Search Results

Search found 2789 results on 112 pages for 'blocks'.

Page 79/112 | < Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >

  • Blocking requests from specific IPs using IIS Rewrite module

    - by Thomas Levesque
    I'm trying to block a range of IP that is sending tons of spam to my blog. I can't use the solution described here because it's a shared hosting and I can't change anything to the server configuration. I only have access to a few options in Remote IIS. I see that the URL Rewrite module has an option to block requests, so I tried to use it. My rule is as follows in web.config: <rule name="BlockSpam" enabled="true" stopProcessing="true"> <match url=".*" /> <conditions logicalGrouping="MatchAll" trackAllCaptures="false"> <add input="{REMOTE_ADDR}" pattern="10\.0\.146\.23[0-9]" ignoreCase="false" /> </conditions> <action type="CustomResponse" statusCode="403" /> </rule> Unfortunately, if I put it at the end of the rewrite rules, it doesn't seem to block anything... and if I put it at the start of the list, it blocks everything! It looks like the condition isn't taken into account. In the UI, the stopProcessing option is not visible and is true by default. Changing it to false in web.config doesn't seem to have any effect. I'm not sure what to do now... any ideas?

    Read the article

  • SSL on local sub-domain and sub-sub-domain

    - by Eduard Luca
    I have both local.domain.com and lmarket.local.domain.com pointing to my localhost from etc/hosts. The problem is that I am using XAMPP on Windows 7, and have 2 SSL VirtualHosts in my apache config, but no matter which one I access, I am taken to local.domain.com. On non-HTTPS requests all works fine, and the vhosts are basically the same. Here is the relevant part of my vhosts: <VirtualHost local.domain.com:443> DocumentRoot "C:/xampp/htdocs/local" ServerName local.domain.com ServerAdmin webmaster@localhost ErrorLog "logs/error.log" <IfModule log_config_module> CustomLog "logs/access.log" combined </IfModule> SSLEngine on SSLCipherSuite ALL:!ADH:!EXPORT56:RC4+RSA:+HIGH:+MEDIUM:+LOW:+SSLv2:+EXP:+eNULL SSLCertificateFile "conf/ssl.crt/server.crt" SSLCertificateKeyFile "conf/ssl.key/server.key" <FilesMatch "\.(cgi|shtml|pl|asp|php)$"> SSLOptions +StdEnvVars </FilesMatch> <Directory "C:/xampp/cgi-bin"> SSLOptions +StdEnvVars </Directory> BrowserMatch ".*MSIE.*" nokeepalive ssl-unclean-shutdown downgrade-1.0 force-response-1.0 CustomLog "logs/ssl_request.log" "%t %h %{SSL_PROTOCOL}x %{SSL_CIPHER}x \"%r\" %b" </VirtualHost> <VirtualHost lmarket.local.domain.com:443> DocumentRoot "C:/xampp/htdocs/lmarket.local" ServerName lmarket.local.domain.com ServerAdmin webmaster@localhost ErrorLog "logs/error.log" <IfModule log_config_module> CustomLog "logs/access.log" combined </IfModule> SSLEngine on SSLCipherSuite ALL:!ADH:!EXPORT56:RC4+RSA:+HIGH:+MEDIUM:+LOW:+SSLv2:+EXP:+eNULL SSLCertificateFile "conf/ssl.crt/server.crt" SSLCertificateKeyFile "conf/ssl.key/server.key" <FilesMatch "\.(cgi|shtml|pl|asp|php)$"> SSLOptions +StdEnvVars </FilesMatch> <Directory "C:/xampp/cgi-bin"> SSLOptions +StdEnvVars </Directory> BrowserMatch ".*MSIE.*" nokeepalive ssl-unclean-shutdown downgrade-1.0 force-response-1.0 CustomLog "logs/ssl_request.log" "%t %h %{SSL_PROTOCOL}x %{SSL_CIPHER}x \"%r\" %b" </VirtualHost> If I invert these blocks, then the opposite happens: local.domain.com goes to lmarket.local.domain.com. Any help would be appreciated.

    Read the article

  • Distributed development staff needing a common IP range

    - by bakasan
    I work on a development staff that is geographically distributed, mostly all throughout the state of CA, but several key members also must travel frequently. We rely quite heavily on a 3rd party provider API for a great deal of our subsystems (can't get into who it is or what they do). The 3rd party however is quite stringent on network access and have no notion of a development sandbox. Access is restricted to 2, 3 IP numbers and that's about it. Once we account for our production servers, that leaves us with an IP or two to spare for our dev team--which is still problematic as people's home IP changes, people travel, we have more than 2 devs, etc. Wide IP blocks are not permitted by the 3rd party. Nor will they allow dynamic DNS type services. There is no simple console to swap IPs on the fly either (e.g. if a dev's IP at home changes or they are on the road). As none of us are deep network experts, I'm wondering what our viable options are? Are there such things as 3rd party hosts to VPNs? Generally I think of a VPN as a mechanism to gain access to a home office, but the notion would be a 3rd party VPN that we'd all connect to and we'd register this as an IP origin w/ our 3rd party. We've considered using Amazon EC2 to effectively host a dev environment for each dev and using that to connect. Amazon only gives you so many static IPs however (I believe 5?) so this would only be a stop gap solution until our team size out strips our IP count at Amazon. Those were the only viable thoughts that I had, but again, I'm far from a networking guy. Tried searching for similar threads, but I'm not even sure I know the right vernacular to look around for.

    Read the article

  • Rsync Push files from linux to windoes. ssh issue - connection refused

    - by piyush c
    For some reason I want to run a script to move files from Linux machine to Windows. I have installed cwRsync on my windows machine and able to connect to linux machine. When i execute following command: rsync -e "ssh -l "piyush"" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" Where 10.0.0.60 is my widows machine and I am running above command on Linux - CentOS 5.5. After running command I get following error message: ssh: connect to host 10.0.0.60 port 22: Connection refused rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: error in rsync protocol data stream (code 12) at io.c(463) [sender=2.6.8] [root@localhost sync]# ssh [email protected] ssh: connect to host 10.0.0.60 port 22: Connection refused I have modified my firewall settings on widows to allow all ports. I think this issue is due to SSH Daemon not present on my windows machine. So I tried installing OpenSSH on my machine and running ssh-agent but didn't helped. I tried similar command to run on my widows machine to pull files from Linux and its working fine. For some reason I want command for Linux machine so that I can embed it in a shell script. Can you suggest me if I am missing anything. I am already having cwRsync installed on my widows and running it in daemon mode using --damemon option. And I am able to login using ssh from windows machine to linux machine. When I issue bellow command, it just blocks for 120 seconds (timeout I specified in command) and exits saying there is timeout. rsync -e "ssh -l piyush" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" After starting rsync on widows, I checked, rsyc is running. And widows firewall setting are set to minimal, and on Linux machine stopped iptables service so that port 873 (default rsync port) is not blocked. What can be the possible reason that Linux machine is not able to connect to rsync-daemon on windows machine?

    Read the article

  • Tomato OS: "memory exhausted" running vi .... how to solve?

    - by Sam Jones
    I have set up tomato (shibby) on an asus RT-N66U router. It works great. I loaded up a few pieces, like transmission and optware. I can run vi, but when I run vi it fails with a "memory exhausted" error, and the terminal session hangs. For reference: If I simply start "vi" it runs fine. But if I specify vi I get the memory exhausted error, even if the file I am opening is just a couple of hundred bytes in size (like fstab). I discovered that my swap partition was not properly set up, so I did that. The swapon command now indicates I really do have a swap: [root@MyRouter samba]$ swapon -s Filename Type Size Used Priority /dev/sda1 partition 32900860 0 1 How can I get vi to work? Thanks! System setup reference information: asus RT-N66U router 2TB usb hard drive partitions on hard drive: Disk /dev/sda: 2000.4 GB, 2000398839808 bytes 255 heads, 63 sectors/track, 30400 cylinders Units = cylinders of 16065 * 4096 = 65802240 bytes Disk identifier: 0xfacbc8ab Device Boot Start End Blocks Id System /dev/sda1 1 512 32900868 82 Linux swap / Solaris /dev/sda2 513 29000 1830638880 83 Linux running samba memory: $ cat /proc/meminfo MemTotal: 255840 kB MemFree: 210980 kB Buffers: 5264 kB Cached: 22768 kB SwapCached: 0 kB Active: 20272 kB Inactive: 11448 kB HighTotal: 131072 kB HighFree: 99868 kB LowTotal: 124768 kB LowFree: 111112 kB SwapTotal: 32900860 kB SwapFree: 32900860 kB Dirty: 0 kB Writeback: 0 kB TIA!

    Read the article

  • Resolving "JBoss Web Console is Accessible to Unauthenticated Remote Users" vulnerability

    - by IAmJeff
    Our security team has determined there is a vulnerability in one of our systems. We are using version JBoss 5.1.0GA on RHEL 5.10. Vulnerability description: JBoss Web Console is Accessible to Unauthenticated Remote Users Yes, this looks familiar. Refer to Question 501417. I do not find the answer there complete. Can someone (or multiple someones) answer Does a newer version of JBoss fix this vulnerability? Are there links describing, in more detail, manual modification of JBoss configuration files to resolve the issue? Are there others options to remediate this vulnerability? Why don't I find the other answer complete? I'm not at all familiar with JBoss, so this answer seems a bit too simple. The web-console.war contains commented-out templates for basic security in its WEB-INF/web.xml as well as commented-out setup for a security domain in WEB-INF/jboss-web.xml. Just uncomment those basic security blocks and restart? Is there anything else I need to include? This seems generic. Do I need to include anything about my environment, such as absolute paths, etc.? Am I making this too complicated?

    Read the article

  • Adding Static IP's to the NIC

    - by Brett Powell
    We are currently working on migrating a lot of new machines to our network, and my job this morning was to setup all of the IP Addresses. I worked on this all morning, and when I got back tonight I was informed that they had all been setup incorrectly, and had to be removed and re-added. I am quite confused as I have been setting up IP's on machines for a long time and I am curious as to what the issue is. Just taking into account this example... 72.26.196.160/29 255.255.255.248 A /29 block is 5 usable IP's. With the script I wrote and used, the IP Addresses .162 - .166 were added to the NIC. I can't remember now what the name for .161 was, but isn't it the broadcast address or something which isn't assigned to the NIC when adding additional IP Blocks? I am curious as to where my logic is failing me. Not to mention even if .161 was to be added, there is no reason why all of the IPs would have to be removed, as .161 could just be added in addition to these.

    Read the article

  • Ubuntu raid 1 write errors

    - by Micah
    I have an Ubuntu server set up with two SATA drives in a RAID 1 configuration with MDADM. The machine is used to record raw video, which involves a lot of writing to the disk. Sometimes during video recording the computer will crash, will the following errors in kern.log: Mar 15 10:39:41 video kernel: [414501.629864] ata2.00: exception Emask 0x10 SAct 0x0 SErr 0x400100 action 0x6 Mar 15 10:39:41 video kernel: [414501.629870] ata2.00: BMDMA stat 0x26 Mar 15 10:39:41 video kernel: [414501.629875] ata2.00: SError: { UnrecovData Handshk } Mar 15 10:39:41 video kernel: [414501.629880] ata2.00: failed command: WRITE DMA EXT Mar 15 10:39:41 video kernel: [414501.629889] ata2.00: cmd 35/00:00:28:6d:f6/00:04:06:00:00/e0 tag 0 dma 524288 out Mar 15 10:39:41 video kernel: [414501.629891] res 51/84:b1:77:6e:f6/84:02:06:00:00/e0 Emask 0x30 (host bus error) Mar 15 10:39:41 video kernel: [414501.629896] ata2.00: status: { DRDY ERR } Mar 15 10:39:41 video kernel: [414501.629899] ata2.00: error: { ICRC ABRT } Mar 15 10:39:41 video kernel: [414501.629910] ata2.00: hard resetting link Mar 15 10:39:41 video kernel: [414501.973009] ata2.01: hard resetting link Mar 15 10:39:41 video kernel: [414502.482642] ata2.00: SATA link up 3.0 Gbps (SStatus 123 SControl 300) Mar 15 10:39:41 video kernel: [414502.482658] ata2.01: SATA link down (SStatus 0 SControl 300) Mar 15 10:39:41 video kernel: [414502.546160] ata2.00: configured for UDMA/133 Mar 15 10:39:41 video kernel: [414502.546203] ata2: EH complete Is this the result of faulty drives? Is software RAID just not performant enough for data rates ~15 MB/s, even with a quad-core i7? Thanks for your help. Edit: cat /proc/mdstat returns this: Personalities : [linear] [multipath] [raid0] [raid1] [raid6] [raid5] [raid4] [raid10] md0 : active raid1 sdb1[1] sda1[0] 976760768 blocks [2/2] [UU] unused devices: <none>

    Read the article

  • Why is mkfs overwriting the LUKS encryption header on LVM on RAID partitions on Ubuntu 12.04?

    - by Starchy
    I'm trying to setup a couple of LUKS-encrypted partitions to be mounted after boot-time on a new Ubuntu server which was installed with LVM on top of software RAID. After running cryptsetup luksFormat, the LUKS header is clearly visible on the volume. After running any flavor of mkfs, the header is overwritten (which does not happen on other systems that were setup without LVM), and cryptsetup will no longer recognize the device as a LUKS device. # cryptsetup -y --cipher aes-cbc-essiv:sha256 --key-size 256 luksFormat /dev/dm-1 WARNING! ======== This will overwrite data on /dev/dm-1 irrevocably. Are you sure? (Type uppercase yes): YES Enter LUKS passphrase: Verify passphrase: # hexdump -C /dev/dm-1|head -n5 00000000 4c 55 4b 53 ba be 00 01 61 65 73 00 00 00 00 00 |LUKS....aes.....| 00000010 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................| 00000020 00 00 00 00 00 00 00 00 63 62 63 2d 65 73 73 69 |........cbc-essi| 00000030 76 3a 73 68 61 32 35 36 00 00 00 00 00 00 00 00 |v:sha256........| 00000040 00 00 00 00 00 00 00 00 73 68 61 31 00 00 00 00 |........sha1....| # cryptsetup luksOpen /dev/dm-1 web2-var # mkfs.ext4 /dev/mapper/web2-var [..snip..] Creating journal (32768 blocks): done Writing superblocks and filesystem accounting information: done # hexdump -C /dev/dm-1|head -n5 # cryptsetup luksClose /dev/mapper/web2-var 00000000 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 |................| * 00000400 00 40 5d 00 00 88 74 01 66 a0 12 00 17 f2 6d 01 |.@]...t.f.....m.| 00000410 f5 3f 5d 00 00 00 00 00 02 00 00 00 02 00 00 00 |.?].............| 00000420 00 80 00 00 00 80 00 00 00 20 00 00 00 00 00 00 |......... ......| # cryptsetup luksOpen /dev/dm-1 web2-var Device /dev/dm-1 is not a valid LUKS device. I have also tried mkfs.ext2 with the same result. Based on setups I've done successfully on Debian and Ubuntu (but not LVM or Ubuntu 12.04), it's hard to see why this is failing.

    Read the article

  • Can't find disk usage in one directory

    - by Xster
    Similar questions are asked frequently but no suggested answers solved my issue. I have some disk space usage that I can't find as well. In df Filesystem 1K-blocks Used Available Use% Mounted on /dev/sda1 144183992 136857180 2652 100% / udev 2013316 4 2013312 1% /dev tmpfs 808848 876 807972 1% /run none 5120 0 5120 0% /run/lock none 2022116 76 2022040 1% /run/shm overflow 1024 0 1024 0% /tmp I checked the inodes, I checked lsof for +L1 or deleted files, I rebooted, I checked for files hidden behind mounts but none of them were the issue. It grows periodically and I'm running out of things to delete to feed the beast. It's all in the home directory of the only user I have. In du in ~ du -h --max-depth=1 192K ./.nv 2.1M ./.gconf 12K ./Pictures 1.6M ./.launchpadlib 12K ./Public 24K ./.TemporaryItems 8.9M ./.cache 12K ./Network Trash Folder 28K ./.vnc 11M ./.AppleDB 48K ./.subversion 1.9G ./.xbmc 8.0K ./.AppleDesktop 12K ./.dbus 81M ./.mozilla 12K ./Music 160K ./.gnome2 44K ./Downloads 692K ./.zsh 236K ./.AppleDouble 64K ./.pulse 4.0K ./.gvfs 1.4M ./.adobe 44K ./.pki 44K ./.compiz-1 168K ./.config 1.4M ./.thumbnails 12K ./Templates 912K ./.gstreamer-0.10 8.0K ./.emacs.d 92K ./Desktop 1.3M ./.local 12K ./Ubuntu One 12K ./Documents 296K ./.fontconfig 12K ./.qt 12K ./.gnome2_private 20K ./.ssh 20K ./.mission-control 12K ./Videos 12K ./Temporary Items 640K ./.macromedia 124G . I can't find a way to figure out how it got to that 124G in that directory. There are no mount points in home.

    Read the article

  • how to correctly mount fat32 partition in Ubuntu in order to preserve case

    - by Dean
    I've found there are couple of problems might be related how my FAT32 partition was mounted. I hope you can help me to solve the problem. I also included the command I used to help others when they find this post, sorry to those might feel I should use less space. I've the following file structures on my disk dean@notebook:~$ sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Disk identifier: 0x08860886 Device Boot Start End Blocks Id System /dev/sda1 * 1 13 102400 7 HPFS/NTFS Partition 1 does not end on cylinder boundary. /dev/sda2 13 5737 45978624 7 HPFS/NTFS /dev/sda3 5738 10600 39062047+ 83 Linux /dev/sda4 10601 19457 71143852+ 5 Extended /dev/sda5 10601 11208 4883728+ 82 Linux swap / Solaris /dev/sda6 11209 15033 30720000 b W95 FAT32 /dev/sda7 15033 19457 35537920 7 HPFS/NTFS In the etc/fstab I've got UUID=91c57a65-dc53-476b-b219-28dac3682d31 / ext4 defaults 0 1 UUID=BEA2A8AFA2A86D99 /media/NTFS ntfs-3g quiet,defaults,locale=en_US.utf8,umask=0 0 0 UUID=0C0C-9BB3 /media/FAT32 vfat user,auto,utf8,fmask=0111,dmask=0000,uid=1000 0 0 /dev/sda5 swap swap sw 0 0 /dev/sda1 /media/sda1 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 /dev/sda2 /media/sda2 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 I checked my id using id and I've got dean@notebook:~$ id uid=1000(dean) gid=1000(dean) groups=4(adm),20(dialout),24(cdrom),46(plugdev),103(fuse),104(lpadmin),115(admin),120(sambashare),1000(dean) I don't know why with these settings I still have problem of using svn like in this one Thank you for your help!

    Read the article

  • Installing VirtualBox on BackTrack 5

    - by m0skit0
    I'm getting this error when running VirtualBox's installation script: $ sudo ~/Downloads/VirtualBox-4.1.14-77440-Linux_x86.run Verifying archive integrity... All good. Uncompressing VirtualBox for Linux installation........... VirtualBox Version 4.1.14 r77440 (2012-04-12T16:20:44Z) installer Removing previous installation of VirtualBox 4.1.14 r77440 from /opt/VirtualBox Installing VirtualBox to /opt/VirtualBox tar: Record size = 8 blocks Python found: python, installing bindings... Building the VirtualBox kernel modules Error! Bad return status for module build on kernel: 3.2.6 (i686) Consult the make.log in the build directory /var/lib/dkms/vboxhost/4.1.14/build/ for more information. ERROR: binary package for vboxhost: 4.1.14 not found Here's the log: $ cat /var/lib/dkms/vboxhost/4.1.14/build/make.log DKMS make.log for vboxhost-4.1.14 for kernel 3.2.6 (i686) Sun May 13 14:32:52 CEST 2012 make: Entering directory `/usr/src/linux-headers-3.2.6' /usr/src/linux-headers-3.2.6/arch/x86/Makefile:39: /usr/src/linux-headers-3.2.6/arch/x86/Makefile_32.cpu: No such file or directory make: *** No rule to make target `/usr/src/linux-headers-3.2.6/arch/x86/Makefile_32.cpu'. Stop. make: Leaving directory `/usr/src/linux-headers-3.2.6' /usr/src/linux-headers-3.2.6/arch/x86/ directory: $ ls /usr/src/linux-headers-3.2.6/arch/x86/ Kconfig Makefile ia32 lguest mm pci tools video Kconfig.cpu boot kernel lib net platform um xen Kconfig.debug crypto kvm math-emu oprofile power vdso Makefile references on "cpu" $ cat /usr/src/linux-headers-3.2.6/arch/x86/Makefile | grep cpu include $(srctree)/arch/x86/Makefile_32.cpu # FIXME - should be integrated in Makefile.cpu (Makefile_32.cpu) Before upgrading to 3.X I didn't have this problem, the script would install VB correctly. Any ideas on what might be causing this? Thanks in advance!

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • How to remove request blocking on apache reverse proxy after failure of backend before asking backen

    - by matnagel
    I am working on an apache2 reverse proxy vhost. When the server behind apache is down, the first request to apache shows the error page of course. But at subsequent requests it seems apache delays for some time before asking the backend server again. During all this time (which is short but in development I don't want a delay at all) only the apache error page is shown to the browser, although the backend server is already up. Where is this setting in apache, what is this behaviour, and how can I set the delay time to zero? Edit: I am not trying to change the timeout for a single request. I want to change the blocking time. It is my experience that apache blocks further requests for a certain time before asking a backend server again that has failed once. Edit2: This is what apache delivers: Service Temporarily Unavailable The server is temporarily unable to service your request due to maintenance downtime or capacity problems. Please try again later. Apache/2.2.8 (Ubuntu) PHP/5.2.4-2ubuntu5.7 with Suhosin-Patch proxy_html/3.0.0 Server at localhost Port 80 After hitting Ctrl-R in firefox for 60 seconds the page finally appears.

    Read the article

  • Data recovery on a corrupted 3TB disk

    - by Mark K Cowan
    Short version I probably need software to run a deep-scan recovery (ideally on Linux) to find files on NTFS filesystem. The file data is intact, but the references are no longer present. Analogous to recovering data from a "quick-formatted" partition. Hopefully there is a smarter way available than deep-scan, one which would recover filenames and possibly paths. Long version I have a 3TB disk containing a load of backups. Windows 7 SP1 refused to detect the disk when plugged in directly via SATA, so I put it on a USB/SATA adaptor which seemed to work at first. The SATA/USB adaptor probably does not support disks over 2.2TB though. Windows first asked me if I wanted to 'format' the disk, then later showed me most of the contents but some folder were inaccessible. I stupidly decided to run a CHKDSK on my backup disk, which made the folders accessible but also left them empty. I connected this disk via SATA to my main PC (Arch Linux). I tried: testdisk ntfsundelete ntfsfix --no-action (to look for diagnostically relevant faults, disk was "OK" though) to no avail as the files references in the tables had presumably been zeroed out by CHKDSK, rather than using a typical journal'd deletion). If it is useful at all, a majority of the files that I want to recover are JPEG, Photoshop PSD, and MPEG-3/MPEG-4/AVI/MKV files. If worst comes to worst, I'll just design my own sector scanner and use some simple heuristic-driven analysis to recover raw binary blocks of data from the disk which appears to match the structures of the above file types. I am unfamiliar with the exact workings of NTFS but used to be proficient at recovering FAT32 systems with just a hex-editor, so I can provide any useful diagnostic information if you let me know how to find it! My priorities in ascending order of importance for choosing the accepted answer: Restores directory structure Recovers many filenames in addition to the file data Is free / very cheap Runs on Linux Recovers a majority of file data The last point is the most important, but the more of the higher points you match the more rep you'll probably get :)

    Read the article

  • Error with procmail script to use Maildir format

    - by bradlis7
    I have this code in /etc/procmailrc: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code to the sending user as well. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user. Sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Do I need a space between the two blocks? Thanks for the help.

    Read the article

  • Dual booting Linux/Win7, Grub refuses to load Win7

    - by JohnB
    Decided to give Linux Mint a try (Ubuntu's interface annoys me), so I installed it with the intention of dual booting with Windows 7. Installation went fine, but now I can only boot into Linux Mint. Grub lists two Windows 7 menu options, but selecting either of them causes an "unknown file system" error and dumps me into a Grub recovery prompt. There, I have to manually reset the root and prefix options, as they reset hd0,msdos6 when they should be hd0,msdos5. I ran Boot Repair twice, once to fix grub errors, once to rebuild the MBR, but it didn't fix anything. Here is the log: http://paste.ubuntu.com/1029675/ fdisk output: Device Boot Start End Blocks Id System /dev/sda1 * 2048 206847 102400 7 HPFS/NTFS/exFAT /dev/sda2 206848 1486249145 743021149 7 HPFS/NTFS/exFAT /dev/sda3 1486249982 1953523711 233636865 5 Extended /dev/sda5 1486249984 1945141247 229445632 83 Linux /dev/sda6 1945143296 1953523711 4190208 82 Linux swap / Solaris grub.cfg: ### BEGIN /etc/grub.d/30_os-prober ### menuentry "Windows 7 (loader) (on /dev/sda1)" --class windows --class os { insmod part_msdos insmod ntfs set root='(hd0,msdos1)' search --no-floppy --fs-uuid --set=root 86184D18184D091F chainloader +1 } menuentry "Windows 7 (loader) (on /dev/sda2)" --class windows --class os { insmod part_msdos insmod ntfs set root='(hd0,msdos2)' search --no-floppy --fs-uuid --set=root 56D84F84D84F60FB chainloader +1 } ### END /etc/grub.d/30_os-prober ### I have found a few similar troubleshooting guides so far, but so far no amount of updating/configuring Grub has been successful. Last resort is, I suppose, use the W7 recovery disc and start over. Thanks in advance! Linux Mint 13 Maya, 64-bit Windows 7 Home Edition, 64-bit

    Read the article

  • how to uninstall ubuntu 8 from ubuntu 10 dual boot

    - by umar
    I have ubuntu 8.04 and ubuntu 10.04 on my laptop, and i want to reclaim all the ubuntu 8 space so that i have just one operating system on my laptop. how can i do it? the output of sudo fdisk -l is as follows: sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x31a431a3 Device Boot Start End Blocks Id System /dev/sda1 * 1 4959 39833136 83 Linux /dev/sda2 4960 5233 2200905 82 Linux swap / Solaris /dev/sda3 5234 12852 61192552 83 Linux /dev/sda4 12852 19458 53062657 5 Extended /dev/sda5 12852 19182 50847744 83 Linux /dev/sda6 19182 19458 2213888 82 Linux swap / Solaris i dont know which of sda1, ..., sda 6 etc ubuntu 8 is on. how can i find that out? The actual task is that i think a lot of space is devoted to ubuntu 8, if there is no easy way to get rid of it, then i want to repartition the disk so that about 50 GB of hard disk space is given to ubuntu 10's home folder from the ubuntu 8's home folder. but i hope that there is an easy way to get rid of ubuntu 8 alrogether and just have ubuntu 10 on my system.

    Read the article

  • Expected IOPS for log writing on PS6000X SAN?

    - by dssz
    Customer is experiencing poor Sybase ASE 15 performance on a PS6000X SAN with 16 X 450GB 10K in RAID-50. The server is a Dell R710 running 2003 server R2 64bit in ESX 4.0.0,256968 I've used sqlio to benchmark the sequential write performance of 4KB blocks on the drive. sqlio -kW -t1 -s600 -dE -o1 -fsequential -b4 -BH -LS sqliotestfile.dat Result is 1900 IOPS. However, when Sybase is running a sustained workload of small inserts SAN HQ shows a consistent 590 IOPS (and 100% 4K write activity). It also shows that the write latency increases to 1.2ms from <1ms. Monitoring and tests in Sybase demonstrate the performance problem is IO related and in particular there is a lot of wait time writing to the log. The SAN indicates that write caching is enabled. What IOPS should the SAN be capable of for 4k sequential write activity? Also, with write caching enabled, shouldn't the controller be batching up the 4K writes into something more efficient? Also, any tips on Sybase on ESX would be appreciated.

    Read the article

  • Opera 10.5 RAM usage and Google Reader?

    - by David
    Hi all, Today I upgraded to Opera 10.5 from Google Chrome and I have two really important questions about it. 1) Is it normal for it to use SO MUCH RAM!!!!? Closing tabs doesn't help, but opening new ones add on to the usage. I can have just 4 tabs open and it goes up to the 300MB mark and I only have 1.5GB in my laptop, 596MB of it used by the graphics card so this really unacceptable. Is there a way to fix it? 2) Why does Google Reader feel so slow and unresponsive on it? It lags so bad when I just try scrolling through the page. I know Opera is known for being really smooth while scrolling through pages. There's also a white bar at the bottom of the page that I can get rid of. It blocks the "Next" and "Previous" buttons. The test between articles is also sort of intersecting each other and that just looks completely unattractive and that's something i'm not used with any web browser. I realize there's a built-in RSS reader, but it doesn't sync across multiple computers and is very late at updating. Here are my specs: Windows 7 Ultimate (x86), Intel Pentium M 1.86 GHz, 1.5GB RAM, ATI Mobility Radeon X600 (64MB dedicated, 596MB shared)

    Read the article

  • SQL transaction log backups conflicting with full backups?

    - by BradC
    On our SQL servers (2000, 2005, and 2008), we run full backups once a day in the evening, and transaction log backups every 2 hrs. We haven't really worried about these two processes conflicting, but lately we've run into some of the following issues: On one server, the trans log backup occasionally blocks the full backup, and must be manually stopped before the full backup can complete We sometimes end up with a massively-sized trans log backup file (sometimes larger than the full backup!) that seems to occur at the same time the full backup is running. I found a reference that indicate that these are "not allowed" to run at the same time, whatever that means: SQL 2000 Books Online and SQL 2005 Books Online. I'm not sure whether that means that the server will simply prevent them from running simultaneously, or if we ought to be explicitly stopping the log backups while the full backups are running. So are there known conflicts/issues between these? Does the answer differ between SQL versions? Should I have the trans log backup job check to see if the full backup is running before it executes? (and how do I do that...?)

    Read the article

  • Redundant OpenVPN connections with advanced Linux routing over an unreliable network

    - by konrad
    I am currently living in a country that blocks many websites and has unreliable network connections to the outside world. I have two OpenVPN endpoints (say: vpn1 and vpn2) on Linux servers that I use to circumvent the firewall. I have full access to these servers. This works quite well, except for the high package loss on my VPN connections. This packet loss varies between 1% and 30% depending on time and seems to have a low correlation, most of the time it seems random. I am thinking about setting up a home router (also on Linux) that maintains OpenVPN connections to both endpoints and sends all packets twice, to both endpoints. vpn2 would send all packets from home to vpn1. Return trafic would be send both directly from vpn1 to home, and also through vpn2. +------------+ | home | +------------+ | | | OpenVPN | | links | | | ~~~~~~~~~~~~~~~~~~ unreliable connection | | +----------+ +----------+ | vpn1 |---| vpn2 | +----------+ +----------+ | +------------+ | HTTP proxy | +------------+ | (internet) For clarity: all packets between home and the HTTP proxy will be duplicated and sent over different paths, to increase the chances one of them will arrive. If both arrive, the first second one can be silently discarded. Bandwidth usage is not an issue, both on the home side and endpoint side. vpn1 and vpn2 are close to each other (3ms ping) and have a reliable connection. Any pointers on how this could be achieved using the advanced routing policies available in Linux?

    Read the article

  • Is it possible to mount a disk image, created with dd, to a directory on a mounted external usb hdd?

    - by Keeper Hood
    I have an image of my home (/dev/sda3) partition, which I've created using the "dd" command. dd if=/dev/sda3 of=/path/to/disk.img I've deleted the home partition via gparted in order to enlarge my /dev/root partition. Then I've recreated the /dev/sda3 partition which is smaller in size then the one I've backed up to the image. I was wondering since I have a 2TB external HDD, could it be possible to mount my backed up image on the external HDD and then copy the files into the /home directory. Since the external HDD would be already in a "mounted state", I'm unsure whether this is a good idea, mounting on a mounted device. I'm running Slackware 13.37 (64bit). used ext4 on all the partitions. resized the root partition with gparted live cd. I've tried mount -t ext4 /path/to/disk.img /mng/image -o loop It gave me an fs error (wrong fs type, bad option, bad superblock on dev/loop/0) Then i did dmesg | tail which outputs: EXT4-fs (loop0) : bad geometry: block count 29009610 exceeds size of defice (1679229 blocks) I have no idea what to do, I want to restore my /home data from the image I've backed up.

    Read the article

  • how to correctly mount fat32 partition in Ubuntu in order to preserve case

    - by Dean
    I've found there are couple of problems might be related how my FAT32 partition was mounted. I hope you can help me to solve the problem. I also included the command I used to help others when they find this post, sorry to those might feel I should use less space. I've the following file structures on my disk dean@notebook:~$ sudo fdisk -l Disk /dev/sda: 160.0 GB, 160041885696 bytes 255 heads, 63 sectors/track, 19457 cylinders Units = cylinders of 16065 * 512 = 8225280 bytes Disk identifier: 0x08860886 Device Boot Start End Blocks Id System /dev/sda1 * 1 13 102400 7 HPFS/NTFS Partition 1 does not end on cylinder boundary. /dev/sda2 13 5737 45978624 7 HPFS/NTFS /dev/sda3 5738 10600 39062047+ 83 Linux /dev/sda4 10601 19457 71143852+ 5 Extended /dev/sda5 10601 11208 4883728+ 82 Linux swap / Solaris /dev/sda6 11209 15033 30720000 b W95 FAT32 /dev/sda7 15033 19457 35537920 7 HPFS/NTFS In the etc/fstab I've got UUID=91c57a65-dc53-476b-b219-28dac3682d31 / ext4 defaults 0 1 UUID=BEA2A8AFA2A86D99 /media/NTFS ntfs-3g quiet,defaults,locale=en_US.utf8,umask=0 0 0 UUID=0C0C-9BB3 /media/FAT32 vfat user,auto,utf8,fmask=0111,dmask=0000,uid=1000 0 0 /dev/sda5 swap swap sw 0 0 /dev/sda1 /media/sda1 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 /dev/sda2 /media/sda2 ntfs nls=iso8859-1,ro,noauto,umask=000 0 0 I checked my id using id and I've got dean@notebook:~$ id uid=1000(dean) gid=1000(dean) groups=4(adm),20(dialout),24(cdrom),46(plugdev),103(fuse),104(lpadmin),115(admin),120(sambashare),1000(dean) I don't know why with these settings I still have problem of using svn like in this one Thank you for your help!

    Read the article

  • Chipset fan on the frtiz - compressed air hasn't fixed anything - is there anything I can do?

    - by Anthony
    Yesterday, my computer started to make an annoying whining noise. Knowing that this is likely a fan issue, I opened the case and proceeded to determine which fan was causing the issue. I got some compressed air and tried cleaning out the dust around it (and the rest of the computer while I was at it). This hasn't seemed to fix the issue. Now, if it were just any fan, I would probably just replace the fan - they're relatively cheap after all. However, this is a special fan. Aside: For what its worth, I feel bad that the graphics card blocks part of the fan, but it is the only slot the graphics card fits, so I had no choice. After pulling out my motherboard user guide, it looks like this is a fan placed directly on top of the chipset. To be perfectly honest, I have no clue what the purpose of the chipset is - but it sounds important. After some quick research, I see that it is responsible for providing the bridge between my CPU, RAM and graphics, among other things. Just a quick search at Newegg tells me that chipset fans can be purchased at pretty reasonable prices (< 20 dollars). Is it practical to replace this fan? It is an old computer as computers go and I wouldn't be terribly upset to upgrade the motherboard and processor, so perhaps this is a sign. Hardware Specs: Motherboard: Asus A8N-E Chipset: NVIDIA nForce4 Ultra

    Read the article

< Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >