Search Results

Search found 13727 results on 550 pages for 'target platform'.

Page 79/550 | < Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >

  • Don't Miss At Devoxx!!!

    - by Yolande Poirier
    Come by IoT Hack Fest which starts with the session: kickstart your Raspberry Pi and/or Leap Motion project, part II on Tuesday from 9:30am to 12:00pm to learn how to start a project with the Raspberry Pi and Leap Motion. In the afternoon, you can still join a project and create your own project with the help of experts on Raspberry Pi, Leap Motion and other boards.  At the Oracle booth, Java experts will be available  to answer your  questions and demo the new features of the Java Platform, including Java Embedded, JavaFX, Java SE and Java EE. This year, the chess game that was first demoed at JavaOne keynotes last September will be showcased at Devoxx.  Duke is coming to Devoxx this year. You can get your picture taken with Duke on Tuesday, Wednesday and Thursday (Nov. 12-14) from 12:00 to 18:00 Beer bash will be Tuesday from 17:30-19:30 and Wednesday/Thursday from 18:00 to 20:00 at the booth. Oracle is raffling off five Raspberry Pi's and a number of books every day. Make sure to stop by and get your badge scanned to enter the raffle. Raffles are Tuesday at 19:15 and Wednesday/Thursday at 19:45 at the Oracle booth.  The main conference sessions from Oracle Java experts are:  Wednesday 13 November Beyond Beauty: JavaFX, Parallax, Touch, Raspberry Pi, Gyroscopes, and Much More Angela Caicedo, Senior Member, Technical Staff, Oracle Room 7, 12:00–13:00 Lambda: A Peek Under the Hood, Brian Goetz, Software Architect, Oracle Room 8, 12:00–13:00 In Full Flow: Java 8 Lambdas in the Stream, Paul Sandoz, Software Developer, Oracle Room 8, 14:00–15:00 The Modular Java Platform and Project Jigsaw, Mark Reinhold, Chief Architect, Java Platform Group, Oracle, Room 8, 15:10–16:10 The Curious Case of JavaScript on the JVM, Attila Szegedi, Principal Member, Technical Staff, Oracle, Room 5, 16:40–17:40 Is It a Car? Is It a Computer? No, It’s a Raspberry Pi JavaFX Informatics System. Simon Ritter, Principal Technology Evangelist, Oracle Room 7, 16:40–17:40 Thursday 14 November Java EE 7: What’s New in the Java EE Platform Linda DeMichiel, Consulting Member, Technical Staff, Oracle, Room 8, 10:50–11:50 Java Microbenchmark Harness: The Lesser of the Two Evils, Aleksey Shipilev, Principal Member, Technical Staff, Oracle. Room 6, 14:00–15:00 Practical Restful Persistence, Shaun Smith, Senior Principal Product Manager, Oracle Room 8, 17:50–18:50 Friday 15 November Avatar.js, Server-Side JavaScript on the Java Platform, Jean-Francois Denise, Software Developer, Oracle Room 8, 11:50–12:50

    Read the article

  • Win7 is not a tablet OS, no matter what the boys in Redmond think.

    - by John Conwell
    Despite what execs at Microsoft think, Windows 7 is NOT a tablet OS.  Just because you can install some software (or OS) on a device, doesn't mean that device is meant to run that software.  This seems to be the step that the non-engineer execs at Microsoft have seem to not understood.  In order to seamlessly work with a device, the software needs to be designed with that device in mind.  That has been the problem with the Windows PDA platform, the Windows Mobil platform, and now with trying to force fit Windows 7 on a tablet.  Its just not designed for that style of interaction.   Windows is designed to be interacted with via a mouse and keyboard.  In fact, it is brilliant at that.  But, It is NOT designed to be interacted with by your fingers.  And that is why the Windows tablet failed 10 years ago, and why it will fail today.  Its not the hardware's fault like Microsoft claimed 10 years ago.  Its the User Interaction design that failed. And this is why the iPhone and Android OS's work wonderfully on a tablet.  The user interaction was designed for small screens, navigated by big fat fingers.  I love these OS's and how I interact with them.  And when I play with a touch screen Windows 7 device, I am feel like I'm playing with a brittle wana-be.  And its not the hardware's fault.  The touchscreen is very responsive.  I actually like the hardware.  But the OS and the software are just not designed to be interacted with, with my big fat fingers.  In order to be successful, Microsoft needs to start from scratch, and build a platform AND SOFTWARE specifically for use by fingers.  Thats why everyone was so excited when they though Microsoft was going to release the Courier tablet.  Because it looked like a totally different platform.  Something that might actually work.  But Windows 7...I hate to burst your bubble, but you are not a touch platform.

    Read the article

  • Great opportunity to try Windows Azure over the next 7 days if you are a UK developer &ndash; act to

    - by Eric Nelson
    Are you a UK based developer who has been put off from trying out the Windows Azure Platform? Were you concerned that you needed to hand over credit card details even to use the introductory offer? Or concerned about how many charges you might run up as you played with “elastic computing”. Then we might have just what you need. 7 Days of access to the Windows Azure Platform – for FREE (expires June 6th 2010) If you are accepted, you will be given a Windows Azure Platfom subscription that will enable you to create Windows Azure hosted services and storage accounts, SQL Azure databases and AppFabric services without any fear of being charged between now and Sunday the 6th of June 2010. No credit card is required. Important: At the end of Sunday your subscription and all your code and data you have uploaded will be deleted. It is your responsibility to keep local copies of your code and data. Apply now To apply for this offer you need to: email ukdev AT microsoft.com with a subject line that starts “UKAZURETRAIL:” (This must  be present) In the email you need to demonstrate you are UK based (.uk email alias or address or… be creative) And you must include 30 to 100 words explaining What your interest is in the Windows Azure Platform and Cloud Computing What you would use the 7 days to explore Some notes (please read!): We have a limited number of these offers to give away on a first come, first served basis (subject to meeting the above criteria). We plan to process all request asap – but there is a UK bank holiday weekend looming. We will do our best to process all by Tues afternoon (which would still give you 5 days of access) There will be no specific support for this offer. We will not be processing any requests that arrive after Tuesday 1st. In case you were wondering, there is no equivalent offer for developer outside of the UK. This offer is a direct result of UK based training we are currently doing which has some spare Azure capacity which we wanted to make best use of. Sorry in advance if you based outside of the UK. Related Links: If you are UK based, you should also join the UK Windows Azure Platform community http://ukazure.ning.com Microsoft UK Windows Azure Platform page

    Read the article

  • WebCenter Customer Spotlight: Azul Brazilian Airlines

    - by me
    Author: Peter Reiser - Social Business Evangelist, Oracle WebCenter  Solution SummaryAzul Linhas Aéreas Brasileiras (Azul Brazilian Airlines) is the third-largest airline in Brazil serving  42 destinations with a fleet of 49 aircraft and employs 4,500 crew members. The company wanted to offer an innovative site with a simple purchasing process for customers to search for and buy tickets and for the company’s marketing team to more effectively conduct its campaigns. To this end, Azul implemented Oracle WebCenter Sites, succeeding in gathering all of the site’s key information onto a single platform. Azul can now complete the Web site content updating process—which used to take approximately 48 hours—in less than five minutes. Company OverviewAzul Linhas Aéreas Brasileiras (Azul Brazilian Airlines) has established itself as the third-largest airline in Brazil, based on a business model that combines low prices with a high level of service. Azul serves 42 destinations with a fleet of 49 aircraft. It operates 350 daily flights with a team of 4,500 crew members. Last year, the company transported 15 million passengers, achieving a 10% share of the Brazilian market, according to the Agência Nacional de Aviação Civil (ANAC, or the National Civil Aviation Agency). Business ChallengesThe company wanted to offer an innovative site with a simple purchasing process for customers to search for and buy tickets and for the company’s marketing team to more effectively conduct its campaigns. Provide customers with an  innovative Web site with a simple process for purchasing flight tickets Bring dynamism to the Web site’s content updating process to provide autonomy to the airline’s strategic departments, such as marketing and product development Facilitate integration among the site’s different application providers, such as ticket availability and payment process, on which ticket sales depend Solution DeployedAzul worked with the  Oracle partner TQI to implement Oracle WebCenter Sites, succeeding in gathering all of the site’s key information onto a single platform. Previously, at least three servers and corporate information environments had directed data to the portal. The single Oracle-based platform now facilitates site updates, which are daily and constant. Business Results Gained development freedom in all processes—from implementation to content editing Gathered all of the Web site’s key information onto a single platform, facilitating its daily and constant updating, whereas the information was previously spread among at least three IT environments and had to go through a complex process to be made available online to customers Reduced time needed to update banners and other Web site content from an average of 48 hours to less than five minutes Simplified the flight ticket sales process thanks to tool flexibility that enabled the company to improve Website usability “Oracle WebCenter Sites provides an easy-to-use platform that enables our marketing department to spend less time updating content and more time on innovative activities. Previously, it would take 48 hours to update content on our Web site; now it takes less than five minutes. We have shown the market that we are innovators, enabling customer convenience through an improved flight ticket purchase process.” Kleber Linhares, Information Technology and E-Commerce Director, Azul Linhas Aéreas Brasileiras Additional Information Azul Brazilian Airlines Case Study Oracle WebCenter Sites Oracle WebCenter Sites Satellite Server

    Read the article

  • Rotate camera around player and set new forward directions

    - by Samurai Fox
    I have a 3rd person camera which can rotate around the player. When I look at the back of the player and press forward, player goes forward. Then I rotate 360 around the player and "forward direction" is tilted for 90 degrees. So every 360 turn there is 90 degrees of direction change. For example when camera is facing the right side of the player, when I press button to move forward, I want player to turn to the left and make that the "new forward". I have Player object with Camera as child object. Camera object has Camera script. Inside Camera script there are Player and Camera classes. Player object itself, has Input Controller. Also I'm making this script for joystick/ controller primarily. My camera script so far: using UnityEngine; using System.Collections; public class CameraScript : MonoBehaviour { public GameObject Target; public float RotateSpeed = 10, FollowDistance = 20, FollowHeight = 10; float RotateSpeedPerTime, DesiredRotationAngle, DesiredHeight, CurrentRotationAngle, CurrentHeight, Yaw, Pitch; Quaternion CurrentRotation; void LateUpdate() { RotateSpeedPerTime = RotateSpeed * Time.deltaTime; DesiredRotationAngle = Target.transform.eulerAngles.y; DesiredHeight = Target.transform.position.y + FollowHeight; CurrentRotationAngle = transform.eulerAngles.y; CurrentHeight = transform.position.y; CurrentRotationAngle = Mathf.LerpAngle(CurrentRotationAngle, DesiredRotationAngle, 0); CurrentHeight = Mathf.Lerp(CurrentHeight, DesiredHeight, 0); CurrentRotation = Quaternion.Euler(0, CurrentRotationAngle, 0); transform.position = Target.transform.position; transform.position -= CurrentRotation * Vector3.forward * FollowDistance; transform.position = new Vector3(transform.position.x, CurrentHeight, transform.position.z); Yaw = Input.GetAxis("Right Horizontal") * RotateSpeedPerTime; Pitch = Input.GetAxis("Right Vertical") * RotateSpeedPerTime; transform.Translate(new Vector3(Yaw, -Pitch, 0)); transform.position = new Vector3(transform.position.x, transform.position.y, transform.position.z); transform.LookAt(Target.transform); } }

    Read the article

  • MSBuild: convert relative path in imported project to absolute path.

    - by Ergwun
    Short version: I have an MSBuild project that imports another project. There is a property holding a relative path in the imported project that is relative to the location of the imported project. How do I convert this relative path to be absolute? I've tried the ConvertToAbsolutePath task, but this makes it relative to the importing project's location). Long version: I'm trying out Robert Koritnik's MSBuild task for integrating nunit output into Visual Studio (see this other SO question for a link). Since I like to have all my tools under version control, I want the target file with the custom task in it to point to the nunit console application using a relative path. My problem is that this relative path ends up being made relative to the importing project. E.g. (in ... MyRepository\Third Party\NUnit\MSBuild.NUnit.Task.Source\bin\Release\MSBuild.NUnit.Task.Targets): ... <PropertyGroup Condition="'$(NUnitConsoleToolPath)' == ''"> <NUnitConsoleToolPath>..\..\..\NUnit 2.5.5\bin\net-2.0</> </PropertyGroup> ... <Target Name="IntegratedTest"> <NUnitIntegrated TreatFailedTestsAsErrors="$(NUnitTreatFailedTestsAsErrors)" AssemblyName="$(AssemblyName)" OutputPath="$(OutputPath)" ConsoleToolPath="$(NUnitConsoleToolPath)" ConsoleTool="$(NUnitConsoleTool)" /> </Target> ... The above target fails with the error that the file cannot be found (that is the nunit-console.exe file). Inside the NUnitIntegrated MSBuild task, when the the execute() method is called, the current directory is the directory of the importing project, so relative paths will point to the wrong location. I tried to convert the relative path to absolute by adding these tasks to the IntegratedTest target: <ConvertToAbsolutePath Paths="$(NUnitConsoleToolPath)"> <Output TaskParameter="AbsolutePaths" PropertyName="AbsoluteNUnitConsoleToolPath"/> </ConvertToAbsolutePath> but this just converted it to be relative to the directory of the project file that imports this target file. I know I can use the property $(MSBuildProjectDirectory) to get the directory of the importing project, but can't find any equivalent for directory of the imported target file. Can anyone tell me how a path in an imported file that is supposed to be relative to the directory that the imported file is in can be made absolute? Thanks!

    Read the article

  • XCode linking error when targeting armv7.

    - by Tom
    I've already spent countless hours puzzling over this, utilizing Google searches and other Stack Overflow questions to no avail. I have an iPhone/iPad universal application, which seems to compile fine when the target is armv6. However, when the device is iPad, I get this warning: warning: building for SDK 'Device - iPhone OS 3.2' requires an armv7 architecture. Oddly enough, the app still runs great on iPad in spite of this warning. However, I do want to do things the "right way" what ever that means in this case. When I switch the target architecture to armv7, I get linking errors: "___restore_vfp_d8_d15_regs", referenced from: *redacted* "___save_vfp_d8_d15_regs", referenced from: *redacted* ld: symbol(s) not found collect2: ld returned 1 exit status The "redacted" portions of the errors are references to the static library to which I'm trying to link. Here's what I've tried from the many suggestions online. Each of these were suggested more than once without any explanation, which leads me to believe nobody quite understands this problem: "Never use the drop down menu in the upper left of the XCode window to choose the target. Instead, set this to Base SDK and then the Base SDK to iPhone OS 3.0 in the target configuration. Set the target device to your preferred target (iPad, iPhone OS 3.2 in my situation.)" This yields the error "Library not found for -lcrt1.3.1.o" "Make sure that GCC isn't linking against the wrong version of the standard library. (You'll have to make sure the LIBRARY_SEARCH_PATH doesn't have the wrong path in it.)" My LIBRARY_SEARCH_PATH is already empty, so this doesn't seem relevant. "Try compiling with GCC 4.0 rather than GCC 4.2." I get a syntax error inside a UIKit header file. The error is "Syntax error before 'AT_NAME' token." The line is "UIKIT_EXTERN @interface UILocalizedIndexedCollation : NSObject." Another project compiles just fine with the same target settings, which is really making me question my sanity. Could I be dealing with a corrupt XCode project? If anyone knows what's actually happening and has a reference or doesn't mind explaining it, I would be so very grateful. Cheers!

    Read the article

  • MSBuild command-line error - Silverlight 4 SDK is not installed

    - by Ned
    My MSBuild command line is as follows: msbuild e:\code\myProject.csproj /p:Configuration=Debug /p:OutputPath=bin/Debug /p:Platform=x86 /p:PlatformTarget=x86 The project builds fine on my development machine in VS2010 but not with the command above. I am running Win 7 64 - Bit. I'm getting an error that says I don't have the Silverlight 4 SDK installed but I do. I"ve read some posts that you have to set the Platform=x86 but to no avail. Here is the error message in full: Microsoft (R) Build Engine Version 4.0.30319.1 [Microsoft .NET Framework, Version 4.0.30319.1] Copyright (C) Microsoft Corporation 2007. All rights reserved. Build started 6/8/2010 4:03:38 PM. Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010 .web.csproj" on node 1 (default targets). GenerateTargetFrameworkMonikerAttribute: Skipping target "GenerateTargetFrameworkMonikerAttribute" because all output fi les are up-to-date with respect to the input files. CoreCompile: Skipping target "CoreCompile" because all output files are up-to-date with resp ect to the input files. CopyFilesToOutputDirectory: Copying file from "obj\Debug\MyProject.Web.dll" to "bin\Debug\MyProject.Web .dll". MyProject2010.web - E:\code\dashboards\MyProject2010\MyProject2010.Web \bin\Debug\MyProject.Web.dll Copying file from "obj\Debug\MyProject.Web.pdb" to "bin\Debug\MyProject.Web .pdb". Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010 .web.csproj" (1) is building "E:\code\dashboards\MyProject2010\MyProject20 10.Client\MyProject2010.Client.csproj" (2) on node 1 (GetXapOutputFile target( s)). C:\Program Files (x86)\MSBuild\Microsoft\Silverlight\v4.0\Microsoft.Silverlight .Common.targets(104,9): error : The Silverlight 4 SDK is not installed. [E:\cod e\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Client.cspr oj] Done Building Project "E:\code\dashboards\MyProject2010\MyProject2010.Clie nt\MyProject2010.Client.csproj" (GetXapOutputFile target(s)) -- FAILED. Done Building Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\ MyProject2010.web.csproj" (default targets) -- FAILED. Build FAILED. "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010.web.csp roj" (default target) (1) - "E:\code\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Clie nt.csproj" (GetXapOutputFile target) (2) - (GetFrameworkPaths target) - C:\Program Files (x86)\MSBuild\Microsoft\Silverlight\v4.0\Microsoft.Silverlig ht.Common.targets(104,9): error : The Silverlight 4 SDK is not installed. [E:\c ode\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Client.cs proj] 0 Warning(s) 1 Error(s) Time Elapsed 00:00:00.39 I appreciate anyone's help. Thanks.

    Read the article

  • Ajax doesn't trigger a change-event on a webkit based browser

    - by user319464
    I have adapted a Jquery plugin to for-fill my needs to send GET requests to servers as a way of "pinging" them. I've also added some javascript code to add some fancy features like: depending on the changed value in a that the Jquery plugin changes, it changes the Icon accordingly. To make it all work essentially, I made so that when Ajax gets a "complete" event, it forces a "onChange" event to the span, triggering the javascript validation function to change the status icons. Here is the code of my slightly modified jQuery Plugin: /** * ping for jQuery * * Adapted by Carroarmato0 (to actually work instead of randomly "pinging" nowhere instead of faking * * @auth Jessica * @link http://www.skiyo.cn/demo/jquery.ping/ * */ (function($) { $.fn.ping = function(options) { var opts = $.extend({}, $.fn.ping.defaults, options); return this.each(function() { var ping, requestTime, responseTime ; var target = $(this); var server = target.html(); target.html('<img src="img/loading.gif" alt="loading" />'); function ping() { $.ajax({url: 'http://' + server, type: 'GET', dataType: 'html', timeout: 30000, beforeSend : function() { requestTime = new Date().getTime(); }, complete : function() { responseTime = new Date().getTime(); ping = Math.abs(requestTime - responseTime); if (ping > 2000) { target.text('niet bereikbaar'); } else { target.text(ping + opts.unit); } target.change(); } }); } ping(); opts.interval != 0 && setInterval(ping,opts.interval * 1000); }); }; $.fn.ping.defaults = { interval: 3, unit: 'ms' }; })(jQuery); target.change(); is the code that triggers the "onchange" event in the span: echo " <td class=\"center\"><span id=\"ping$pingNb\" onChange=\"checkServerIcon(this)\" >" .$server['IP'] . "</span></td>"; In Firefox this works, checkServerIcon(this) gets executed and passes the span object to the function. function checkServerIcon(object) { var delayText = object.innerHTML; var delay = delayText.substring(0, delayText.length - 2); if ( isInteger(delay) ) { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/enable_server.png'; } else { if (delay == "bezig.") { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/search_server.png'; } else { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/desable_server.png'; } } } My guess would be that there's something different in WebKit browsers in the way object.parentNode.previousSibling.parentNode. .... works...

    Read the article

  • How can I have a Makefile automatically rebuild source files that include a modified header file? (I

    - by Nicholas Flynt
    I have the following makefile that I use to build a program (a kernel, actually) that I'm working on. Its from scratch and I'm learning about the process, so its not perfect, but I think its powerful enough at this point for my level of experience writing makefiles. AS = nasm CC = gcc LD = ld TARGET = core BUILD = build SOURCES = source INCLUDE = include ASM = assembly VPATH = $(SOURCES) CFLAGS = -Wall -O -fstrength-reduce -fomit-frame-pointer -finline-functions \ -nostdinc -fno-builtin -I $(INCLUDE) ASFLAGS = -f elf #CFILES = core.c consoleio.c system.c CFILES = $(foreach dir,$(SOURCES),$(notdir $(wildcard $(dir)/*.c))) SFILES = assembly/start.asm SOBJS = $(SFILES:.asm=.o) COBJS = $(CFILES:.c=.o) OBJS = $(SOBJS) $(COBJS) build : $(TARGET).img $(TARGET).img : $(TARGET).elf c:/python26/python.exe concat.py stage1 stage2 pad.bin core.elf floppy.img $(TARGET).elf : $(OBJS) $(LD) -T link.ld -o $@ $^ $(SOBJS) : $(SFILES) $(AS) $(ASFLAGS) $< -o $@ %.o: %.c @echo Compiling $<... $(CC) $(CFLAGS) -c -o $@ $< #Clean Script - Should clear out all .o files everywhere and all that. clean: -del *.img -del *.o -del assembly\*.o -del core.elf My main issue with this makefile is that when I modify a header file that one or more C files include, the C files aren't rebuilt. I can fix this quite easily by having all of my header files be dependencies for all of my C files, but that would effectively cause a complete rebuild of the project any time I changed/added a header file, which would not be very graceful. What I want is for only the C files that include the header file I change to be rebuilt, and for the entire project to be linked again. I can do the linking by causing all header files to be dependencies of the target, but I cannot figure out how to make the C files be invalidated when their included header files are newer. I've heard that GCC has some commands to make this possible (so the makefile can somehow figure out which files need to be rebuilt) but I can't for the life of me find an actual implementation example to look at. Can someone post a solution that will enable this behavior in a makefile? EDIT: I should clarify, I'm familiar with the concept of putting the individual targets in and having each target.o require the header files. That requires me to be editing the makefile every time I include a header file somewhere, which is a bit of a pain. I'm looking for a solution that can derive the header file dependencies on its own, which I'm fairly certain I've seen in other projects.

    Read the article

  • Why is my namespace not recognized in Visual Studio / xaml

    - by msfanboy
    Hello, these are my 2 classes a Attachable Property SelectedItems: code is from here: http://stackoverflow.com/questions/1297643/sync-selecteditems-in-a-muliselect-listbox-with-a-collection-in-viewmodel The namespace TBM.Helper is for sure proper as it works for other classes too. The namespace reference is also in the xaml file: xmlns:Helper="clr_namespace:TBM.Helper" But <ListBox Helper:SelectedItems.Items="{Binding SelectedItems}" ... does not work because = The property 'SelectedItems.Items' does not exist in XML namespace 'clr_namespace:TBM.Helper'. The attachable property 'Items' was not found in type 'SelectedItems What do I have to change ? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows.Controls; using System.Collections; using System.Windows; namespace TBM.Helper { public static class SelectedItems : DependencyObject { private static readonly DependencyProperty SelectedItemsBehaviorProperty = DependencyProperty.RegisterAttached( "SelectedItemsBehavior", typeof(SelectedItemsBehavior), typeof(ListBox), null); public static readonly DependencyProperty ItemsProperty = DependencyProperty.RegisterAttached( "Items", typeof(IList), typeof(SelectedItems), new PropertyMetadata(null, ItemsPropertyChanged)); public static void SetItems(ListBox listBox, IList list) { listBox.SetValue(ItemsProperty, list); } public static IList GetItems(ListBox listBox) { return listBox.GetValue(ItemsProperty) as IList; } private static void ItemsPropertyChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { var target = d as ListBox; if (target != null) { GetOrCreateBehavior(target, e.NewValue as IList); } } private static SelectedItemsBehavior GetOrCreateBehavior(ListBox target, IList list) { var behavior = target.GetValue(SelectedItemsBehaviorProperty) as SelectedItemsBehavior; if (behavior == null) { behavior = new SelectedItemsBehavior(target, list); target.SetValue(SelectedItemsBehaviorProperty, behavior); } return behavior; } } } using System.Windows; using System.Windows.Controls; using System.Collections; namespace TBM.Helper { public class SelectedItemsBehavior { private readonly ListBox _listBox; private readonly IList _boundList; public SelectedItemsBehavior(ListBox listBox, IList boundList) { _boundList = boundList; _listBox = listBox; SetSelectedItems(); _listBox.SelectionChanged += OnSelectionChanged; _listBox.DataContextChanged += OnDataContextChanged; } private void SetSelectedItems() { _listBox.SelectedItems.Clear(); foreach (object item in _boundList) { // References in _boundList might not be the same as in _listBox.Items int i = _listBox.Items.IndexOf(item); if (i >= 0) _listBox.SelectedItems.Add(_listBox.Items[i]); } } private void OnDataContextChanged(object sender, DependencyPropertyChangedEventArgs e) { SetSelectedItems(); } private void OnSelectionChanged(object sender, SelectionChangedEventArgs e) { _boundList.Clear(); foreach (var item in _listBox.SelectedItems) _boundList.Add(item); } } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Code Golf: Countdown Number Game

    - by Noldorin
    Challenge Here is the task, inspired by the well-known British TV game show Countdown. The challenge should be pretty clear even without any knowledge of the game, but feel free to ask for clarifications. And if you fancy seeing a clip of this game in action, check out this YouTube clip. It features the wonderful late Richard Whitely in 1997. You are given 6 numbers, chosen at random from the set {1, 2, 3, 4, 5, 6, 8, 9, 10, 25, 50, 75, 100}, and a random target number between 100 and 999. The aim is to make use the six given numbers and the four common arithmetic operations (addition, subtraction, multiplication, division; all over the rational numbers) to generate the target - or as close as possible either side. Each number may only be used once at most, while each arithmetic operator may be used any number of times (including zero.) Note that it does not matter how many numbers are used. Write a function that takes the target number and set of 6 numbers (can be represented as list/collection/array/sequence) and returns the solution in any standard numerical notation (e.g. infix, prefix, postfix). The function must always return the closest-possible result to the target, and must run in at most 1 minute on a standard PC. Note that in the case where more than one solution exists, any single solution is sufficient. Examples: {50, 100, 4, 2, 2, 4}, target 203 e.g. 100 * 2 + 2 + (4 / 4) e.g. (100 + 50) * 4 * 2 / (4 + 2) {25, 4, 9, 2, 3, 10}, target 465 e.g. (25 + 10 - 4) * (9 * 2 - 3) {9, 8, 10, 5, 9, 7), target 241 e.g. ((10 + 9) * 9 * 7) + 8) / 5 Rules Other than mentioned in the problem statement, there are no further restrictions. You may write the function in any standard language (standard I/O is not necessary). The aim as always is to solve the task with the smallest number of characters of code. Saying that, I may not simply accept the answer with the shortest code. I'll also be looking at elegance of the code and time complexity of the algorithm! My Solution I'm attempting an F# solution when I find the free time - will post it here when I have something! Format Please post all answers in the following format for the purpose of easy comparison: Language Number of characters: ??? Fully obfuscated function: (code here) Clear (ideally commented) function: (code here) Any notes on the algorithm/clever shortcuts it takes.

    Read the article

  • Simple MSBuild Configuration: Updating Assemblies With A Version Number

    - by srkirkland
    When distributing a library you often run up against versioning problems, once facet of which is simply determining which version of that library your client is running.  Of course, each project in your solution has an AssemblyInfo.cs file which provides, among other things, the ability to set the Assembly name and version number.  Unfortunately, setting the assembly version here would require not only changing the version manually for each build (depending on your schedule), but keeping it in sync across all projects.  There are many ways to solve this versioning problem, and in this blog post I’m going to try to explain what I think is the easiest and most flexible solution.  I will walk you through using MSBuild to create a simple build script, and I’ll even show how to (optionally) integrate with a Team City build server.  All of the code from this post can be found at https://github.com/srkirkland/BuildVersion. Create CommonAssemblyInfo.cs The first step is to create a common location for the repeated assembly info that is spread across all of your projects.  Create a new solution-level file (I usually create a Build/ folder in the solution root, but anywhere reachable by all your projects will do) called CommonAssemblyInfo.cs.  In here you can put any information common to all your assemblies, including the version number.  An example CommonAssemblyInfo.cs is as follows: using System.Reflection; using System.Resources; using System.Runtime.InteropServices;   [assembly: AssemblyCompany("University of California, Davis")] [assembly: AssemblyProduct("BuildVersionTest")] [assembly: AssemblyCopyright("Scott Kirkland & UC Regents")] [assembly: AssemblyConfiguration("")] [assembly: AssemblyTrademark("")]   [assembly: ComVisible(false)]   [assembly: AssemblyVersion("1.2.3.4")] //Will be replaced   [assembly: NeutralResourcesLanguage("en-US")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; }   Cleanup AssemblyInfo.cs & Link CommonAssemblyInfo.cs For each of your projects, you’ll want to clean up your assembly info to contain only information that is unique to that assembly – everything else will go in the CommonAssemblyInfo.cs file.  For most of my projects, that just means setting the AssemblyTitle, though you may feel AssemblyDescription is warranted.  An example AssemblyInfo.cs file is as follows: using System.Reflection;   [assembly: AssemblyTitle("BuildVersionTest")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Next, you need to “link” the CommonAssemblyinfo.cs file into your projects right beside your newly lean AssemblyInfo.cs file.  To do this, right click on your project and choose Add | Existing Item from the context menu.  Navigate to your CommonAssemblyinfo.cs file but instead of clicking Add, click the little down-arrow next to add and choose “Add as Link.”  You should see a little link graphic similar to this: We’ve actually reduced complexity a lot already, because if you build all of your assemblies will have the same common info, including the product name and our static (fake) assembly version.  Let’s take this one step further and introduce a build script. Create an MSBuild file What we want from the build script (for now) is basically just to have the common assembly version number changed via a parameter (eventually to be passed in by the build server) and then for the project to build.  Also we’d like to have a flexibility to define what build configuration to use (debug, release, etc). In order to find/replace the version number, we are going to use a Regular Expression to find and replace the text within your CommonAssemblyInfo.cs file.  There are many other ways to do this using community build task add-ins, but since we want to keep it simple let’s just define the Regular Expression task manually in a new file, Build.tasks (this example taken from the NuGet build.tasks file). <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <UsingTask TaskName="RegexTransform" TaskFactory="CodeTaskFactory" AssemblyFile="$(MSBuildToolsPath)\Microsoft.Build.Tasks.v4.0.dll"> <ParameterGroup> <Items ParameterType="Microsoft.Build.Framework.ITaskItem[]" /> </ParameterGroup> <Task> <Using Namespace="System.IO" /> <Using Namespace="System.Text.RegularExpressions" /> <Using Namespace="Microsoft.Build.Framework" /> <Code Type="Fragment" Language="cs"> <![CDATA[ foreach(ITaskItem item in Items) { string fileName = item.GetMetadata("FullPath"); string find = item.GetMetadata("Find"); string replaceWith = item.GetMetadata("ReplaceWith"); if(!File.Exists(fileName)) { Log.LogError(null, null, null, null, 0, 0, 0, 0, String.Format("Could not find version file: {0}", fileName), new object[0]); } string content = File.ReadAllText(fileName); File.WriteAllText( fileName, Regex.Replace( content, find, replaceWith ) ); } ]]> </Code> </Task> </UsingTask> </Project> .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } If you glance at the code, you’ll see it’s really just going a Regex.Replace() on a given file, which is exactly what we need. Now we are ready to write our build file, called (by convention) Build.proj. <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <Import Project="$(MSBuildProjectDirectory)\Build.tasks" /> <PropertyGroup> <Configuration Condition="'$(Configuration)' == ''">Debug</Configuration> <SolutionRoot>$(MSBuildProjectDirectory)</SolutionRoot> </PropertyGroup>   <ItemGroup> <RegexTransform Include="$(SolutionRoot)\CommonAssemblyInfo.cs"> <Find>(?&lt;major&gt;\d+)\.(?&lt;minor&gt;\d+)\.\d+\.(?&lt;revision&gt;\d+)</Find> <ReplaceWith>$(BUILD_NUMBER)</ReplaceWith> </RegexTransform> </ItemGroup>   <Target Name="Go" DependsOnTargets="UpdateAssemblyVersion; Build"> </Target>   <Target Name="UpdateAssemblyVersion" Condition="'$(BUILD_NUMBER)' != ''"> <RegexTransform Items="@(RegexTransform)" /> </Target>   <Target Name="Build"> <MSBuild Projects="$(SolutionRoot)\BuildVersionTest.sln" Targets="Build" /> </Target>   </Project> Reviewing this MSBuild file, we see that by default the “Go” target will be called, which in turn depends on “UpdateAssemblyVersion” and then “Build.”  We go ahead and import the Bulid.tasks file and then setup some handy properties for setting the build configuration and solution root (in this case, my build files are in the solution root, but we might want to create a Build/ directory later).  The rest of the file flows logically, we setup the RegexTransform to match version numbers such as <major>.<minor>.1.<revision> (1.2.3.4 in our example) and replace it with a $(BUILD_NUMBER) parameter which will be supplied externally.  The first target, “UpdateAssemblyVersion” just runs the RegexTransform, and the second target, “Build” just runs the default MSBuild on our solution. Testing the MSBuild file locally Now we have a build file which can replace assembly version numbers and build, so let’s setup a quick batch file to be able to build locally.  To do this you simply create a file called Build.cmd and have it call MSBuild on your Build.proj file.  I’ve added a bit more flexibility so you can specify build configuration and version number, which makes your Build.cmd look as follows: set config=%1 if "%config%" == "" ( set config=debug ) set version=%2 if "%version%" == "" ( set version=2.3.4.5 ) %WINDIR%\Microsoft.NET\Framework\v4.0.30319\msbuild Build.proj /p:Configuration="%config%" /p:build_number="%version%" .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Now if you click on the Build.cmd file, you will get a default debug build using the version 2.3.4.5.  Let’s run it in a command window with the parameters set for a release build version 2.0.1.453.   Excellent!  We can now run one simple command and govern the build configuration and version number of our entire solution.  Each DLL produced will have the same version number, making determining which version of a library you are running very simple and accurate. Configure the build server (TeamCity) Of course you are not really going to want to run a build command manually every time, and typing in incrementing version numbers will also not be ideal.  A good solution is to have a computer (or set of computers) act as a build server and build your code for you, providing you a consistent environment, excellent reporting, and much more.  One of the most popular Build Servers is JetBrains’ TeamCity, and this last section will show you the few configuration parameters to use when setting up a build using your MSBuild file created earlier.  If you are using a different build server, the same principals should apply. First, when setting up the project you want to specify the “Build Number Format,” often given in the form <major>.<minor>.<revision>.<build>.  In this case you will set major/minor manually, and optionally revision (or you can use your VCS revision number with %build.vcs.number%), and then build using the {0} wildcard.  Thus your build number format might look like this: 2.0.1.{0}.  During each build, this value will be created and passed into the $BUILD_NUMBER variable of our Build.proj file, which then uses it to decorate your assemblies with the proper version. After setting up the build number, you must choose MSBuild as the Build Runner, then provide a path to your build file (Build.proj).  After specifying your MSBuild Version (equivalent to your .NET Framework Version), you have the option to specify targets (the default being “Go”) and additional MSBuild parameters.  The one parameter that is often useful is manually setting the configuration property (/p:Configuration="Release") if you want something other than the default (which is Debug in our example).  Your resulting configuration will look something like this: [Under General Settings] [Build Runner Settings]   Now every time your build is run, a newly incremented build version number will be generated and passed to MSBuild, which will then version your assemblies and build your solution.   A Quick Review Our goal was to version our output assemblies in an automated way, and we accomplished it by performing a few quick steps: Move the common assembly information, including version, into a linked CommonAssemblyInfo.cs file Create a simple MSBuild script to replace the common assembly version number and build your solution Direct your build server to use the created MSBuild script That’s really all there is to it.  You can find all of the code from this post at https://github.com/srkirkland/BuildVersion. Enjoy!

    Read the article

  • Sage 50 Accounts 2010 wont run on windows 7

    - by admintech
    I have sucessfuly installed Sage 50 Accounts 2010 onto my 32 bit Windows 7 machine, yet whenever i try to run it i encounter - Log Name: Application Source: Application Error Date: 24/05/2010 17:14:13 Event ID: 1000 Task Category: (100) Level: Error Keywords: Classic User: N/A Computer: LukeThomas-PC.domain.co.uk Description: Faulting application name: Sage.SBD.Platform.Installation.SoftwareUpdates.UI.exe, version: 2.0.0.91, time stamp: 0x4a8c22fe Faulting module name: igdumd32.dll, version: 8.15.10.1872, time stamp: 0x4a848a05 Exception code: 0xc0000409 Fault offset: 0x00012f96 Faulting process id: 0x1778 Faulting application start time: 0x01cafb5c2493b609 Faulting application path: C:\Program Files\Common Files\Sage SBD\Sage.SBD.Platform.Installation.SoftwareUpdates.UI.exe Faulting module path: C:\Windows\system32\igdumd32.dll Report Id: 63e2246b-674f-11df-96ba-002564c97988 Event Xml: 1000 2 100 0x80000000000000 5062 Application LukeThomas-PC.domain.co.uk Sage.SBD.Platform.Installation.SoftwareUpdates.UI.exe 2.0.0.91 4a8c22fe igdumd32.dll 8.15.10.1872 4a848a05 c0000409 00012f96 1778 01cafb5c2493b609 C:\Program Files\Common Files\Sage SBD\Sage.SBD.Platform.Installation.SoftwareUpdates.UI.exe C:\Windows\system32\igdumd32.dll 63e2246b-674f-11df-96ba-002564c97988 Any help would be appreciated as i cant find anything about this error

    Read the article

  • Have I bricked my Sun V20z?

    - by David Mackintosh
    I have a small pile of Sun V20z computers. I was trying to update the SP and BIOS firmwares in order to bring them all up to the same standard -- mostly to get the updated (ie actually useful) SP functionality, and figured that I would just do the BIOS while I was at it. For three of the four computers, it worked perfectly. However after the BIOS update, the fourth system won't boot. I did this: batch05-mgmt $ sp get mounts Local Remote /mnt 10.16.0.8:/export/v20z batch05-mgmt $ platform set os state update-bios /mnt/sw_images/platform/firmware/bios/V1.35.3.2/bios.sp This command may take several minutes. Please be patient. Bios started Bios Flash Transmit Started Bios Flash Transmit Complete Bios Flash update Progress: 7 Bios Flash update Progress: 6 Bios Flash update Progress: 5 Bios Flash update Progress: 4 Bios Flash update Progress: 3 Bios Flash update Progress: 2 Bios Flash update Progress: 1 Bios Flash update complete batch05-mgmt $ platform set power state on This command may take several minutes. Please be patient. After an hour of waiting, it still won't start. The chassis powers on, but beyond the fans spinning up and the hardware POST of the drives, nothing appears to happen. So if I try to re-flash the BIOS (on the theory that maybe something went wrong): batch05-mgmt $ platform set os state update-bios /mnt/sw_images/platform/firmware/bios/V1.35.3.2/bios.sp This command may take several minutes. Please be patient. Bios started Error. The operation timed out. Have I bricked it?

    Read the article

  • Drop outs when accessing share by DFS name.

    - by Stephen Woolhead
    I have a strange problem, aren't they all! I have a DFS root \domain\files\vms, it has a single target on a different server than the namespace. I can copy a test file set from the target directly via \server\vms$\testfiles and all is well, the files copy fine. I have repeated these tests many times. If I try and copy the files from the dfs root I get big pauses in the network traffic, about 50 seconds every couple of minutes, all the traffic just stops for the copy. If I start another copy between the same two machines during this pause, it starts copying fine, so I know it's not an issue with the disks on the server. Every once in a while the copy will fail, no errors, the progress bar will just zip all the way to 100% and the copy dialog will close. Checking the target folder show that the copy is incomplete. I've moved the LUN to another server and had the same problem. The servers are all 2008 R2, the clients are Vista x64, Windows7 x64 and 2008 R2, all have the same problem. Anyone got any ideas? Cheers, Stephen More Information: I've been running a NetMon trace on the connection when the file copy fails and what seems to be standing out is that when opening a file that the copy completes on the SMB command looks like this: SMB2: C CREATE (0x5), Name=Training\PDC2008\BB34 Live Services Notifications, Awareness, and Communications.wmv@#422082, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 245376 SMB2: R CREATE (0x5), Context=MxAc, Context=RqLs, Context=DHnQ, Context=QFid, FID=0xFFFFFFFF00000015, Mid = 245376 But for the last file when the copy dialog closes looks like this: SMB2: C CREATE (0x5), Name=gt\files\Media\Training\PDC2008\BB36 FAST Building Search-Driven Portals with Microsoft Office SharePoint Server 2007 and Microsoft Silverlight.wmv@#859374, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 77 SMB2: R , Mid = 77 - NT Status: System - Error, Code = (58) STATUS_OBJECT_PATH_NOT_FOUND The main difference seems to be in the name, one is relative to the open file share, the other has gained the gt\files\media prefix which is the name of the DFS target. These failures are always preceded by logoff and back on of the SMB target. Might have to bump this one to PSS.

    Read the article

  • What's wrong with Lotus Notes / Lotus Domino?

    - by user20242
    I have a client who is using Lotus Domino for their web application/server platform. The client has two "web developers" who are more comfortable with Lotus Domino than more mainstream tools and technologies and are not enthusiastic about making a switch. I have been asked to provide an assessment of why it may be prudent to migrate to a different web application platform. I would be particularly interested in understanding deficiencies related to the platform as I have very little knowledge of Domino but am very familiar with other platforms. In addition to the fact that Apache has over 70% of web server market, IIS over 21%, and Lotus almost 0%, what other reasons would you give for moving away from this platform?

    Read the article

  • What's wrong with Lotus Notes / Lotus Domino?

    - by Anthony Gatlin
    I have a client who is using Lotus Domino for their web application/server platform. The client has two "web developers" who are more comfortable with Lotus Domino than more mainstream tools and technologies and are not enthusiastic about making a switch. I have been asked to provide an assessment of why it may be prudent to migrate to a different web application platform. I would be particularly interested in understanding deficiencies related to the platform as I have very little knowledge of Domino but am very familiar with other platforms. In addition to the fact that Apache has over 70% of web server market, IIS over 21%, and Lotus almost 0%, what other reasons would you give for moving away from this platform?

    Read the article

  • Can't install NPM after installing Node on EC2 Linux instance?

    - by frequent
    I'm trying my first attempt on getting a node server set up on an amazon ec2 linux instance. I think I made it quite far. First problem I ran into was when trying to make Node the connection timed out after a while, so I need three attempts until I got this: LINK(target) /home/ec2-user/node/out/Release/node: Finished touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_header.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_provider.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_ustack.stamp touch /home/ec2-user/node/out/Release/obj.target/node_etw.stamp make[1]: Leaving directory `/home/ec2-user/node/out' ln -fs out/Release/node node Which tells me, "Node is done", although I'm not sure it is also working as it should. Following this,this and this tutorial, I'm now stuck at installing npm. I think I first cloned into the wrong folder, which always gave me error 127, but even if I'm doing this: cd ~ git clone git://github.com/isaacs/npm.git cd npm sudo -s PATH=/usr/local/bin:$PATH make install I'm still getting this: #after cloning# make[1]: Entering directory `/root/npm' node cli.js install bash: node: command not found make[1]: *** [node_modules/.bin/ronn] Error 127 make[1]: Leaving directory `/root/npm' make: *** [man/man3/start.3] Error 2 Question:: Since I'm pretty much a newby at everything I'm trying here, can someone please tell me what I'm doing wrong and how to get npm to install? Also, in case I cloned into the wrong folder, is there a way to remove the "false clone" or is this not written to disk until I call make install and I don't need to worry? Thanks for helping out!

    Read the article

  • iptables (NAT/PAT) setup for SSH & Samba

    - by IanVaughan
    I need to access a Linux box via SSH & Samba that is hidden/connected behind another one. Setup :- A switch B C |----| |---| |----| |----| |eth0|----| |----|eth0| | | |----| |---| |eth1|----|eth1| |----| |----| Eg, SSH/Samba from A to C How does one go about this? I was thinking that it cannot be done via IP alone? Or can it? Could B say "hi on eth0, if your looking for 192.168.0.2, its here on eth1"? Is this NAT? This is a large private network, so what about if another PC has that IP?! More likely it would be PAT? A would say "hi 192.168.109.15:1234" B would say "hi on eth0, traffic for port 1234 goes on here eth1" How could that be done? And would the SSH/Samba demons see the correct packet header info and work?? IP info :- A - eth0 - 192.168.109.2 B - eth0 - B1 = 192.168.109.15 B2 = 172.24.40.130 - eth1 - 192.168.0.1 C - eth1 - 192.168.0.2 A, B & C are RHEL (RedHat) But Windows computers can be connected to the switch. I configured the 192.168.0.* IPs, they are changeable. Update after response from Eddie Few problems (and Machines' B IP is different!) From A :- ssh 172.24.40.130 works ok, (can get to B2) but ssh 172.24.40.130 -p 2022 -vv times out with :- OpenSSH_4.3p2, OpenSSL 0.9.8e-fips-rhel5 01 Jul 2008 debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug2: ssh_connect: needpriv 0 debug1: Connecting to 172.24.40.130 [172.24.40.130] port 2022. ...wait ages... debug1: connect to address 172.24.40.130 port 2022: Connection timed out ssh: connect to host 172.24.40.130 port 2022: Connection timed out From B2 :- $ service iptables status Table: filter Chain INPUT (policy ACCEPT) num target prot opt source destination Chain FORWARD (policy ACCEPT) num target prot opt source destination 1 ACCEPT tcp -- 0.0.0.0/0 192.168.0.2 tcp dpt:22 Chain OUTPUT (policy ACCEPT) num target prot opt source destination Table: nat Chain PREROUTING (policy ACCEPT) num target prot opt source destination 1 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:2022 to:192.168.0.2:22 Chain POSTROUTING (policy ACCEPT) num target prot opt source destination Chain OUTPUT (policy ACCEPT) num target prot opt source destination And ssh from B2 to C works fine :- $ ssh 192.168.0.2 Route info :- $ route Kernel IP routing table Destination Gateway Genmask Flags Metric Ref Use Iface 192.168.0.0 * 255.255.255.0 U 0 0 0 eth1 172.24.40.0 * 255.255.255.0 U 0 0 0 eth0 169.254.0.0 * 255.255.0.0 U 0 0 0 eth1 default 172.24.40.1 0.0.0.0 UG 0 0 0 eth0 $ ip route 192.168.0.0/24 dev eth1 proto kernel scope link src 192.168.0.1 172.24.40.0/24 dev eth0 proto kernel scope link src 172.24.40.130 169.254.0.0/16 dev eth1 scope link default via 172.24.40.1 dev eth0 So I just dont know why the port forward doesnt work from A to B2?

    Read the article

  • Windows computer account appears to reset its own password, why?

    - by David Yu
    Has anyone seen this where a computer account appears to reset its password? The password for user 'WEST\SQLCLUSTER$' was reset by 'WEST\SQLCLUSTER$' on 'DOMAINCONTROLLER.WEST.company.corp' at '04/23/10 20:47:41' Event Type: Success Audit Event Source: Security Event Category: Account Management Event ID: 628 Date: Friday, April 23, 2010 Time: 8:47 PM User: WEST\SQLCLUSTER$ Computer: DOMAINCONTROLLER.WEST.company.corp Description: User Account password set: Target Account Name: SQLCLUSTER$ Target Domain: WEST Target Account ID: WEST\SQLCLUSTER$ Caller User Name: SQLCLUSTER$ Caller Domain: WEST Caller Logon ID: (0x0,0x7A518945)

    Read the article

  • Resize videos with different widths to a fixed height preserving aspect ratio with ffmpeg

    - by Axarydax
    I'd like to convert a lot of video files to flash video for our company's website. I have a requirement that all of the videos must be in 360p format, so their size would be Nx360. FFMpeg uses -s argument to specify target resolution as WxH. I don't know Width, as it depends on source file aspect ratio. If source is 640x480, target will be 480x360. If source is 848x480, target will be 636x360. Is there a way to do it with some switch of ffmpeg? That it will preserve aspect ratio and I'll only specify the height of target video? I could easily solve it by making a program that will launch ffprobe to get source video size, calculate aspect ratio and then calculate a new width.

    Read the article

  • Variable directory names over SCP

    - by nedm
    We have a backup routine that previously ran from one disk to another on the same server, but have recently moved the source data to a remote server and are trying to replicate the job via scp. We need to run the script on the target server, and we've set up key-based scp (no username/password required) between the two servers. Using scp to copy specific files and directories works perfectly: scp -r -p -B [email protected]:/mnt/disk1/bsource/filename.txt /mnt/disk2/btarget/ However, our previous routine iterates through directories on the source disk to determine which files to copy, then runs them individually through gpg encryption. Is there any way to do this only by using scp? Again, this script needs to run from the target server, and the user the job runs under only has scp (no ssh) access to the target system. The old job would look something like this: #Change to source dir cd /mnt/disk1 #Create variable to store # directories named by date YYYYMMDD j="20000101/" #Iterate though directories in the current dir # to get the most recent folder name for i in $(ls -d */); do if [ "$j" \< "$i" ]; then j=${i%/*} fi done #Encrypt individual files from $j to target directory cd ./${j%%}/bsource/ for k in $(ls -p | grep -v /$); do sudo /usr/bin/gpg -e -r "Backup Key" --batch --no-tty -o "/mnt/disk2/btarget/$k.gpg" "$/mnt/disk1/$j/bsource/$k" done Can anyone suggest how to do this via scp from the target system? Thanks in advance.

    Read the article

  • Security log overflowing with filtering blocks

    - by Jacob
    I have a Windows 7 workstation whose security log is overflowing with the following errors: Audit Failure 3/31/2010 2:00:50 PM Microsoft-Windows-Security-Auditing 5157 Filtering Platform Connection "The Windows Filtering Platform has blocked a connection." Audit Failure 3/31/2010 2:00:50 PM Microsoft-Windows-Security-Auditing 5152 Filtering Platform Packet Drop "The Windows Filtering Platform has blocked a packet." These are not unexpected events; the firewall is expected to drop unsolicited traffic. However, I can't figure out how to tell Windows to stop writing these events to the security log. I've seen this problem before and have been able to find an answer with the use of Google, but I wasn't able to locate on this this time. Thanks!

    Read the article

< Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >