has something to do with the way Nginx is compressing or chunking the requests/responses, causing git to think there's been an unexpected hangup, but I'm not sure what to do to fix it, since this is my first time with Nginx. My Nginx configuration file is basically a clone of the on found here; I've tried commenting out various likely-seeming options to see if they were causing the problem, but none of them fixed it so I assume there's some default behavior I need to suppress, I'm just not sure which. Any thoughts on how to fix this? Since it works not through Nginx, I'm considering just redirecting git requests to the tornado port itself, but this feels like a hack rather than a clean solution...

    Read the article

  • How to set up Git on remote instance using keys from local machine?

    - by Lucas
    I have a setup where I can ssh into my remote server (ie a Google Compute instance) from my local machine. I used to be able to clone, push, and pull from a repository on my remote instance without adding any keys to my remote instance, nor adding any new keys to my repository online (just the public key from my local machine). I believe the remote instance was using the keys from my local machine to authenticate my Git pushes and pulls. However, the system broke when I reinstalled the OS on my local machine. Now I when I try to connect with the Github server from my remote instance, I get the following: Cannot clone: [lucas@ecoinstance]~/node$ git clone [email protected]:lucasExample/test.git test Cloning into 'test'... Permission denied (publickey). fatal: The remote end hung up unexpectedly Cannot push: [lucas@ecoinstance]~/node/nodetest1$ git status # On branch master # Your branch is ahead of 'origin/master' by 1 commit. # nothing to commit (working directory clean) [lucas@ecoinstance]~/node/nodetest1$ git push Permission denied (publickey). fatal: The remote end hung up unexpectedly Additional info: [lucas@ecoinstance]~/node/nodetest1$ ssh-add -l Could not open a connection to your authentication agent. [lucas@ecoinstance]~/.ssh$ ls authorized_keys known_hosts As you can see, I have no keys on my remote instance. I have never had keys on the remote, and it would push and pull just fine until I re-installed my local OS. I can still clone, push, and pull on my local machine, it is just my remote machine that cannot get authentication. My local OS is Ubuntu 14.04 and my remote OS is Debian Wheezy. Any suggestions would be great. I am not sure how to search for this concept where I can authenticate from a remote instance via my local machine, so any reference are appreciated as well.

    Read the article

  • Mirror a Dropbox repository in Sharepoint and restrict access

    - by Dan Robson
    I'm looking for an elegant way to solve the following problem: My development team uses Dropbox for sharing documents amongst our immediate group. We'd like to put some of those documents into a SharePoint repository for the larger group to be able to access, as granting Dropbox access to the group at large is not ideal. However, we'd like to continue to be able to propagate changes to the SharePoint site simply by updating the files in Dropbox on our local client machines, and also vice versa - users granted access on SharePoint that update files in that workspace should be able to save their files and the changes should appear automatically on our client PC's. I've already done the organization of the folders so that in Dropbox, there exists a SharePoint folder that looks something like this: SharePoint ----Team --------Restricted Access Folders ----Organization --------Open Access Folders The Dropbox master account and the SharePoint master account are both set up on my file server. Unfortunately, Dropbox doesn't seem to allow syncing of folders anywhere above the \Dropbox\ part of the file system's hierarchy - or all I would have to do is find where the Sharepoint repository is maintained locally, and I'd be golden. So it seems I have to do some sort of 2-way synchronization between the Dropbox folder on the file server and the SharePoint folder on the file server. I messed around with Microsoft SyncToy, but it seems to be lacking in the area of real-time updating - and as much as I love rsync, I've had nothing but bad luck with it on Windows, and again, it has to be kicked off manually or through Task Scheduler - and I just have a feeling if I go down that route, it's only a matter of time before I get conflicts all over the place in either Dropbox, SharePoint, or both. I really want something that's going to watch both folders, and when one item changes, the other automatically updates in "real-time". It's quite possible I'm going down the entirely wrong route, which is why I'm asking the question. For simplicity's sake, I'll restate the goal: To be able to update Dropbox and have it viewable on the SharePoint site, or to update the SharePoint site and have it viewable in Dropbox. And since I'm a SharePoint noob, I'll also need help hiding the "Team" subfolder from everyone not in a specific group in AD.

    Read the article

  • Fix Corrupted Ruby in Mac OS X Lion

    - by luckyb56
    I screwed up my ruby buy executing the command sudo easy_install pip> /usr/bin/ruby -e "$(/usr/bin/curl -fksSL https://raw.github.com/mxcl/homebrew/master/Library/Contributions/install_homebrew.rb)" It showed error: Couldn't find index page for '-e' (maybe misspelled?) No local packages or download links found for -e error: Could not find suitable distribution for Requirement.parse('-e') After that when I tried to install Brew by: /usr/bin/ruby -e "$(/usr/bin/curl -fksSL https://raw.github.com/mxcl/homebrew/master/Library/Contributions/install_homebrew.rb)" It shows error which I have no idea: /usr/bin/ruby: line 1: Searching: command not found /usr/bin/ruby: line 2: Best: command not found /usr/bin/ruby: line 3: Processing: command not found Usage: pip COMMAND [OPTIONS] pip: error: No command by the name pip 1.1 (maybe you meant "pip install 1.1") /usr/bin/ruby: line 5: Installing: command not found /usr/bin/ruby: line 6: Installing: command not found /usr/bin/ruby: line 8: Using: command not found /usr/bin/ruby: line 9: Processing: command not found /usr/bin/ruby: line 10: Finished: command not found /usr/bin/ruby: line 11: Searching: command not found /usr/bin/ruby: line 12: Reading: command not found /usr/bin/ruby: line 13: syntax error near unexpected token `(' /usr/bin/ruby: line 13: `Scanning index of all packages (this may take a while)' Can this be fixed?

    Read the article

  • Nginx + uWSGI + Django performance stuck on 100rq/s

    - by dancio
    I have configured Nginx with uWSGI and Django on CentOS 6 x64 (3.06GHz i3 540, 4GB), which should easily handle 2500 rq/s but when I run ab test ( ab -n 1000 -c 100 ) performance stops at 92 - 100 rq/s. Nginx: user nginx; worker_processes 2; events { worker_connections 2048; use epoll; } uWSGI: Emperor /usr/sbin/uwsgi --master --no-orphans --pythonpath /var/python --emperor /var/python/*/uwsgi.ini [uwsgi] socket = 127.0.0.2:3031 master = true processes = 5 env = DJANGO_SETTINGS_MODULE=x.settings env = HTTPS=on module = django.core.handlers.wsgi:WSGIHandler() disable-logging = true catch-exceptions = false post-buffering = 8192 harakiri = 30 harakiri-verbose = true vacuum = true listen = 500 optimize = 2 sysclt changes: # Increase TCP max buffer size setable using setsockopt() net.ipv4.tcp_rmem = 4096 87380 8388608 net.ipv4.tcp_wmem = 4096 87380 8388608 net.core.rmem_max = 8388608 net.core.wmem_max = 8388608 net.core.netdev_max_backlog = 5000 net.ipv4.tcp_max_syn_backlog = 5000 net.ipv4.tcp_window_scaling = 1 net.core.somaxconn = 2048 # Avoid a smurf attack net.ipv4.icmp_echo_ignore_broadcasts = 1 # Optimization for port usefor LBs # Increase system file descriptor limit fs.file-max = 65535 I did sysctl -p to enable changes. Idle server info: top - 13:34:58 up 102 days, 18:35, 1 user, load average: 0.00, 0.00, 0.00 Tasks: 118 total, 1 running, 117 sleeping, 0 stopped, 0 zombie Cpu(s): 0.0%us, 0.0%sy, 0.0%ni,100.0%id, 0.0%wa, 0.0%hi, 0.0%si, 0.0%st Mem: 3983068k total, 2125088k used, 1857980k free, 262528k buffers Swap: 2104504k total, 0k used, 2104504k free, 606996k cached free -m total used free shared buffers cached Mem: 3889 2075 1814 0 256 592 -/+ buffers/cache: 1226 2663 Swap: 2055 0 2055 **During the test:** top - 13:45:21 up 102 days, 18:46, 1 user, load average: 3.73, 1.51, 0.58 Tasks: 122 total, 8 running, 114 sleeping, 0 stopped, 0 zombie Cpu(s): 93.5%us, 5.2%sy, 0.0%ni, 0.2%id, 0.0%wa, 0.1%hi, 1.1%si, 0.0%st Mem: 3983068k total, 2127564k used, 1855504k free, 262580k buffers Swap: 2104504k total, 0k used, 2104504k free, 608760k cached free -m total used free shared buffers cached Mem: 3889 2125 1763 0 256 595 -/+ buffers/cache: 1274 2615 Swap: 2055 0 2055 iotop 30141 be/4 nginx 0.00 B/s 7.78 K/s 0.00 % 0.00 % nginx: wo~er process Where is the bottleneck ? Or what am I doing wrong ?

    Read the article

  • Postfix Postscreen: how to use postscreen for smtp and smtps both

    - by petermolnar
    I'm trying to get postscreen work. I've followed the man page and it's already running correctly for smtp. But it I want to use it for smtps as well (adding the same line as smtp in master.cf but with smtps) i receive failure messages in syslog like: postfix/postscreen[8851]: fatal: btree:/var/lib/postfix/postscreen_cache: unable to get exclusive lock: Resource temporarily unavailable Some say that postscreen can only run once; that's ok. But can I use the same postscreen session for both smtp and smtps? If not, how to enable postscreen for smtps as well? Any help would be apprecieted! The parts of the configs: main.cf postscreen_access_list = permit_mynetworks, cidr:/etc/postfix/postscreen_access.cidr postscreen_dnsbl_threshold = 8 postscreen_dnsbl_sites = dnsbl.ahbl.org*3 dnsbl.njabl.org*3 dnsbl.sorbs.net*3 pbl.spamhaus.org*3 cbl.abuseat.org*3 bl.spamcannibal.org*3 nsbl.inps.de*3 spamrbl.imp.ch*3 postscreen_dnsbl_action = enforce postscreen_greet_action = enforce master.cf (full) smtpd pass - - n - - smtpd smtp inet n - n - 1 postscreen tlsproxy unix - - n - 0 tlsproxy dnsblog unix - - n - 0 dnsblog ### the problematic line ### smtps inet n - - - - smtpd pickup fifo n - - 60 1 pickup cleanup unix n - - - 0 cleanup qmgr fifo n - n 300 1 qmgr tlsmgr unix - - - 1000? 1 tlsmgr rewrite unix - - - - - trivial-rewrite bounce unix - - - - 0 bounce defer unix - - - - 0 bounce trace unix - - - - 0 bounce verify unix - - - - 1 verify flush unix n - - 1000? 0 flush proxymap unix - - n - - proxymap proxywrite unix - - n - 1 proxymap smtp unix - - - - - smtp relay unix - - - - - smtp showq unix n - - - - showq error unix - - - - - error retry unix - - - - - error discard unix - - - - - discard local unix - n n - - local virtual unix - n n - - virtual lmtp unix - - - - - lmtp anvil unix - - - - 1 anvil scache unix - - - - 1 scache dovecot unix - n n - - pipe flags=DRhu user=virtuser:virtuser argv=/usr/bin/spamc -e /usr/lib/dovecot/deliver -d ${recipient} -f {sender}

    Read the article

  • Accounting setup in freeradius with mikrotik and the "always" module

    - by Matt
    I have a freeradius setup that is being used to provide authentication for users on a wireless network. The access points are all Mikrotik hardware and the users are connected 24/7. We've been using Daloradius with mysql and freeradius 2. The boss wants to use the accounting information and while this is all set up and appears to be working, I've found that not all the accounting information is present. Since our users may be connected for more than 24 hours at a time we keep this in here, it will reset some attributes daily so that the accounting packets work correctly. So he started poking around at this link: http://wiki.mikrotik.com/wiki/RouterOs_MySql_Freeradius#Configuring_RouterOs_for_Radius_.26_PPP.2A_AAA And was looking specifically at the following section. Since our users may be connected for more than 24 hours at a time we keep this in here, it will reset some attributes daily so that the accounting packets work correctly always fail { rcode = fail } always reject { rcode = reject } always ok { rcode = ok simulcount = 0 mpp = no } However, that link references freeradius 1 and I can't find this in the radius.conf file for freeradius 2. What does it do and could it be a reason I'm missing data? EDIT: I have found one issue. We have a backup freeradius server that is also receiving the accounting packets. Although they are replicating, it's only a master/slave configuration. If the slave receives accounting packets it won't replicate them back to the master. Although I suspect this might solve it, the boss is not convinced due to the always module. Is there anything special I need to configure in the mikrotik AP's or freeradius 2 for clients connected 24/7.

    Read the article

  • Cisco ASA5505 won't sync with NTP

    - by Martijn Heemels
    Today I noticed that the clock my Cisco ASA 5505 firewall was running about 15 minutes late, which surprised me since I've set up the NTP client. My two NTP servers 10.10.0.1 and 10.10.0.2 are virtualized Windows Server 2008 R2 domain controllers, and both have the correct time. As shown below, the ASA knows about the two servers, can ping them and seems to poll them periodically, so I suppose it can reach them both. The ASA claims its time source is NTP, however the clock is unsynchronized. Neither host is marked as synced. Result of the command: "ping 10.10.0.1" Type escape sequence to abort. Sending 5, 100-byte ICMP Echos to 10.10.0.1, timeout is 2 seconds: !!!!! Success rate is 100 percent (5/5), round-trip min/avg/max = 1/1/1 ms Result of the command: "sh ntp ass" address ref clock st when poll reach delay offset disp ~10.10.0.1 .LOCL. 1 78 1024 377 0.5 643.69 17.0 ~10.10.0.2 10.10.0.1 2 190 1024 377 0.9 655.91 58.4 * master (synced), # master (unsynced), + selected, - candidate, ~ configured Result of the command: "sh ntp stat" Clock is unsynchronized, stratum 16, no reference clock nominal freq is 99.9984 Hz, actual freq is 99.9984 Hz, precision is 2**6 reference time is 00000000.00000000 (07:28:16.000 CEST Thu Feb 7 2036) clock offset is 0.0000 msec, root delay is 0.00 msec root dispersion is 0.00 msec, peer dispersion is 0.00 msec Result of the command: "sh clock detail" 10:33:23.769 CEDT Tue Jun 26 2012 Time source is NTP UTC time is: 08:33:23 UTC Tue Jun 26 2012 Summer time starts 02:00:00 CEST Sun Mar 25 2012 Summer time ends 03:00:00 CEDT Sun Oct 28 2012 I've tried the basic steps of manually setting the time and removing and adding the timeservers, to no avail. My ASA's ntp config is simply: ntp server 10.10.0.1 ntp server 10.10.0.2 Do I need to enable authentication to use a Windows NTP server? Any thoughts?

    Read the article

  • Router failover not detecting outside interface link lost

    - by Matt
    Suppose I have two routers configured in master/slave configuration. They look something like this (addresses are not real ones) 123.123.123.10 <===> [eth0] Router 1 (10.1.1.2) [eth1] ===> +----------+ | 10.1.1.1 | ===> LAN 172.123.123.10 <===> [eth0] Router 2 (10.1.1.3) [eth1] ===> +----------+ The 10.1.1.1 is the default route for the Network (10.1.1.0). What's slightly different in this config to other's I've seen is that I don't have an external virtual IP. Also, the 10.1.1.1 addresses are in real life, public IP's (not private ones shown here). This is more of a router setup than a firewall setup so I'm not using NAT here. Now the issue that I'm having is that I can't see any way to configure UCARP or VRRP to monitor both eth0 & eth1 and fail over to the backup router should either of them go down. What I'm seeing is that if Router1 is the master and I unplug eth0 on router1, it doesn't fail over to router 2. However, it will if instead I unplug eth1 of router 1. In VRRP I see there is a cluster group, but it seems that for this to work you need to have virtual ip's or vrrp instances rather than actual interfaces assigned to it. I hope my explanation is clear. How do I get around this?

    Read the article

  • PostgreSQL failover cluster on Windows Server

    - by user36997
    We are looking for advice on how to setup a basic failover cluster for our application: We will be using 4 machines running Microsoft Windows Server (most probably 2003). All four will always run our application, which is essentially a web service. Load balancing is "outsourced" - somebody else handles the distribution of the web requests among the servers. Only one of the servers will be running the PostgreSQL server actively at any given time. Another server (of the four) also has the DB installed, but is on standby/passive. The DB data is stored on shared storage. No copying data between servers. Reads are done very frequently by many end-users, and in rather small chunks of data. Writes are done much less frequently, by less users, and in very large bulks of data. Now, how can one configure Microsoft Cluster Service to keep only one instance of the DB server and 4 instances (1 per server) of our application at all times? And does PostgreSQL integrate neatly with MSCS at all? Update: Instead of keeping the data on shared storage, I also consider using log shipping to replicate data on a couple of DB servers. There are two issues with this option: Log shipping only makes sure that I have a second server that gets all of the data and is ready to take over. How do I implement the actual failure detection and failover switch? Switching back: Suppose the master fails and the system automatically fails over to the slave, and later the master comes back online. I understand that with WAL shipping this will require to reconfigure the log shipping once again, and that switching back is far from seamless. Is that so?

    Read the article

  • what web based tool, to allow a non-technical user to manage authorized keys files on a Linux (fedora/centos/ubuntu/debian) server

    - by Tom H
    (Edit: clarification below) We have a number of groups of developers that change frequently, and a security policy to require individual logins to servers using rsa or dsa public keys, which is achieved via the standard method of adding id_dsa.pub to their authorized keys file. I am using chef to sync the user accounts across machines, however our previous method of using webmin to manage the user passwords is not designed for key based auth, and hence is not easy to use for non-technical users. The developers are logging in from the WAN using ssh, they can either provide their own key, or an administrator will send them a private key. The development machines are located in the cloud and we have a single server available to host the master set of accounts. Obviously I could deploy ldap or other centralised authentication system, but that seems a bit over blown when webmin worked well for the simple case. It is easy to achieve synchronised users, groups and passwords across a bunch of low security development boxes using webmin clustered users and groups. However looking at the currently installed webmin it is not so easy to create the authorized keys as it is to create user accounts and passwords. (its possible, but its not easy - some functionality is in the usermin module, or would required some tedious steps) Ideally I'd like a web interface that is pretty much dedicated to creating users and groups, and can generate key pairs on the fly, and can accepted pasted in public keys to add to the users authorized keys file. If the tool sync'ed the users and keys as well, that would be great, but I can use chef to do that part if the accounts are created correctly on the "master" server.

    Read the article

< Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >