Search Results

Search found 97216 results on 3889 pages for 'user location'.

Page 78/3889 | < Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >

  • Automatic profile load on boot

    - by AnthonyW
    Is there any way to configure a computer to login automatically at bootup and then IMMEDIATELY switch users? The purpose is to trigger the profile loading process for the assumed user so that when they go to login, their profile loads instantaneously. Yet, the immediate user switch means that the login password is still required before any actual use. A few of the attempts I have made require storing the password in plain-text for the system to use. Needless to say that is undesireable. I have been looking for this solution for years; if anyone knows of a better solution to skinning this cat I am all ears. EDIT: tsdiscon command will Lock the workstation.

    Read the article

  • How can I disable the guest account on OSX Lion?

    - by Wezly
    I have 'disabled' the guest account on my macbook pro running Lion via System Preferences Users & Groups. However the guest account still seems to appear as an option to login at start up and when switching users. I have never used the guest account for anything, and I have tried a system restore but the guest user has returned as before. How can I get rid of it? Thanks. edit: I also just enabled and disabled the account again - but the guest option still appears at startup offering a safari only restart for a guest user.

    Read the article

  • robots.txt file with more restrictive rules for certain user agents

    - by Carson63000
    Hi, I'm a bit vague on the precise syntax of robots.txt, but what I'm trying to achieve is: Tell all user agents not to crawl certain pages Tell certain user agents not to crawl anything (basically, some pages with enormous amounts of data should never be crawled; and some voracious but useless search engines, e.g. Cuil, should never crawl anything) If I do something like this: User-agent: * Disallow: /path/page1.aspx Disallow: /path/page2.aspx Disallow: /path/page3.aspx User-agent: twiceler Disallow: / ..will it flow through as expected, with all user agents matching the first rule and skipping page1, page2 and page3; and twiceler matching the second rule and skipping everything?

    Read the article

  • trying to copy security groups to a user using dsmod group utility in AD

    - by newbie
    i am trying to create a batch file that asks to enter source samid and destination samid. then using dsquery and dsget find out what security groups source samid is assigned to and assign destination samid to those security groups using dsmod. everything works except the dsmod group command. it doesnt do anything and batch file stops. if i literally put "CN=marketing,OU=test group,DC=abc,DC=com" instead of %%g and "CN=test1,OU=test group,DC=abc,DC=com" instead of %dusercn%, it works fine. can anyone help with this? i have pasted my scrip here. this last small thing is killing me. echo off echo %date% at %time% set /p susername=enter source user name: set /P dusername=enter destination user name: echo %susername% echo %dusername% set dusercn= %dusercn%=dsquery user -samid %dusername% echo %dusercn% for /f "tokens=*" %%g in ('dsquery user -samid %susername% ^|dsget user -memberof') do (dsmod group %%g -addmbr %dusercn%) echo completed pause

    Read the article

  • Redirect specific e-mail address sent to a user, to another user.

    - by Michael Pasqualone
    I need to redirect e-mail within our MTA when the two following criteria are both true: When an e-mail is: Sent from: [email protected] Addressesd to: [email protected] Result: redirect e-mail to [email protected]. I don't want to catch *@isp.com and redirect, and I don't want to redirect all e-mail addressed to [email protected] but only redirect when [email protected] sends [email protected] an e-mail. How do I achieve this within Postfix's configuration. And if it's not possible within Postfix, what may be the best solution?

    Read the article

  • Folder access per user

    - by user137670
    I have sbs 2003 r2. I have a shared folder (s-drive) for all shared info for everyone. when user is on shared folder, you see size of folder 230G. I have one user that only sees 1g when on shared folder. I have pcs using XP pro. Have check quota and they say no quota limit checked. I had user use a different pc and still same result. With this I looked at server and users profile and compared with user that did not have problem. could not see anything different. what did I miss in some option or do I have to rebuild user? I have tried google with different terms but have not gotten any good clues

    Read the article

  • SQLAuthority News – Professional Development and Community

    - by pinaldave
    I was recently invited by Hyderabad Techies to deliver a keynote for their 16-day online session called TECH THUNDERS. This event has been running from May 15 and will continue up to the end of the month May 30). There would be a total of 30 sessions. In every evening of those 16 day, there will be either one or two sessions from several noted industry experts. It is the same group which has received the Microsoft Community Impact Award as the Best User Group in India as for developers. I have never talked about Professional Development before. Even if this was my first time to do so, I still accepted the wonderful challenge for the sake of the thousands of audience who were expected to attend this online event. Time is of the essence; I had 15 minutes to deliver the keynote and open the event. The reason why I was nervous was because I had to cover precisely only 15 minutes- no more, no less. If I had an hour, I would have been very confident because I knew I could do a good job for sure. However, I still needed to open the event as great as it can be even if the time was short. I finally created a 6-slide small presentation. In reality, there were only two pages which had the main contents of my keynote, and the remaining slides were just wrappers and decors. You can download the complete slide deck from here. The image used in the slide deck is a curtsy of blog reader Roger Smith who sent it to me. The slide in which I spent a good amount of time is the slide which talks about Professional Development. The content of the slide is as follows: Today, Technology and You Keep your eyes, ears and senses open – Stay Active! You are not the first one who faced the problem – Search Online! Learn the web – Blogs, Forums and Friends! Trust the Technology, Not Print – Test Everything! Community and You! I had a very little time creating the slide deck as I was busy the whole day doing the Advanced SQL Server Training. I had put together these slides during the tea/coffee break of my session. Though it was just a six-bullet point, I had received quite a few emails right after keynote requesting me to talk more about this subject and share the details of my slide deck. I have talked with the event organizer and he will put the keynote online very soon. The subject of the talk is very simple; it revolves around the community. Time has changed, and Internet has come a long way from where it was many years ago. Now that we are all connected, help via the Internet and useful software is easily available around us. In fact, RSS, Newletters and few other technologies have progressed so much that the help through news is now being delivered to our door steps, instead of going out and seeking them. Sometimes, a simple search online solves a lot of problems of many developers. The community is now the first stop for any developer when he or she needs help or just wants to hang around and share some thoughts. I strongly suggest everybody to be a part of the Tech Community. Be it online, offline community or just a local user group, I strongly advise all of you to get involved. I am active in the Community, and I must say I recommend getting drawn into it. Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: MVP, Pinal Dave, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQL User Group, SQLAuthority News, T SQL, Technology Tagged: Community

    Read the article

  • Customizing UPK outputs (Part 1)

    - by [email protected]
    If you are familiar with Oracle's User Productivity Kit, you are aware that UPK is a great product for rapidly developing application training. Did you know that you can also customize the UPK outputs to incorporate your company's logo, colors, and preferred styles? There are several areas that support customization: Logo - Within the developer, you can change the logo for all outputs at one time. Player - The player output uses a style sheet that can be updated to change colors, graphics and other visual branding. Documentation - The print documentation uses a Word-based template that can be modified to match your corporate standards. I'll discuss the first one today, and we'll cover the others in subsequent blogs. Before you begin: If you are working in a multi-user environment, ensure that you have "Modify" permissions for the Styles directory under the Publishing folder. Make a copy of the current styles. This recommendation is for backup purposes. If something goes wrong, you will have a way to recover. Consider creating your own category by creating a new folder under the Styles directory, and then copying the styles into your new folder. When you upgrade to future versions, the system will overwrite the standard styles with any new feature additions and updates that have been made. With your own category, all of your customizations will remain intact. To update the logos in all outputs: From the Tools Menu, choose Customize Logo. Select the category if necessary. Browse to select your logo. You can use any size logo, in any graphic format (*.bmp, *.gif, *.jpeg, *.jpg, *.png, or *.tif). The system will make a copy of your logo and add it to each of the publishing styles. Choose OK, and the update process begins. It may take a few minutes. Helpful hints: The logo you select is used "as is" - no resizing or cropping occurs during this process. The Customize Logo process automates replacing all the logo graphics for online deployment (small_logo.gif and large_logo.gif) and the headers in the documentation outputs. You can manually replace these graphics on an individual style basis if you prefer. The recommended logo size is 230 pixels wide x 44 pixels high. Prior to updating the logos, the system will display the size of the selected logo. If you use a logo that is much larger than the recommended size, the heading area will resize to fit the new logo, but that will impact the space available for your training material. If you are using a multi-user environment, the system will check out the publishing styles to you for the logo updates. After you review the styles, remember to check them in so the rest of your team can access the new changes. I'd be interested in hearing (or seeing) how you brand your UPK. Feel free to share in the comments! --Maria Cozzolino, Manager of Requirements & UI for UPK Product Development PS. For those of you who want to customize the player and documentation NOW, check out the detailed instructions in the Publishing Content chapter of the Content Development Guide.

    Read the article

  • Kent .Net/SqlServer User Group – Upcoming events

    - by Dave Ballantyne
    At the Kent user group we have two upcoming events.  Both are to be held at F-Keys Training suite http://f-keys.co.uk/ in Rochester, Kent. If you haven’t attended before please note the location here. 14-June Is your code S.O.L.I.D ? Nathan Gloyn Everybody keeps on about SOLID principles but what are they? and why should you care? This session is an introduction to SOLID and I'll aim to walk through each principle telling you about that principle and then show how a code base can be refactored using the principles to make your life easier, Come the end of the session you should have a basic understanding of the principle, why to use it and how using it can improve your code. Building composite applications with OpenRasta 3 Sebastien Lambla A wave of change is coming to Web development on .NET. Packaging technologies are bringing dependency management to .NET for the first time, streamlining development workflow and creating new possibilities for deployment and administration. The sky's the limit, and in this session we'll explore how open frameworks can help us leverage composition for the web. Register here for this event http://www.eventbrite.com/event/1643797643 05-July Tony Rogerson Achieving a throughput of 1.5Terabytes or over 92,000 8Kbyte of 100% random reads per second on kit costing less that 2.5K, and of course what to do with it! The session will focus on commodity kit and how it can be used within business to provide massive performance benefits at little cost. End to End Report Creation and Management using SQL Server Reporting Services  Chris Testa-O'NeillThis session will walk through the authoring, management and delivery of reports with a focus on the new features of Reporting Services 2008 R2. At the end of this session you will understand how to create a report in the new report designer. Be aware of the Report management options available and the delivery mechanisms that can be used to deliver reports. Register here for this event http://www.eventbrite.com/event/1643805667 Hope to see you at one or other ( or even both if you are that way inclined).

    Read the article

  • Top 5 Reasons to Invest in Enterprise 2.0 Technologies

    - by kellsey.ruppel(at)oracle.com
    In 2010, Oracle's portal, content management, and collaboration solutions evolved rapidly, supported by increasingly deep integrations across Oracle Fusion Middleware and the entire Oracle stack. In light of these developments, we asked Vince Casarez, vice president of Enterprise 2.0 product management, for his top five reasons to invest in Enterprise 2.0 (E2.0) technologies--including real-world examples of businesses already realizing the benefits of next-generation E2.0 technologies. 1. Provide a modern user experience As E2.0 technologies gain widespread adoption, customers and employees expect intuitive Web experiences that are both interactive and community-based. By partnering with Oracle, Alcatel-Lucent Enterprise Group is already making that happen. With 76,000 employees and operations in more than 100 countries, the company wanted a streamlined, personalized user experience with more relevant content in fewer clicks. Working with Oracle, they created a global support portal that supports personalization and integration with Oracle Business Intelligence Enterprise Edition and Oracle E-Business Suite--and drives collaboration with tools such as wikis, blogs, and forums. Learn more about Alcatel-Lucent Enterprise Group's Global Support Portal in this Webcast. 2. Improve productivity and collaboration As E2.0 technologies mature, Oracle anticipates companies moving beyond the idea of simply creating yet another Facebook-like destination for its employees, and instead shaping work environments around specific business tasks. After rapid growth--both organic and through acquisition--construction and infrastructure services leader Balfour Beatty found itself with multiple homegrown intranet sites with very minimal content-sharing capabilities. Today, thanks to Oracle WebCenter Suite, Oracle WebCenter Spaces, Oracle WebCenter Services, and Oracle Universal Content Management, Balfour Beatty is benefiting from collaborative workspaces, a central place to use and work with documents, and unified search across content. 3. Leverage business processes and applications Modern portals are now able to integrate users, content, and business processes in unprecedented ways. To take advantage of these new possibilities, leading dairy provider Land O'Lakes has implemented a fully integrated ERP solution together with Oracle's ECM platform. As a result, Land O'Lakes has been able to achieve better information management and compliance, increased adoption rates for enterprise tools, and increased business process efficiency thanks to more effective information sharing and collaboration. 4. Enhance customer and supplier relationships Companies have begun to move beyond the idea that E2.0 simply means enabling customer reviews or embedding chat functionality. They are taking E2.0 to the next level and providing interactive experiences for their customers. For example, to enhance customer and supplier relationships, Wind River, a global leader in device software optimization, successfully partnered with Oracle to: Integrate ERP and ECM content to provide customers the latest and most relevant support information for products they own Enable customers to personalize their support experience and receive updates regarding patches, application notes, and other relevant content Enable discussions, wikis, and blogs for more efficient collaboration 5. Increase business visibility and responsiveness By strategically embedding collaboration and communication tools into specific business contexts, companies significantly increase visibility into changing business conditions--and can respond much more agilely. Texas A&M University System--one of the largest systems of higher education in the U.S.--partnered with Oracle to create a unified repository that would enable the retrieval of research and grant data from disparate systems via an Enterprise 2.0 user interface. By enabling researchers to customize their own portals with easy-to-use tools, they have also been able to significantly reduce their reliance on the IT department. Learn how other Oracle customers are leveraging Enterprise 2.0 technologies.

    Read the article

  • Authenticate with Django 1.5

    - by gorjuce
    I'm currently testing django 1.5 and a custom User model, but I've some problems. I've created a User class in my account app, which looks like: class User(AbstractBaseUser): email = models.EmailField() activation_key = models.CharField(max_length=255) is_active = models.BooleanField(default=False) is_admin = models.BooleanField(default=False) USERNAME_FIELD = 'email' I can correctly register a user, who is stored in my account_user table. Now, how can I log in? I've tried with: def login(request): form = AuthenticationForm() if request.method == 'POST': form = AuthenticationForm(request.POST) email = request.POST['username'] password = request.POST['password'] user = authenticate(username=email, password=password) if user is not None: if user.is_active: login(user) else: message = 'disabled account, check validation email' return render( request, 'account-login-failed.html', {'message': message} ) return render(request, 'account-login.html', {'form': form}) I can correctly register a new User My forms.py which contains my register form class RegisterForm(forms.ModelForm): """ a form to create user""" password = forms.CharField( label="Password", widget=forms.PasswordInput() ) password_confirm = forms.CharField( label="Password Repeat", widget=forms.PasswordInput() ) class Meta: model = User exclude = ('last_login', 'activation_key') def clean_password_confirm(self): password = self.cleaned_data.get("password") password_confirm = self.cleaned_data.get("password_confirm") if password and password_confirm and password != password_confirm: raise forms.ValidationError("Password don't math") return password_confirm def clean_email(self): if User.objects.filter(email__iexact=self.cleaned_data.get("email")): raise forms.ValidationError("email already exists") return self.cleaned_data['email'] def save(self): user = super(RegisterForm, self).save(commit=False) user.password = self.cleaned_data['password'] user.activation_key = generate_sha1(user.email) user.save() return user My question is: Why does authenticate give me None? I know I'm trying to authenticate() with an email as username but is that not one of the reasons to use a custom User model?

    Read the article

  • Looking to create website that can have custom GUI and database per user

    - by riley3131
    I have developed an MS Access database for a company to track data in regards to production of a certain commodity. It has many many tables, forms, reports, etc. These were all done as the user requested, and resemble the users previously used system, mostly printed worksheets and excel workbooks. This has created a central location for all information and has allowed the company to compare data in a new way. I am now looking to do this for other companies, but would like to switch it to a web application. Here is my question. What is the best way to create unique solutions for individual companies that can have around 100 users each? I would love to create one site that would serve all parties, but that would ruin the customizable nature of what I am developing. I love the ability to create reports, excel sheets, pdf, graphs, etc with access, but am tired of relying on my customers software, servers, etc. I have some experience with WAMP, but I am far better at VBA. I was okay at PHP, and was getting a grasp on JavaScript a few years back. I am also trying to decide whether to go with WAMP or LAMP, if web is the best choice. Also, should I try set up one site for all users that after log-in goes to company specific pages, or individual sites for each company? Should I host or use a service?

    Read the article

  • Travelling MVP #1: Visit to SharePoint User Group Finland

    - by DigiMortal
    My first self organized trip this autumn was visit to SharePoint User Group Finland community evening. As active community leaders who make things like these possible they are worth mentioning and on spug.fi side there was Jussi Roine the one who invited me. Here is my short review about my trip to Helsinki. User group meeting As Helsinki is near Tallinn I went there using ship. It was easy to get from sea port to venue and I had also some minutes of time to visit academic book store. Community evening was held on the ground floor of one city center hotel and room was conveniently located near hotel bar and restaurant. Here is the meeting schedule: Welcome (Jussi Roine) OpenText application archiving and governance for SharePoint (Bernd Hennicke, OpenText) Using advanced C# features in SharePoint development (Alexey Sadomov, NED Consulting) Optimizing public-facing internet sites for SharePoint (Gunnar Peipman) After meeting, of course, local dudes doesn’t walk away but continue with some beers and discussion. Sessions After welcome words by Jussi there was session by Bernd Hennicke who spoke about OpenText. His session covered OpenText history and current moment. After this introduction he spoke about OpenText products for SharePoint and gave the audience good overview about where their SharePoint extensions fit in big picture. I usually don’t like those vendors sessions but this one was good. I mean vendor dudes were not aggressively selling something. They were way different – kind people who introduced their stuff and later answered questions. They acted like good guests. Second speaker was Alexey Sadomov who is working on SharePoint development projects. He introduced some ways how to get over some limitations of SharePoint. I don’t go here deeply with his session but it’s worth to mention that this session was strong one. It is not rear case when developers have to make nasty hacks to SharePoint. I mean really nasty hacks. Often these hacks are long blocks of code that uses terrible techniques to achieve the result. Alexey introduced some very much civilized ways about how to apply hacks. Alex Sadomov, SharePoint MVP, speaking about SharePoint coding tips and tricks on C# I spoke about how I optimized caching of Estonian Microsoft community portal that runs on SharePoint Server and that uses publishing infrastructure. I made no actual demos on SharePoint because I wanted to focus on optimizing process and share some experiences about how to get caches optimized and how to measure caches. Networking After official part there was time to talk and discuss with people. Finns are cool – they have beers and they are glad. It was not big community event but people were like one good family. Developers there work often for big companies and it was very interesting to me to hear about their experiences with SharePoint. One thing was a little bit surprising for me – SharePoint guys in Finland are talking actively also about Office 365 and online SharePoint. It doesn’t happen often here in Estonia. I had to leave a little bit 21:00 to get to my ship back to Tallinn. I am sure spug.fi dudes continued nice evening and they had at least same good time as I did. Do I want to go back to Finland and meet these guys again? Yes, sure, let’s do it again! :)

    Read the article

  • Home ADSL Modem Dropping Packets?

    - by Cody
    I know this is supposed to be a "pro" forum, but I'm hoping someone can help since my ISP isn't doing much to try and fix things. My ISP has given me a DSL modem / Router combo - a ADB / Pirelli P.DG A2100N and I have a 4096 / 767 kbps connection. I use it purely as modem and router, and have the wireless AP feature turned off. I run it to a Ubiquiti Networks Toughswitch and use a Ubiquiti UAP as the wireless access point - although I've ran tests directly wired to the router with nothing else connected, and still see the same issues. I've been having issues where latency suddenly spikes from 8ms to google.com to 250+ if someone does anything on the internet. If I run a speedtest or something, I can see latencies above 3000ms. Regularly when downloading something, even if the speed is throttled to , it can get random drops to 0kbps every few seconds. Online gaming is impossible because I notice the sudden lag-outs in the connection, and video streams or VoIP drop out as well - it's not at all consistent. I managed to find the password to my modem and I don't think I see anything wrong with the settings - but I looked for the logs and found this: Jun 6 17:10:30 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:30 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:31 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: __ratelimit: 63 callbacks suppressed Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:10:40 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:22 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:23 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:24 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:24 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:24 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:24 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:24 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:25 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:25 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:25 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:29 user warn kernel: __ratelimit: 15 callbacks suppressed Jun 6 17:11:29 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:29 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:30 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:11:30 user warn kernel: nf_conntrack: table full, dropping packet. Jun 6 17:55:26 user warn kernel: bcmxtmcfg: OAM loopback response not received on VCC 1.1.3 Jun 6 17:55:27 user warn kernel: bcmxtmcfg: OAM loopback response not received on VCC 1.1.4 So, as I understand it, it appears the router is dropping packets? If that's the case, is there anything in the config that I can change? Or should I buy a new router, a new modem, or both?

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Database users in the Oracle Utilities Application Framework

    - by Anthony Shorten
    I mentioned the product database users fleetingly in the last blog post and they deserve a better mention. This applies to all versions of the Oracle Utilities Application Framework. The Oracle Utilities Application Framework uses up to three users initially as part of the base operations of the product. The type of database supported (the framework supports Oracle, IBM DB2 and Microsoft SQL Server) dictates the number of users used and their permissions. For publishing brevity I will outline what is available for the Oracle database and, in summary, mention where it differs for the other database supported. For Oracle database customers we ship three distinct database users: Administration User (SPLADM or CISADM by default) - This is the database user that actually owns the schema. This user is not used by the product to do any DML (Data Manipulation Language) SQL other than that is necessary for maintenance of the database. This database user performs all the DCL (Data Control Language) and DDL (Data Definition Language) against the database. It is typically reserved for Database Administration use only. Product Read Write User (SPLUSER or CISUSER by default) - This is the database user used by the product itself to execute DML (Data Manipulation Language) statements against the schema owned by the Administration user. This user has the appropriate read and write permission to objects within the schema owned by the Administration user. For databases such as DB2 and SQL Server we may not create this user but use other DCL (Data Control Language) statements and facilities to simulate this user. Product Read User (SPLREAD or CISREAD by default) - This is the database that has read only permission to the schema owned by the Administration user. It is used for reporting or any part of the product or interface that requires read permissions to the database (for example, products that have ConfigLab and Archiving use this user for remote access). For databases such as DB2 and SQL Server we may not create this user but use other DCL (Data Control Language) statements and facilities to simulate this user. You may notice the words by default in the list above. The values supplied with the installer are the default and can be changed to what the site standard or implementation wants to use (as long as they conform to the standards supported by the underlying database). You can even create multiples of each within the same database and pointing to same schema. To manage the permissions for the users, there is a utility provided with the installation (oragensec (Oracle), db2gensec (DB2) or msqlgensec (SQL Server)) that generates the security definitions for the above users. That can be executed a number of times for each schema to give users appropriate permissions. For example, it is possible to define more than one read/write User to access the database. This is a common technique used by implementations to have a different user per access mode (to separate online and batch). In fact you can also allocate additional security (such as resource profiles in Oracle) to limit the impact of specific users at the database. To facilitate users and permissions, in Oracle for example, we create a CISREAD role (read only role) and a CISUSER role (read write role) that can be allocated to the appropriate database user. When the security permissions utility, oragensec in this case, is executed it uses the role to determine the permissions. To give you a case study, my underpowered laptop has multiple installations on it of multiple products but I have one database. I create a different schema for each product and each version (with my own naming convention to help me manage the databases). I create individual users on each schema and run oragensec to maintain the permissions for each appropriately. It works fine as long I have setup the userids appropriately. This means: Creating the users with the appropriate roles. I use the common CISUSER and CISREAD role across versions and across Oracle Utilities Application Framework products. Just remember to associate the CISUSER role with the database user you want to use for read/write operations and the CISREAD role with the user you wish to use for the read only operations. The role is treated as a tag to indicate the oragensec utility which appropriate permissions to assign to the user. The utilities for the other database types essentially do the same, obviously using the technology available within those databases. Run oragensec against the read write user and read only user against the appropriate administration user (I will abbreviate the user to ADM user). This ensures the right permissions are allocated to the right users for the right products. To help me there, I use the same prefix on the user name for the same product. For example, my Oracle Utilities Application Framework V4 environment has the administration user set to FW4ADM and the associated FW4USER and FW4READ as the users for the product to use. For my MWM environment I used MWMADM for the administration user and MWMUSER and MWMREAD for my associated users. You get the picture. When I run oragensec (once for each ADM user), I know what other users to associate with it. Remember to rerun oragensec against the users if I run upgrades, service packs or database based single fixes. This assures that the users are in synchronization with the ADM user. As a side note, for those who do not understand the difference between DML, DCL and DDL: DDL (Data Definition Language) - These are SQL statements that define the database schema and the structures within. SQL Statements such as CREATE and DROP are examples of DDL SQL statements. DCL (Data Control Language) - These are the SQL statements that define the database level permissions to DDL maintained objects within the database. SQL Statements such as GRANT and REVOKE are examples of DCL SQL statements. DML (Database Manipulation Language) - These are SQL statements that alter the data within the tables. SQL Statements such as SELECT, INSERT, UPDATE and DELETE are examples of DML SQL statements. Hope this has clarified the database user support. Remember in Oracle Utilities Application Framework V4 we enhanced this by also supporting CLIENT_IDENTIFIER to allow the database to still use the administration user for the main processing but make the database session more traceable.

    Read the article

  • Aggregate SharePoint Event/Items with Exchange appointments into your Calendar view using Calendar O

    - by eJugnoo
    In continuation of my previous post about using Calendar Overlay with new SharePoint 2010 when you have other Calendar view in any other lists in SharePoint. Now the other option for Overlay we have is with Exchange. You can overlay current users (logged in user) personal Calendar (from Exchange) onto a existing SharePoint calendar, in any list, by using new Overlay feature. Here is an example: Yes, you have to point to your OWA and Exchange WS url. It can also go and find your web service url, when you click find. In my case, it converted machine name into FQDN. That was smart… I had initial configuration issue, that my test users (Administrator!) didn’t have corresponding Exchange e-mail in SharePoint profile. So you have to ensure that your profiles are in sync with AD/Exchange for e-mail. It picks up current user’s e-mail from profile to pull data from Exchange calendar. My calendar in OWA… Same calendar in Outlook 2010… I think, new Calendar Overlay feature fills a great void. Users can now view SharePoint information within context of their personal calendar. Which is simply great! Enjoy new SharePoint 2010. --Sharad

    Read the article

  • /planes and /clubs or /wiki/planes and /wiki/clubs

    - by Jelmer
    I am currently working on a nice application about which I can't share all the details, but it will have some sort of a wiki part. In this wiki, you will be able to change the planes as well as the clubs, maybe in the future it will be possible to change the countries and manufacturers as well. But I have to think about this and I have to check how good this is. But, you will understand that it has to be expendable! That is really important. Use the planes controller with a edit page and the same for the clubs Route the planes and clubs controller to the wiki controller, so we have 1 nice "path" to edit this stuff. I want to have it called wiki that is for sure. Because that is what it is, but I am storing the planes and clubs data in its down table in my database. I think that is kinda obvious since it has to be maintainable. Right now you could edit a plane via the url: example.com/wiki/planes/edit/Duo_Discus.html Do you think that is better than example.com/planes/edit/Duo_Discus.html since it is easy to understand for the user, that he is working in the wiki instead of in the planes ? Or do you think this will break the user experience?

    Read the article

  • Fujitsu Raku-Raku SmartPhone: Japanese Digital Seniors UX Insight from @debralilley

    - by ultan o'broin
    Super blog posting on the super-important subject of digital inclusion by Oracle partner Fujitsu appstech maven and Oracle Applications User Experience FXA-er and ACE Director Debra Lilley (@debralilley). Debra tells us how Fujitsu is enabling digital inclusion for older mobile users in Japan with their  Raku-Raku (??????. ????)smart phone: Fujitsu Raku-Raku - My UX Homework (Raku-Raku means easy or comfortable in Japanese). There are UX mobile, social media, and methodology takeaways there for us in Debra's blog. Fujitsu Raku-Raku Smartphone Demo  I encourage you to read Debra's blog. In it, she makes reference to a tailored social media experience for those digital seniors (???????) as they'd be called in Japan (UK and Ireland uses the term silver surfers). You can find that online experience here. Online Community site for Fujitsu Raku-Raku Smartphone Digital Seniors (English translation via Google Translate) It's an important reminder that UX is global sure, but also that worldwide accessibility and digital inclusion are priorities too for UX. It's vital that we understand such aspects of technology adoption and how the requirements of different categories of technology users can be met. Oracle is committed to providing the best possible user experience for enterprise users of all ages and abilities. That means talking with all sorts of people worldwide and understanding how and why they want to use our technology and what their context of use is. You can read more about Oracle's accessibility program on our corporate website. Proud to say I prompted a few questions in Japan all the way from Ireland. So, UX is not only global but you can drive UX research globally too without ever leaving home. Brilliant job, Debra. Here's to more such joint research creativity and UX collaborations worldwide between us. Wondering where we might go next? And what a fun way to do things too!

    Read the article

  • ERP/CRM Systems. Desktop Based ? Web based?

    - by Parhs
    Hello guys... I have seen 2-3 ERPs in action. I am wondering what is better. Desktop based application or webbased displayed on a browser. My first expirience was with a web based ERP when i was 14 years old.. It was web based and terribly slow... For most simple task you had to do lots of clicks... no keyboard support ..... Pages took ages to load. Last year i worked for migrating to a newer computer some old terminal based cobol application. The computer that worked till today and still has no problem was from 1993. The user interface ofcourse was textbased.. The speed that guys placed orders was amazing! just typing the name of the customer , then 5-10 keys to add a product to order.... Comparing to this ERP the page for placing orders Link (click sales orders) seems terribly slow to add a product... No keyboard shortcut works to save what you added and generally i believe you need 4 times more time to place an order compared to the text interface... Having to use both mouse and keyboard for this task is BAD and sadistic... So how can tek heck these people ever use a system like that ??? So in the long run desktop application seems the only way... Ofcourse browsers support shortcuts but the way to overide the defaults that browsers uses isnt cross compatible... That is a hudge problem. Finnaly, if we MUST/forced use cloud in near future what about keyboard shortcuts?? I feel confused... I have seen converters of desktop applications to browser applications but are SLOW as hell... The question is what about user friendliness?What kind of application would you use?

    Read the article

  • Correct architecture for running and stopping complex tasks in the background

    - by Phonon
    I'm having trouble working out the correct architecture for the following task. I have a GUI in Windows Forms that contains a ListBox, listing certain architectural layouts. One an item in this list is selected, a custom Control displays an interactive visualization of the selected layout. Drawing of this interactive diagram is a CPU-intensive task, and can take up to a second on my machine. The kind of functionality I'm trying to achieve is that if a user wants to quickly scroll through the layouts in the ListBox (say, holding down the down arrow key), I don't want my computer to sit there thinking about how to draw the layout before it allows the user to do anything else. The obvious answer is, of course, to run the layout calculations in a separate thread. But how do I make that thread return a whole control? How do I make sure I'm not running two layout calculations at once? I'm fairly new to this complex GUI business. So the real question is what is the right architecture to implement something like this? This seems like something people do all the time, but finding any suggestions on how to do it properly is really difficult.

    Read the article

< Previous Page | 74 75 76 77 78 79 80 81 82 83 84 85  | Next Page >