Search Results

Search found 42218 results on 1689 pages for 'os version'.

Page 790/1689 | < Previous Page | 786 787 788 789 790 791 792 793 794 795 796 797  | Next Page >

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • XSLT - Comparing preceding-sibling's elements with current's node element

    - by siondream
    Hello, I have this XML file: <recursos> <recurso url="http://w3c.com"> <descripcion>Consorcio W3C</descripcion> <tipo>externo</tipo> <idioma>ingles</idioma> <contenido>General</contenido> <unidad>Unidad 2</unidad> </recurso> <recurso url="http://html.com"> <descripcion>Especificación HTML</descripcion> <tipo>externo</tipo> <idioma>castellano</idioma> <contenido>HTML</contenido> <version>4.01</version> <unidad>Unidad 3</unidad> </recurso> </recursos> I want to compare one "recurso"'s preceding sibling element "unidad" with the "unidad" of the current "recurso" to check if they're different. I was trying: <xsl:if test="preceding-sibling::recurso[position()=1]::unidad != unidad"> </xsl:if> But I know it's horribly wrong :( I hope you could help me, thank you very much.

    Read the article

  • Casting Type array to Generic array?

    - by George R
    The short version of the question - why can't I do this? I'm restricted to .NET 3.5. T[] genericArray; // Obviously T should be float! genericArray = new T[3]{ 1.0f, 2.0f, 0.0f }; // Can't do this either, why the hell not genericArray = new float[3]{ 1.0f, 2.0f, 0.0f }; Longer version - I'm working with the Unity engine here, although that's not important. What is - I'm trying to throw conversion between its fixed Vector2 (2 floats) and Vector3 (3 floats) and my generic Vector< class. I can't cast types directly to a generic array. using UnityEngine; public struct Vector { private readonly T[] _axes; #region Constructors public Vector(int axisCount) { this._axes = new T[axisCount]; } public Vector(T x, T y) { this._axes = new T[2] { x, y }; } public Vector(T x, T y, T z) { this._axes = new T[3]{x, y, z}; } public Vector(Vector2 vector2) { // This doesn't work this._axes = new T[2] { vector2.x, vector2.y }; } public Vector(Vector3 vector3) { // Nor does this this._axes = new T[3] { vector3.x, vector3.y, vector3.z }; } #endregion #region Properties public T this[int i] { get { return _axes[i]; } set { _axes[i] = value; } } public T X { get { return _axes[0];} set { _axes[0] = value; } } public T Y { get { return _axes[1]; } set { _axes[1] = value; } } public T Z { get { return this._axes.Length (Vector2 vector2) { Vector vector = new Vector(vector2); return vector; } public static explicit operator Vector(Vector3 vector3) { Vector vector = new Vector(vector3); return vector; } #endregion }

    Read the article

  • Git rebase and semi-tracked per-developer config files.

    - by dougkiwi
    This is my first SO question and I'm new-ish to Git as well. Background: I am supposed to be the version control guru for Git in my group of about 8 developers. As I don't have a lot of Git experience, this is exciting. I decided we need a shared repository that would be the authoritative master for the production code and the main meeting-point for the development code. As we work for a corporation, we really do need to show an authoritive source for the production code at least. I have instructed the developers to pull-rebase when pulling from the shared repository, then push the commits that they want to share. We have been running into problems with a particular type of file. One of these files, which I currently assume is typical of the problem, is called web.config. We want a version-controlled master web.config for devs to clone, but each dev may make minor edits to this file that they wish to locally save but not share. The problem is this: how do I tell git not to consider local changes or commits to this file to be relevent for rebasing and pushing? Gitignore does not seem to solve the problem, but maybe that's because I put web.config into .gitignore too late? In some simple situations we have stacked local changes, rebased, pushed, and popped the stack, but that doesn't seem to work all of the time. I haven't picked up the pattern quite yet. The published documentation on pull --rebase tends to deal with simplier situations. Or do I have the wrong idea entirely? Are we misusing Git? Dougkiwi

    Read the article

  • Highlighting Changes in Java

    - by Buzz Lightyear
    Basically, i have done my program so that it will display differences in strings and display the whole line. I want to highlight (in a colour) the differences in the line. Example: Original at line 5 <rect x="60.01" width="855.38" id="rect_1" y="-244.35" height="641.13" style="stroke-width: 1; stroke: rgb(0, 0, 0); fill: none; "/> Edited at line 5 <rect x="298.43" width="340.00" y="131.12" height="380.00" id="rect_1" style="stroke-width: 1; stroke: rgb(0, 0, 0); fill: rgb(255, 102, 0); "/> In this example, the width is different from the 'original' from the 'edited' version. I would like to be able to highlight that difference and any other difference. My code so far: Patch patch = DiffUtils.diff(centralFile, remoteFile); StringBuffer resultsBuff = new StringBuffer(remoteFileData.length); for (Delta delta : patch.getDeltas()) { resultsBuff.append("Original at line " + delta.getOriginal().getPosition() + "\n"); for (Object line : delta.getOriginal().getLines()) { resultsBuff.append(" " + line + "\n"); } resultsBuff.append("Edited at line " + delta.getRevised().getPosition() + "\n"); for (Object line : delta.getRevised().getLines()) { resultsBuff.append(" " + line + "\n"); } resultsBuff.append("\n"); } return resultsBuff.toString(); } That will display two whole lines like the example before (the original and the edited version) I want to be able to highlight the changes that have actually been made, is there any way to do this in Java?

    Read the article

  • How to update to jersey 2.X on an app using jersey 1.1X?

    - by Maxrunner
    i recently faced a problem with the handling of exceptions using jersey. In this case it was that the exceptions thrown from Exception mapper are not re thrown to the underlaying container, i searched and found that this has been fixed in the 2.0 version. But i'm using jersey 1.10 and the 2.X dependencies are all different and its also maven based. Since this project is not using maven, how do i use the more recent version?In the 2.X versions there are no jackson json jars for example. So i'm having some doubts in how to upgrade. Here's my web.xml config entry for jerse <servlet> <servlet-name>Jersey REST Service</servlet-name> <servlet-class>com.sun.jersey.spi.container.servlet.ServletContainer</servlet-class> <init-param> <param-name>com.sun.jersey.config.property.packages</param-name> <param-value>com.mobile.rest.resources</param-value> </init-param> <init-param> <param-name>com.sun.jersey.api.json.POJOMappingFeature</param-name> <param-value>true</param-value> </init-param> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Jersey REST Service</servlet-name> <url-pattern>/rest/*</url-pattern> </servlet-mapping> regards,

    Read the article

  • cython setup.py gives .o instead of .dll

    - by alok1974
    Hi, I am a newbie to cython, so pardon me if I am missing something obvious here. I am trying to build c extensions to be used in python for enhanced performance. I have fc.py module with a bunch of function and trying to generate a .dll through cython using dsutils and running on win64: c:\python26\python c:\cythontest\setup.py build_ext --inplace I have the dsutils.cfg in C:\Python26\Lib\distutils. As required the disutils.cfg has the following config settings: [build] compiler = mingw32 My startup.py looks like this: from distutils.core import setup from distutils.extension import Extension from Cython.Distutils import build_ext ext_modules = [Extension('fc', [r'C:\cythonTest\fc.pyx'])] setup( name = 'FC Extensions', cmdclass = {'build_ext': build_ext}, ext_modules = ext_modules ) I have latest version mingw for target/host amdwin64 type builds. I have the latest version of cython for python26 for win64. Cython does give me an fc.c without errors, only a few warning for type conversions, which I will handle once I have it right. Further it produces fc.def an fc.o files Instead of giving a .dll. I get no errors. I find on threads that it will create the .so or .dll automatically as required, which is not happening.

    Read the article

  • How do I get require_login()-like functionality using the new PHP Client Library for Facebook?

    - by cc
    Howdy. I've been tasked with making a Facebook game, but I'm new to Facebook development, so I'm just getting started. Apologies in advance if this is a no-brainer to people. I'm having trouble following all the examples I see on sites, and I keep running into missing pages in the Facebook documentation when I am trying to read up. I think it's because there's a new version of the PHP Client Library for Facebook, and everything I'm finding is referring to the old client. For instance, I see this code in a lot of examples: require 'facebook.php'; $facebook = new Facebook( array( 'appId' => '(id)', 'secret' => '(secret)' ) ); $facebook_account = $facebook->require_login(); ...but there's no "require_login()" in the client library provided in the facebook.php file. From what I can tell, it looks like Facebook has very recently rolled out some new system for development, but I don't see any sample code anywhere to deal with it. The new library comes with an "example.php" file, but it appears to be only for adding "Log in with Facebook" functionality to other sites (what I'm assuming is what they mean by "Facebook Connect" sites), not for just running apps in a Canvas page on Facebook itself. Specifically, what I need to do is let users visit an application page within Facebook, have it bring up the dialog box allowing them to authorize the app, have it show up in their "games" page, and then have it pass me the relevant info about the user so I can start creating the game. But I can't seem to find any tutorials or examples that show how to do this using the new library. Seems like this should be pretty straightforward, but I'm running into roadblocks. Or am I missing something about the PHP client library? Should require_login() be working for me, and there's something broken with my implementation, such as having the wrong client library or something? I downloaded from GitHub yesterday, so I'm pretty sure I have the most recent version of the code I have, but perhaps I'm downloading the wrong "facebook.php" file...?

    Read the article

  • Invalid Argument javascript error only on certain computers

    - by Jen
    Getting an error whenever we click a particular button/link on our site. It is generating a javascript "Invalid Argument" error. I know in the other posts it is typically because it is a syntax error in the javascript however it only just seems to have started happening and it doesn't happen on all pcs. ie. in our client's environment if I remote onto their web server and view the uat website I get the javascript error. If I remote onto their sql server and view the uat website I don't get the javascript error. If it was a syntax error then I would always get the error wouldn't I? both browsers are the same version of IE6 (yeah I know...) :) I have tried deleting temporary internet files - including viewing the files and deleting them myself - but no joy. client uses citrix.. and they're all getting the error :( Any ideas would be appreciated - Thanks! :) Update - Sorry I haven't posted specific code as there is too much to post (and I'm not sure where the error is occurring). The "button" launches a new window which in turn opens up a couple of aspx pages and calls lots of javascript. So the window opens ok, and there's a function that gets called to resize the window - but before it calls the resizing of the window/content it throws the invalid argument error. Am busy trying to get alerts to trigger to see if I can see where it's falling over but so far no luck. Again not sure why this error doesn't occur when I use a particular PC (same browser version)

    Read the article

  • WCF service not working after program update

    - by Boesj
    I have recently added a WCF service reference to my program. When I perform a clean install of this program, everything seems to work as expected. But, when I install the program on a client which already has a previous version (without the new service reference) installed, I get a exception telling me the default endpoint for this particular service could not be found. It seems that the appname.exe.config is not being updated with the new endpoint settings. Is there any reason for this and how can I force the installer to overwrite the config file? I'm using the default Visual Studio 2008 installer project with RemovePreviousVersions set to True. Update: My program encrypts the settings section after the first run with the following code Configuration config = ConfigurationManager.OpenExeConfiguration(ConfigurationUserLevel.None); ConfigurationSection section = config.GetSection(sectionKey); if (section != null) { if (!section.SectionInformation.IsProtected) { if (!section.ElementInformation.IsLocked) { section.SectionInformation.ProtectSection("DataProtectionConfigurationProvider"); section.SectionInformation.ForceSave = true; config.Save(ConfigurationSaveMode.Full); } } } When I do not run the program before installing the new version the app.config gets updated.

    Read the article

  • Drupal view filter to show only one of a certain item

    - by Joel
    I'm fairly new to Drupal, and am using Node Import to take a TSV file and turn it into nodes. I'm hitting a problem, though, with automating updates to the nodes. Again, I'd like to take a Tab Separated Values text file, and load it into my site via Node Import (or whatever else anyone might suggest) and then only show updated Nodes. Here's a specific example: I have a Node with the following info: StoreId Name Address Phone Contact 01 Name1 Address1 Phone1 Contact1 02 Name2 Address2 Phone2 Contact2 etc. The info pulls into the nodes just fine (Thank you Node Import!), but we also want to process updates to the nodes. So far I have two ideas... figure out how to delete duplicate (previous) instances of the same StoreID, or just save the node with the duplicate StoreID (and new other info) and just display the most current version. In Views, I can get it to show the nodes and everything, but I can't figure out how to only display the most recent version of each StoreID. A view of views would work, but I can't seem to get that to work, either. Any ideas or other approaches I could take? Thanks in advance for the help!

    Read the article

  • CXF code first service, WSDL generation; soap:address changes?

    - by jcalvert
    I have a simple Java interface/implementation I am exposing via CXF. I have a jaxws element in my Spring configuration file like this: <jaxws:endpoint id="managementServiceJaxws" implementor="#managementService" address="/jaxws/ManagementService" > </jaxws:endpoint> It generates the WSDL from my annotated interface and exposes the service. Then when I hit http://myhostname/cxf/jaxws/ManagementService?wsdl I get a lovely WSDL. At the bottom in the wsdl:service element, I'll see <soap:address location="http://myhostname/cxf/jaxws/ManagementService"/> However, some time a day or so later, with no application restart, hitting that same url produces: This causes a number of problems, but what I really want is to fix it. Right now, there's a particular client to the webservice that sets the endpoint to localhost; because it runs on the same machine. Is it possible the wsdl is getting regenerated and cached and then exposing the 'localhost' version? In part I don't know the exact mechanism by which one goes from a ?wsdl request in CXF to the response. It seems almost certain that it's retrieving some cached version, given that it's supposed to be determining the address by asking the servletcontainer (Jetty). For reference I know a stopgap solution is using the hostname on the client and making sure an alias in place so that it goes over the loopback. EDIT: For reference, I confirmed that if I bring my application up and first hit it over localhost, then querying for the wsdl via the hostname shows the address as localhost. Conversely, first hitting it over the hostname causes localhost requests to show the hostname. So obviously something is getting cached here.

    Read the article

  • Should TcpClient be used for this scenario?

    - by Martín Marconcini
    I have to communicate with an iPhone. I have its IP Address and the port (obtained via Bonjour). I need to send a header that is “0x50544833” (or similar, It’s an HEX number), then the size of the data (below) and then the data itself. The data is just a string that looks like this: <?xml version="1.0" encoding="utf-8"?> <!DOCTYPE plist SYSTEM "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>clientName</key> <string>XXX</string> <key>clientService</key> <string>0be397e7-21f4-4d3c-89d0-cdf179a7e14d</string> <key>registerCode</key> <string>0000</string> </dict> </plist> The requirement also says that I must send the data in little endian format (which I think is the default for Intel anyway). So it would be: hex_number + size of data + string_with_the_above_xml. I need to send that to the iPhone and read the response. What would be, according to your experience, the best way to send this data (and read the response)?

    Read the article

  • Subversion freaking out on me!

    - by Malfist
    I have two copies of a site, one is the production copy, and the other is the development copy. I recently added everything in the production to a subversion repository hosted on our linux backup server. I created a tag of the current version and I was done. I then copied the development copy overtop of the production copy (on my local machine where I have everything checked out). There are only 10-20 files changed, however, when I use tortoise SVN to do a commit, it says every file has changed. The diff file generated shows subversion removing everything, and replacing it with the new version (which is the exact same). What is going on? How do I fix it? An example diff: Index: C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html =================================================================== --- C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (revision 5) +++ C:/Users/jhollon/Documents/Visual Studio 2008/Projects/saloon/trunk/components/index.html (working copy) @@ -1,4 +1,4 @@ -<html> -<body bgcolor="#FFFFFF"> -</body> +<html> +<body bgcolor="#FFFFFF"> +</body> </html> \ No newline at end of file

    Read the article

  • C++ : integer constant is too large for its type

    - by user38586
    I need to bruteforce a year for an exercise. The compiler keep throwing this error: bruteforceJS12.cpp:8:28: warning: integer constant is too large for its type [enabled by default] My code is: #include <iostream> using namespace std; int main(){ unsigned long long year(0); unsigned long long result(318338237039211050000); unsigned long long pass(1337); while (pass != result) { for (unsigned long long i = 1; i<= year; i++) { pass += year * i * year; } cout << "pass not cracked with year = " << year << endl; ++year; } cout << "pass cracked with year = " << year << endl; } Note that I already tried with unsigned long long result(318338237039211050000ULL); I'm using gcc version 4.8.1 EDIT: Here is the corrected version using InfInt library http://code.google.com/p/infint/ #include <iostream> #include "InfInt.h" using namespace std; int main(){ InfInt year = "113"; InfInt result = "318338237039211050000"; InfInt pass= "1337"; while (pass != result) { for (InfInt i = 1; i<= year; i++) { pass += year * i * year; } cout << "year = " << year << " pass = " << pass << endl; ++year; } cout << "pass cracked with year = " << year << endl; }

    Read the article

  • Java applet wont run

    - by Courtney
    I am trying to get a Java applet to run properly when linked to an HTML page in Dreamweaver CC. I'm new to all this so please bear with me here. First I saved this code to a .java file //Triangle.java import java.awt.*; import java.applet.Applet; public class Triangle extends Applet { public void paint (Graphics g){ int bottomX=80; int bottomY=200; int base=100; int height=100; g.drawLine(bottomX,bottomY,bottomX+base,bottomY); g.drawLine(bottomX+base,bottomY,bottomX+base/2,bottomY-height); g.drawLine(bottomX+base/2,bottomY-height, bottomX,bottomY); } } I then compiled it entering javac Triangle.java After that, I inserted it into a Dreamwever page using: <html> <applet code=Triangle.class width=400 height=400 > </applet> </html> Now when I try and open the page in Chrome I get an error reading: UnsupportedClassVersionError Triangle: Unsupported major.minor version 52.0 This, as I have read, is an issue with using two incompatible Java versions? In my Java Control Panel it says I am using version 1.8.0_20 and my JDK is jdk1.8.0_20. Does anyone see anything super obvious that I am doing wrong here?

    Read the article

  • RMagick transparent_color deprecated? What's the alternative?

    - by user315975
    I'm developing an app that does a fair amount of generating transparent pngs on the fly. These are used as overlays, to show areas of interest in a graphic, so they have to have transparent backgrounds. I am developing in Ruby on Rails, deploying on Heroku. What works fine in development is not working in production. I get this error when I call a drawing routine using RMagick: NotImplementedError (the `transparent_color=' method is not supported by ImageMagick 6.2.4): /usr/local/lib/ruby/gems/1.8/gems/rmagick-1.15.17/lib/RMagick.rb:1691:in `transparent_color=' I'm using RMagick version 2.12.1 on the development machine, but I'm not exactly certain how to discover the version of ImageMagick that it's running, so I'm not sure if this is a case of my local code being behind or ahead. I'm hoping behind, because perhaps then there'll be a replacement for this call. Does anyone know what the fix is here? What's required to generate a transparent background, if not the call I'm using? I can't find this in the documentation: in fact, it was on a third-party site that I found mention of this capability.

    Read the article

  • Can anyone explain this strange behaviour?

    - by partizan
    Hi, guys. Here is the example with comments: class Program { // first version of structure public struct D1 { public double d; public int f; } // during some changes in code then we got D2 from D1 // Field f type became double while it was int before public struct D2 { public double d; public double f; } static void Main(string[] args) { // Scenario with the first version D1 a = new D1(); D1 b = new D1(); a.f = b.f = 1; a.d = 0.0; b.d = -0.0; bool r1 = a.Equals(b); // gives true, all is ok // The same scenario with the new one D2 c = new D2(); D2 d = new D2(); c.f = d.f = 1; c.d = 0.0; d.d = -0.0; bool r2 = c.Equals(d); // false! this is not the expected result } } So, what do you think about this?

    Read the article

  • select nodes from a line of xml code with sql

    - by wondergoat77
    I have a table that stores a huge line/entire document of xml like this: <?xml version="1.0" encoding="utf-16"?> <RealQuestResponse xmlns:xsi="http://www.w3.org /2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <Success>true</Success> <Subject> <AmbiguousMatches /> <Assessment> <LandValue>0</LandValue> <ImprovementsValue>0</ImprovementsValue> <TotalValue>0</TotalValue> </Assessment> <RecentSales /> <Warnings> <Score>0</Score> <TrusteesDeedRatio>0</Tr........etc Is there a way to pull any of these fields out of the xml? it is stored in a column in a table called AutomatedRequests That table looks like this: requestid Provider Date Success Response 1 test 1/2/2012 Y <?xml version..... <---this is the xml code stored> Ive seen a couple ways but nothing like this Id basically like something like select xmlnode1, xmlnode2, xmlnode3 from automatedrequests have tried this but not working: select xml.query('RealQuestResponse/Bedrooms/*') from automatedRequests where orderid = 1266162

    Read the article

  • How to provide i18n service for developer and end user

    - by user247245
    Many android applications have quite poor i18n-support, and for an understandable reason, as it adds much work for the developer. From a both intuitive and cultural point of view it would be a good thing if end-users could translate the apps themself, and OTA share the translation, without reinstalling the app itself. In concept; as wikipedia, some add content easily, others only use what's there. It's of course important that the service is as easy as possible to use, both for app-developers, and people willing to transcribe. To keep it simple, this is the solution I'm concidering; Developer perspective: Developer uses a customized setContentView when open activities/layouts that will seach for thanslations of xml-entries. (below) The customized version is provided as a free downloadable library/class..., turning the i18n feature to more or less a one liner. User perspective: User downloads app without any translation As app launches, it checks locale running at phone, and will look for a translated xml-file at shared space in SD. If no or old transcribed xml (above), try to download new from internet-service (ansync). This is all done by library above, no need for intents. Translator perspective: Separate app to provide translations for any app using the i18n service above. (Could be just a webapp), with some form of QA on translators/input. QUESTION: Now, for this to work efficiently, it has to be AeasyAP for the developer to even bother, and the most fluent solution would be a customized version of setContentView, that simply loads the translated values from external xml, instead of the ones in the apk. Is this possible at all, and if not, what's your suggested solutions? (And of course, Happy New Year, feliz ano novo, blwyddyn newydd dda, Gott Nytt År, kontan ane nouvo, szczesliwego nowego roku ...) Regards, /T

    Read the article

  • Cannot create a new VS data connection in Server Explorer

    - by Seventh Element
    I have a local instance of SQL Server 2008 express edition running on my development PC. I'm trying to create a new data connection through Visual Studio Server Explorer. The steps are the following: Right click the "Data Connections" node = Choose Data Source. I select "Microsoft SQL Server" as the data source. The "Add Connection" dialog window appears. I select my local server instance = "Test connection" works fine. I select "AdventureWorks" as the database name = "Test connection" works fine. Next I hit the "Ok" button = Error message: "This server version is not supported. Only servers up to MS SQL Server 2005 are supported." I'm using Visual Studio 2008 Professional Edition. The target framework of the application is ".NET framework 3.5". I have a reference to System.Data (framework v2.0) and cannot find another version of the assembly on my system. Am I referencing the wrong assembly? How can I fix this problem?

    Read the article

  • Cannot display converted value inside xml field

    - by zurna
    PS: My bad, there was not an error. I forgot to upload the latest version to the server... I have multimedias and images table. I save images in multimedias table with their images table id numbers. Then whenever I need image's url, with a simple function I get it from images table. The problem I am having is when I try to display image's url inside ImageURL, it just does not happen. This is very annoying. xml output <?xml version='1.0' encoding='windows-1254' ?> <rows><row id='1'> <MultimediaTitle>Hagi Goals</MultimediaTitle> /FLPM/media/images/5Y2K4T5V_sm.jpg <ImageURL><![CDATA[]]></ImageURL> <Videos> <VideoID id='1'><VideoURL>/FLPM/media/videos/0H7T9C0F.flv</VideoURL></VideoID> <VideoID id='2'><VideoURL>/FLPM/media/videos/9L6X9G9J.flv</VideoURL></VideoID> </Videos> </row> </rows>

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Converting string to a simple type

    - by zespri
    .Net framework contains a great class named Convert that allows conversion between simple types, DateTime type and String type. Also the class support conversion of the types implementing IConvertible interface. The class has been implemented in the very first version of .Net framework. There were a few things in the first .Net framework that were not done quite right. For example .Parse methods on simple types would throw an exception if the string couldn't be parsed and there would be no way to check if exception is going to be thrown in advance. A future version of .Net Framework removed this deficiency by introducing the TryParse method that resolved this problem. The Convert class dates back to time of the old Parse method, so the ChangeType method on this class in implemented old style - if conversion can't be performed an exception is thrown. Take a look at the following code: public static T ConvertString<T>(string s, T @default) { try { return (T)Convert.ChangeType(s, typeof(T), CultureInfo.InvariantCulture); } catch (Exception) { return @default; } } This code basically does what I want. However I would pretty much like to avoid the ugly try/catch here. I'm sure, that similar to TryParse, there is a modern method of rewriting this code without the catch-all. Could you suggest one?

    Read the article

  • How Best to Replace Ugly Queries and Dynamic PL/SQL with C#?

    - by Mike
    Hi, I write a lot of one-off Oracle SQL queries (in Toad), and sometimes they can get complex, involving lots of unions, joins, and subqueries, and sometimes requiring dynamic SQL. That is, sometimes SQL queries require set based processing along with significant procedural processing. This is what PL/SQL is custom made for, but as a language it does not begin to compare to C#. Now and then I convert a PL/SQL procedure to C#, and am always amazed at how much cleaner and easier to both read and write the C# version is. The C# program might for example construct a SQL query string piece by piece and/or run several queries and process them as needed. The C# version is usually much faster as well, which must mean that I'm not very good at PL/SQL either. I do not currently have access to LINQ. My question is, how best to package all these little C# programs, which are really just mini reports, that is, replacements for ugly SQL queries? Right now I'm actually using NUnit to hold them, and calling each report a [Test], even though they aren't really tests. NUnit just happens to provide a convenient packaging framework.

    Read the article

< Previous Page | 786 787 788 789 790 791 792 793 794 795 796 797  | Next Page >