Search Results

Search found 431 results on 18 pages for 'jeffrey vincent'.

Page 8/18 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • Update JQuery Progressbar with JSON Response in an ajax Request

    - by Vincent
    All, I have an AJAX request, which makes a JSON request to a server, to get the sync status. The JSON Request and responses are as under: I want to display a JQuery UI progressbar and update the progressbar status, as per the percentage returned in the getStatus JSON response. If the status is "insync", then the progressbar should not appear and a message should be displayed instead. Ex: "Server is in Sync". How can I do this? //JSON Request to getStatus { "header": { "type": "request" }, "payload": [ { "data": null, "header": { "action": "load", } } ] } //JSON Response of getStatus (When status not 100%) { "header": { "type": "response", "result": 400 }, "payload": [ { "header": { "result": 400 }, "data": { "status": "pending", "percent": 20 } } ] } //JSON Response of getStatus (When percent is 100%) { "header": { "type": "response", "result": 400 }, "payload": [ { "header": { "result": 400 }, "data": { "status": "insync" } } ] }

    Read the article

  • PHP 5.3 SOAP deprecated errors

    - by Vincent
    All, I am using PHP 5.3.1 under Ubuntu and using the SOAP package. I am getting the following errors when I include SOAP/Client.php. Any one knows how to get this working? Thanks Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/SOAP/WSDL.php on line 214 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/SOAP/WSDL.php on line 791 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/SOAP/WSDL.php on line 1159 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/SOAP/WSDL.php on line 1685 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/HTTP/Request.php on line 228 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/HTTP/Request.php on line 324 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/HTTP/Request.php on line 602 Deprecated: Assigning the return value of new by reference is deprecated in /opt/lampp/lib/php/HTTP/Request.php on line 621 Strict Standards: Redefining already defined constructor for class Net_URL in /opt/lampp/lib/php/Net/URL.php on line 122

    Read the article

  • Android: Dialog themed activity not visible

    - by Vincent
    I have an activity which, when started, needs to check if the user is authenticated. If not, I need to display an interface to authenticate. I do this with another activity, which has a dialog theme, and I start it in onResume() with flags NO_HISTORY and EXCLUDE_FROM_RECENTS. Everything works fine when starting the application for the first time. But I have a feature that resets login after some time, if the user is not in an activity. When I test this, I start the applicatio, enter the password, then move back to home. Then when I enter the application again, the background darkens as if the dialog would show, but it doesn't. At this point, if I press the back button, the darkening from the background activity disappears for a second, then the dialog finally appears. I used logcat to investigate the case, and the activity lifecycle functions get called properly: //For the first start: onCreate background activity onStart background activity onResume background activity onPause background activity onCreate dialog onStart dialog onResume dialog //Enter password onPause dialog onResume background activity onStop dialog onDestroy dialog //navigating to homescreen onPause background activity onStop background activity //starting again onRestart background activity onStart background activity onResume background activity onPause background activity onCreate dialog onStart dialog onResume dialog //no dialog shown, only darkened background activity recieving no input //pressing back button onPause dialog onResume background activity onPause background activity onCreate NEW dialog onStart NEW dialog onResume NEW dialog onStop OLD dialog onDestroy OLD dialog //now the dialog is properly shown //entering password onPause NEW dialog onResume background activity onStop NEW dialog onDestroy NEW dialog Using the SINGLE_TOP flag makes no change. However, if I remove the dialog theme from the dialog activity, it IS shown after the restart. So far I didn't want to use a Dialog instead of an Activity, because I consider them problematic sometimes and less encapsulated and this part has to be quite secure. You may be able to convince me though.. Thank you in advance!

    Read the article

  • Using Zend_HTTP_Client instead of CURL

    - by Vincent
    All, I want to use Zend_HTTP_CLient instead of CURL as there are issues with using curl on Solaris. I have the following curl code.. How will this code be written if I want to use Zend_HTTP_Client? $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } Thanks

    Read the article

  • Emulating old-school sprite flickering (theory and concept)

    - by Jeffrey Kern
    I'm trying to develop an oldschool NES-style video game, with sprite flickering and graphical slowdown. I've been thinking of what type of logic I should use to enable such effects. I have to consider the following restrictions if I want to go old-school NES style: No more than 64 sprites on the screen at a time No more than 8 sprites per scanline, or for each line on the Y axis If there is too much action going on the screen, the system freezes the image for a frame to let the processor catch up with the action From what I've read up, if there were more than 64 sprites on the screen, the developer would only draw high-priority sprites while ignoring low-priority ones. They could also alternate, drawing each even numbered sprite on opposite frames from odd numbered ones. The scanline issue is interesting. From my testing, it is impossible to get good speed on the XBOX 360 XNA framework by drawing sprites pixel-by-pixel, like the NES did. This is why in old-school games, if there were too many sprites on a single line, some would appear if they were cut in half. For all purposes for this project, I'm making scanlines be 8 pixels tall, and grouping the sprites together per scanline by their Y positioning. So, dumbed down I need to come up with a solution that.... 64 sprites on screen at once 8 sprites per 'scanline' Can draw sprites based on priority Can alternate between sprites per frame Emulate slowdown Here is my current theory First and foremost, a fundamental idea I came up with is addressing sprite priority. Assuming values between 0-255 (0 being low), I can assign sprites priority levels, for instance: 0 to 63 being low 63 to 127 being medium 128 to 191 being high 192 to 255 being maximum Within my data files, I can assign each sprite to be a certain priority. When the parent object is created, the sprite would randomly get assigned a number between its designated range. I would then draw sprites in order from high to low, with the end goal of drawing every sprite. Now, when a sprite gets drawn in a frame, I would then randomly generate it a new priority value within its initial priority level. However, if a sprite doesn't get drawn in a frame, I could add 32 to its current priority. For example, if the system can only draw sprites down to a priority level of 135, a sprite with an initial priority of 45 could then be drawn after 3 frames of not being drawn (45+32+32+32=141) This would, in theory, allow sprites to alternate frames, allow priority levels, and limit sprites to 64 per screen. Now, the interesting question is how do I limit sprites to only 8 per scanline? I'm thinking that if I'm sorting the sprites high-priority to low-priority, iterate through the loop until I've hit 64 sprites drawn. However, I shouldn't just take the first 64 sprites in the list. Before drawing each sprite, I could check to see how many sprites were drawn in it's respective scanline via counter variables . For example: Y-values between 0 to 7 belong to Scanline 0, scanlineCount[0] = 0 Y-values between 8 to 15 belong to Scanline 1, scanlineCount[1] = 0 etc. I could reset the values per scanline for every frame drawn. While going down the sprite list, add 1 to the scanline's respective counter if a sprite gets drawn in that scanline. If it equals 8, don't draw that sprite and go to the sprite with the next lowest priority. SLOWDOWN The last thing I need to do is emulate slowdown. My initial idea was that if I'm drawing 64 sprites per frame and there's still more sprites that need to be drawn, I could pause the rendering by 16ms or so. However, in the NES games I've played, sometimes there's slowdown if there's not any sprite flickering going on whereas the game moves beautifully even if there is some sprite flickering. Perhaps give a value to each object that uses sprites on the screen (like the priority values above), and if the combined values of all objects w/ sprites surpass a threshold, introduce the sprite flickering? IN CONCLUSION... Does everything I wrote actually sound legitimate and could work, or is it a pipe dream? What improvements can you all possibly think with this game programming theory of mine?

    Read the article

  • PHP Browser Detection and Redirection

    - by Vincent
    All, My application supports IE7+, MOZILLA and other modern browsers. Anybody know of a very good browser detection and redirection PHP class? I came across this, but I am not sure if anybody used this: http://chrisschuld.com/projects/browser-php-detecting-a-users-browser-from-php/#typicalusage Thanks

    Read the article

  • jQuery and Firebug

    - by Jeffrey Karbowski
    I am using jQuery's cycle plugin, and found that I can call up the default for "speed" by typing this into Firebug's console: $.fn.cycle.defaults.speed 1000 I would like to know how to call up the override I have for speed: $('.xxx').cycle({ speed: 1700 }); If you have the answer, please let me know the steps taken to figure it out so I can understand Firebug better. Thanks a bunch!

    Read the article

  • Double-byte characters in querystring using PHP

    - by Jeffrey Berthiaume
    I'm trying to figure out how to create personalized urls for double-byte languages. For example, this url from Amazon Japan has Japanese characters within the querystring (specifically, the path): http://www.amazon.co.jp/????????-DVD-???/dp/B00005R5J3/ref=sr_1_3?ie=UTF8&s=dvd&qid=1269891925&sr=8-3 What I would like to do is have: http://www.mysite.com/???????? or even http://www.mysite.com/index.php?name=???????? be able to properly decode the $GET[name] string. I think I have tried all of the urldecode and utf8_decode possibilities, but I just get gibberish in response. This all works fine in a form $_POST, but I need these urls to be emailable...

    Read the article

  • Zend DB MYSQL Wrapper

    - by Vincent
    All, I have a PHP application written in Zend Framework with MVC style. I plan to use Zend_DB to connect to the MySQL database and process queries. I am looking for a wrapper class which makes it easy to use Zend_DB class. This wrapper class will have a constructor that connects to the Mysql db using Zend_DB. It will also have a method to return a singleton instance for each and every db connection made. Something like: $pptDB = PPTDB::getInstance(); $pptDB->setFetchMode(PPTDB::FETCH_OBJ); $result = $pptDB->fetchRow('SELECT * FROM bugs WHERE bug_id = 2'); echo $result->bug_description; Where class PPTDB extends Zend_DB Is this something feasible to have? If not, how ls would you use Zend_DB in a major application? Thanks,

    Read the article

  • UVA #10410 Tree Reconstruction

    - by Vincent
    I have worked on UVA 10410 Tree Reconstruction several days. But I can't get the correct answer unitl now. I have used an algorithm similar to the one which we always use to recovery a binary tree through the preorder traversal and the inorder traversal. But it can't work. Can anyone help me? Thanks in advance.

    Read the article

  • CURL - HTTPS Wierd error

    - by Vincent
    All, I am having trouble requesting info from HTTPS site using CURL and PHP. I am using Solaris 10. It so happens that sometimes it works and sometimes it doesn't. I am not sure what is the cause. If it doesn't work, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * error:80089077:lib(128):func(137):reason(119) * Closing connection #0 If it works, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * SSL connection using DHE-RSA-AES256-SHA * Server certificate: * subject: C=CA, ST=British Columnbia, L=Vancouver, O=google, OU=FDN, CN=g.googlenet.com, [email protected] * start date: 2007-07-24 23:06:32 GMT * expire date: 2027-09-07 23:06:32 GMT * issuer: C=US, ST=California, L=Sunnyvale, O=Google, OU=Certificate Authority, CN=support, [email protected] * SSL certificate verify result: unable to get local issuer certificate (20), continuing anyway. > POST /gportal/gpmgr HTTP/1.1^M Host: 10.10.101.12^M Accept: */*^M Accept-Encoding: gzip,deflate^M Content-Length: 1623^M Content-Type: application/x-www-form-urlencoded^M Expect: 100-continue^M ^M < HTTP/1.1 100 Continue^M < HTTP/1.1 200 OK^M < Date: Wed, 28 Apr 2010 21:56:15 GMT^M < Server: Apache^M < Cache-Control: no-cache^M < Pragma: no-cache^M < Vary: Accept-Encoding^M < Content-Encoding: gzip^M < Content-Length: 1453^M < Content-Type: application/json^M < ^M * Connection #0 to host 10.10.101.12 left intact * Closing connection #0 My CURL options are as under: $ch = curl_init(); $devnull = fopen('/tmp/curlcookie.txt', 'w'); $fp_err = fopen('/tmp/verbose_file.txt', 'ab+'); fwrite($fp_err, date('Y-m-d H:i:s')."\n\n"); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,120); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); curl_setopt($ch, CURLOPT_VERBOSE,1); curl_setopt($ch, CURLOPT_FAILONERROR, true); curl_setopt($ch, CURLOPT_STDERR, $fp_err); $ret = curl_exec($ch); Anybody has any idea, why it works sometimes but fails mostly? Thanks

    Read the article

  • Zend Server with xampp MySQL

    - by Vincent
    I am running Zend Server,Zend Studio (Trial versions) on Ubuntu 9.10. I am also using xampp to do most of my development. I plan to use Zend Server only to do URL profiling to know function level performance of my code. Is it possible to configure Zend Server to use XAMPP's MySQL database instead of installing a new mysql instance for Zend Server? Thanks

    Read the article

  • Format relative dates

    - by Jeffrey Aylesworth
    Is there a ruby gem that will format dates relative to the current time? I want output like "Tomorrow at 5pm", "Thursday next week at 5:15pm", I'm not too concerned about the exact output, just as long as it's relative dates in natural language

    Read the article

  • CURL - https - solaris

    - by Vincent
    All, I am receiving the following error when I use PHP to curl to a https site. Both PHP and the https site are hosted on Solaris. This error seems to occur occassionally but frequently. error:80089077:lib(128):func(137):reason(119) This is the curl code I am using: $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } How can I fix this error? If not, is there an alternative to curl?

    Read the article

  • Jquery - Loop through Checkboxes and Multiple elements

    - by Vincent
    All, I have a set of elements like this in a form: <input type="checkbox" name="chk[140]"> <input type="hidden" value="3" name="ctcount[140]"> <input type="hidden" value="Apples" name="catname[140]"> <input type="checkbox" name="chk[142]"> <input type="hidden" value="20" name="ctcount[142]"> <input type="hidden" value="Bananas" name="catname[142]"> <input type="checkbox" name="chk[144]"> <input type="hidden" value="200" name="ctcount[144]"> <input type="hidden" value="Strawberries" name="catname[144]"> <input type="checkbox" name="chk[145]"> <input type="hidden" value="0" name="ctcount[145]"> <input type="hidden" value="Carrots" name="catname[145]"> When a user clicks a button, I want the Javascript to: 1. Loop through all the checkboxes 2. For all the checked checkboxes, 2a. Get ctcount value 2b. Get catname value 2c. If ctcount value > 50, alert a message saying "Unable to add item as max limit for 'catname' has reached. 2d. Break the loop after it encountered first ctcount value that is greater than 50. I am new to JQuery..have the following code so far: var checklimit = 50; $('#frmTest input:checkbox:checked').each(function(i) { alert(this.value); }); How do I do this using JQuery? Thanks

    Read the article

  • Solve the IE select overlap bug

    - by Vincent Robert
    When using IE, you cannot put an absolutely positioned div over a select input element. That's because the select element is considered an ActiveX object and is on top of every HTML element in the page. I already saw people hiding selects when opening a popup div, that leads to pretty bad user experience having controls disappearing. FogBugz actually had a pretty smart solution (before v6) of turning every select into text boxes when a popup was displayed. This solved the bug and tricked the user eye but the behavior was not perfect. Another solution is in FogBugz 6 where they no more use the select element and recoded it everywhere. Last solution I currently use is messing up the IE rendering engine and force it to render the absolutely positioned div as an ActiveX element too, ensuring it can live over a select element. This is achieved by placing an invisible iframe inside the div and styling it with: #MyDiv iframe { position: absolute; z-index: -1; filter: mask(); border: 0; margin: 0; padding: 0; top: 0; left: 0; width: 9999px; height: 9999px; overflow: hidden; } Anyone has a even better solution than this one ? EDIT: The purpose of this question is as much informative as it is a real question. I find the iframe trick to be a good solution but I am still looking for improvement like removing this ugly useless iframe tag that degrade accessibility.

    Read the article

  • What is node.js?

    - by Jeffrey
    I don't fully get what node.js is all about. Maybe it's because I am mainly a web based business app developer. Can someone please explain what it is and the use of it? Thanks. My understanding so far is that: The programming model is event driven, especially the way it handles IO. It uses javascript and the parser is V8. It can be easily used to create concurrent server apps. Are my understandings correct? If yes, then what are the benefits of evented IO, is it just more for the concurrency stuffs? Also is the direction of node.js to become a framework like, javascript based (v8 based) programming model?

    Read the article

  • Is it possible to serve up a resource as both JSON and Aspx with OpenRasta?

    - by Jeffrey Cameron
    (I'm also asking this on the OpenRasta google group) Hey all, I've been using OpenRasta to convert an old web application we have into something RESTful. IS it possible to serve up a resource (or specifically a list of resources) as both .aspx and JSON? I have tried this but no matter what I try I keep getting the .aspx back ... any ideas? Here's a sample configuration: ResourceSpace.Has.ResourcesOfType<List<Valueset>>() .AtUri("/valuesets") .HandledBy<ValuesetHandler>() .AsJsonDataContract() .And.AsXmlDataContract() .And.RenderedByAspx("~/Views/VauesetView.aspx")

    Read the article

  • How to debug packet loss ?

    - by Gene Vincent
    I wrote a C++ application (running on Linux) that serves an RTP stream of about 400 kbps. To most destinations this works fine, but some destinations expericence packet loss. The problematic destinations seem to have a slower connection in common, but it should be plenty fast enough for the stream I'm sending. Since these destinations are able to receive similar RTP streams for other applications without packet loss, my application might be at fault. I already verified a few things: - in a tcpdump, I see all RTP packets going out on the sending machine - there is a UDP send buffer in place (I tried sizes between 64KB and 300KB) - the RTP packets mostly stay below 1400 bytes to avoid fragmentation What can a sending application do to minimize the possibility of packet loss and what would be the best way to debug such a situation ?

    Read the article

  • Zend_Soap_Client - Ignore HTTPS verification

    - by Vincent
    All, I want to use Zend_Soap_Client class to load WSDL from an HTTPS url. Currently, if I call like this, it gives me an error even if the WSDL is perfectly valid: $wsdlUrl = "https://abc.xyz.com/webservices/WeatherService.php?wsdl"; $soapClient = new Zend_Soap_Client($wsdlUrl); The error I receive is: SOAP-ERROR: Parsing WSDL: Couldn't load from 'https://abc.xyz.com/webservices /WeatherService.php?wsdl' : Start tag expected, '<' not found If I browse to the WSDL url in the browser, it loads up the WSDL just fine. I think Zend_Soap_Client is trying to validate the certificate and failing. Is there a way to set the SOAP option to ignore the HTTPS verification and just load the WSDL? Thanks

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >