Search Results

Search found 5262 results on 211 pages for 'operation'.

Page 8/211 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • Operation is not valid due to the current state of the object

    - by DBa
    Sometimes, when running a Mono .NET application (it seems to not depend on the input data, as it does not change), I run into following situation: when trying to Dequeue an element from a (non-empty, I check its Count beforehand) Queue, an exception is thrown: Unhandled Exception: System.InvalidOperationException: Operation is not valid due to the current state of the object at System.Collections.Generic.Queue1[DBWorkItem].Peek ()[0x00000] at System.Collections.Generic.Queue1[DBWorkItem].Dequeue () [0x00000] at DBProcessor.process (System.Object q) [0x0006b] in <... Though I can certainly catch this exception, the element is dequeued and lost. Has anyone else encountered this behavior, too?

    Read the article

  • Django gives "I/O operation on closed file" error when reading from a saved ImageField

    - by Rob Osborne
    I have a model with two image fields, a source image and a thumbnail. When I update the new source image, save it and then try to read the source image to crop/scale it to a thumbnail I get an "I/O operation on closed file" error from PIL. If I update the source image, don't save the source image, and then try to read the source image to crop/scale, I get an "attempting to read from closed file" error from PIL. In both cases the source image is actually saved and available in later request/response loops. If I don't crop/scale in a single request/response loop but instead upload on one page and then crop/scale in another page this all works fine. This seems to be a cached buffer being reused some how, either by PIL or by the Django file storage. Any ideas on how to make an ImageField readable after saving?

    Read the article

  • database logic for tracking each and every operation in my web application

    - by ripa
    I am developing an Web application. In my application, I need to keep track of each and every operation for every logged in user. I have planned following for achieving this task:- I will create stored procedure in mysql. I will trigger this procedure on each table's insert , update delete. This is an tough job for me. Will anybody direct me in the right way? I am using PHP based Codeigniter framework and mysql database.

    Read the article

  • "remote file operation failed" on Hudson

    - by Aveen
    I am running a Windows slave for Husdon 1.337 (Linux master). When running a project on the Windows node, it fails with the following message: Building remotely on winTestSlave Checking out a fresh workspace because there's no workspace at C:\hudson\***\ejb remote file operation failed It did work yesterday and I have not upgraded Hudson or changed its configurations (or the slave's configurations) in any way. I establish the connection between the slave and the master by running the following command on a cygwim prompt on the slave: java -jar slave.jar -jnlpUrl http://myserver/computer/winTestSlave/slave-agent.jnlp I saw the issue http://issues.hudson-ci.org/browse/HUDSON-5374 and did as instructed in the work-around but that did not work. I also tried with a newer version of slave.jar (version 1.356) but that did not work either. Does anyone please have any idea of how to fix this? I really cannot find more information anywhere else!

    Read the article

  • IL emit - operation could destabilize runtime when storing then loading

    - by Jakob Botsch Nielsen
    Hey, so I have the following IL: il.Emit(OpCodes.Ldarg_0); il.Emit(OpCodes.Ret); Which works fine. It basically returns the argument given. This, however: il.Emit(OpCodes.Ldarg_0); il.Emit(OpCodes.Stloc_0); il.Emit(OpCodes.Ldloc_0); il.Emit(OpCodes.Ret); Does not work. It crashes with the exception "Operation could destabilize the runtime.". Now, I know that the purpose of that is useless but I'm trying to reach my goal by small steps. Why does that not work?

    Read the article

  • Waiting for a background operation to complete

    - by JohnHenry
    I have been suffering from the all too common 'Waiting for a background operation to complete...' message in Visual Studio 2012 (Professional) for a while now but it has been fairly sporadic. Lately though, I am really struggling to use Visual Studio as pretty much whenever i try and do anything with any Razor views (mostly clicking to move the cursor) visual studio hangs and the above message appears for about a minute at a time. (If when its finished doing stuff i then click in the view again, the process repeats, and repeats, and repeats.....) I have searched high and low, and read loads of articles regarding this and peoples suggestions and tried changing indentation settings, resetting settings, etc but none have worked. Has anyone come across something else that may work as this is seriously impeding my ability to use visual studio and sadly provoking much cursing.

    Read the article

  • API verbs for an interruptible operation

    - by 280Z28
    I have a long running task as part of my application. The task can be started, paused, resumed, and cancelled. I'm trying to find the best interface for these operations. Two seem clear: Pause and Cancel. This leaves the start and resume operations. I could include both Start and Resume. This has the downside of either requiring the API consumer to check the state before starting/resuming the operation to call the right method, or making the methods aliases of each other. I'm thinking I should include either Start or Resume, but I don't know which one is the most appropriate. Does anyone have any examples in the .NET Framework of such behavior? I prefer to follow established patterns whenever they are available.

    Read the article

  • "Socket operation on non-socket" error due to strange sytax

    - by Robert S. Barnes
    I ran across the error Socket operation on non-socket in some of my networking code when calling connect and spent a lot of time trying to figure out what was causing it. I finally figured out that the following line of code was causing the problem: if ((sockfd = socket( ai->ai_family, ai->ai_socktype, ai->ai_protocol) < 0)) { See the problem? Here's what the line should look like: if ((sockfd = socket( ai->ai_family, ai->ai_socktype, ai->ai_protocol)) < 0) { What I don't understand is why the first, incorrect line doesn't produce a warning. To put it another way, shouldn't the general form: if ( foo = bar() < baz ) do_somthing(); look odd to the compiler, especially running with g++ -Wall -Wextra? If not, shouldn't it at least show up as "bad style" to cppcheck, which I'm also running as part of my compile?

    Read the article

  • Collection was modified; enumeration operation may not execute

    - by Rita
    I have the below code. I am trying to remove the record and it is throwing Exception when it is removing the Record. "Collection was modified; enumeration operation may not execute." Any ideas on how to get rid of the message. Appreciate your time. //validClaimControlNo has valid ClaimControl Numbers. List<string> validClaimControlNo = new List<string>(); int count = 0; foreach (List<Field> f in records) { foreach (Field fe in f) { if (i == 0) if (!(validClaimControlNo.Contains(fe.Value))) { //if this claim is not in the Valid list, Remove that Record records.RemoveAt(count); } i++; } i = 0; count++; }

    Read the article

  • Attempted to perform an unauthorized operation

    - by Lefteris Gkinis
    Now I use the following code: Public Function SetACL(ByVal filename As String, ByVal account As String, ByVal sender As Object, ByVal e As System.EventArgs) As Boolean Try Dim rule As FileSystemAccessRule = New FileSystemAccessRule(account, FileSystemRights.Write, AccessControlType.Allow) Dim fp As PermissionSet = New PermissionSet(Permissions.PermissionState.Unrestricted) fp.AddPermission(New FileIOPermission(FileIOPermissionAccess.Read, filename)) fp.AddPermission(New FileIOPermission(FileIOPermissionAccess.Write, filename)) fp.AddPermission(New FileIOPermission(FileIOPermissionAccess.PathDiscovery, filename)) fp.Assert() Dim di As DirectoryInfo = New DirectoryInfo(Path.GetDirectoryName(filename)) SetACL = False Dim security As DirectorySecurity = di.GetAccessControl(AccessControlSections.Access) security.ModifyAccessRule(AccessControlModification.Add, rule, SetACL) di.SetAccessControl(security) Return SetACL Catch ex As Exception MessageBox.Show(ex.Message, "Set Security Sub", MessageBoxButtons.OK, MessageBoxIcon.Stop) Finalize() End Try End Function The Error of 'Attempted to perform an unauthorized operation' comes when i'm trying to execute the instraction Dim security As DirectorySecurity = di.GetAccessControl(AccessControlSections.Access) Please if anybody knows why that error comes here to respond

    Read the article

  • OSError: [Error 1] Operation not permitted

    - by user1357576
    I am trying to run a python script which uses a binary file (xFiles.bin.addr_patched) created by a postlinker. However, I am getting this error. File "abc.py", line 74, in ParseCmd shutil.copy(gOptions.inputX, gWorkingXFile) File "/usr/lib/python2.6/shutil.py", line 89, in copy copymode(src, dst) File "/usr/lib/python2.6/shutil.py", line 66, in copymode os.chmod(dst, mode) OSError: [Errno 1] Operation not permitted: 'myPath/xFiles.bin.addr_patched' When I checked the permissions of this xFiles.bin, by ls-l, it shows that -rwxrwxrwx 1 nobody nogroup I presume the error is because this file was created by some other application, the python script I am running does not have access to it. Since I am beginner wrt ubuntu, I don't really know how to fix it. Any suggestions on how to fix this? SOLVED: As one of the answers Suggested : chown username:groupname file name fixes this issue

    Read the article

  • Performing an operation based on values within an array

    - by James W.
    I'm trying to figure out how to do operations based on values in an array. The values are taken from a string and inserted into the array e.g num = TextBox.Text.Split(' '); results = Convert.ToDouble(num[0]); for (int i = 0; i < num.Length - 1; i++) { if (num[i] == "+") { results += Convert.ToDouble(num[i++]); } ... } So based on this, let's say the TextBox string value was "1 + 2". So the array would be: ------------- | 1 | + | 2 | ------------- 0 1 2 (indexes) The part I'm having trouble with is Convert.ToDouble(num[i++]).. I've tried num[1] + 1, num[i + 1], etc I'm trying to figure out how to get it to perform the operation based on the first value and the value in the index after the operator. Which is the correct way to do something like this?

    Read the article

  • Problem with JOGL and Framebuffer Render-to-texture: Invalid Framebuffer Operation Error

    - by quadelirus
    Okay, so I am trying to render a scene to a small 32x32 texture and ran into problems. I get an "invalid framebuffer operation" error when I try to actually draw anything to the texture. I have simplified the code below so that it simply tries to render a quad to a texture and then bind that quad as a texture for another quad that is rendered to the screen. So my question is this... where is the error? This is using JOGL 1.1.1. The error occurs at Checkpoint2 in the code. import java.awt.event.*; import javax.media.opengl.*; import javax.media.opengl.glu.*; import javax.swing.JFrame; import java.nio.*; public class Main extends JFrame implements GLEventListener, KeyListener, MouseListener, MouseMotionListener, ActionListener{ /* GL related variables */ private final GLCanvas canvas; private GL gl; private GLU glu; private int winW = 600, winH = 600; private int texRender_FBO; private int texRender_RB; private int texRender_32x32; public static void main(String args[]) { new Main(); } /* creates OpenGL window */ public Main() { super("Problem Child"); canvas = new GLCanvas(); canvas.addGLEventListener(this); canvas.addKeyListener(this); canvas.addMouseListener(this); canvas.addMouseMotionListener(this); getContentPane().add(canvas); setSize(winW, winH); setLocationRelativeTo(null); setDefaultCloseOperation(EXIT_ON_CLOSE); setVisible(true); canvas.requestFocus(); } /* gl display function */ public void display(GLAutoDrawable drawable) { gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, this.texRender_FBO); gl.glPushAttrib(GL.GL_VIEWPORT_BIT); gl.glViewport(0, 0, 32, 32); gl.glClearColor(1.f, 0.f, 0.f, 1.f); System.out.print("Checkpoint1: "); outputError(); gl.glBegin(GL.GL_QUADS); { //gl.glTexCoord2f(0.0f, 0.0f); gl.glColor3f(1.f, 0.f, 0.f); gl.glVertex3f(0.0f, 1.0f, 1.0f); //gl.glTexCoord2f(1.0f, 0.0f); gl.glColor3f(1.f, 1.f, 0.f); gl.glVertex3f(1.0f, 1.0f, 1.0f); //gl.glTexCoord2f(1.0f, 1.0f); gl.glColor3f(1.f, 1.f, 1.f); gl.glVertex3f(1.0f, 0.0f, 1.0f); //gl.glTexCoord2f(0.0f, 1.0f); gl.glColor3f(1.f, 0.f, 1.f); gl.glVertex3f(0.0f, 0.0f, 1.0f); } gl.glEnd(); System.out.print("Checkpoint2: "); outputError(); //Here I get an invalid framebuffer operation gl.glPopAttrib(); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, 0); gl.glClearColor(0.f, 0.f, 0.f, 1.f); gl.glClear(GL.GL_COLOR_BUFFER_BIT); gl.glColor3f(1.f, 1.f, 1.f); gl.glBindTexture(GL.GL_TEXTURE_1D, this.texRender_32x32); gl.glBegin(GL.GL_QUADS); { gl.glTexCoord2f(0.0f, 0.0f); //gl.glColor3f(1.f, 0.f, 0.f); gl.glVertex3f(0.0f, 1.0f, 1.0f); gl.glTexCoord2f(1.0f, 0.0f); //gl.glColor3f(1.f, 1.f, 0.f); gl.glVertex3f(1.0f, 1.0f, 1.0f); gl.glTexCoord2f(1.0f, 1.0f); //gl.glColor3f(1.f, 1.f, 1.f); gl.glVertex3f(1.0f, 0.0f, 1.0f); gl.glTexCoord2f(0.0f, 1.0f); //gl.glColor3f(1.f, 0.f, 1.f); gl.glVertex3f(0.0f, 0.0f, 1.0f); } gl.glEnd(); } /* initialize GL */ public void init(GLAutoDrawable drawable) { gl = drawable.getGL(); glu = new GLU(); gl.glClearColor(.3f, .3f, .3f, 1f); gl.glClearDepth(1.0f); gl.glMatrixMode(GL.GL_PROJECTION); gl.glLoadIdentity(); gl.glOrtho(0, 1, 0, 1, -10, 10); gl.glMatrixMode(GL.GL_MODELVIEW); //Set up the 32x32 texture this.texRender_FBO = genFBO(gl); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, this.texRender_FBO); this.texRender_32x32 = genTexture(gl); gl.glBindTexture(GL.GL_TEXTURE_2D, this.texRender_32x32); gl.glTexImage2D(GL.GL_TEXTURE_2D, 0, GL.GL_RGB_FLOAT32_ATI, 32, 32, 0, GL.GL_RGB, GL.GL_FLOAT, null); gl.glFramebufferTexture2DEXT(GL.GL_FRAMEBUFFER_EXT, GL.GL_COLOR_ATTACHMENT0_EXT, GL.GL_TEXTURE_2D, this.texRender_32x32, 0); //gl.glDrawBuffer(GL.GL_COLOR_ATTACHMENT0_EXT); this.texRender_RB = genRB(gl); gl.glBindRenderbufferEXT(GL.GL_RENDERBUFFER_EXT, this.texRender_RB); gl.glRenderbufferStorageEXT(GL.GL_RENDERBUFFER_EXT, GL.GL_DEPTH_COMPONENT24, 32, 32); gl.glFramebufferRenderbufferEXT(GL.GL_FRAMEBUFFER_EXT, GL.GL_DEPTH_ATTACHMENT_EXT, GL.GL_RENDERBUFFER_EXT, this.texRender_RB); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, 0); gl.glBindRenderbufferEXT(GL.GL_RENDERBUFFER_EXT, 0); outputError(); } private void outputError() { int c; if ((c = gl.glGetError()) != GL.GL_NO_ERROR) System.out.println(glu.gluErrorString(c)); } private int genRB(GL gl) { int[] array = new int[1]; IntBuffer ib = IntBuffer.wrap(array); gl.glGenRenderbuffersEXT(1, ib); return ib.get(0); } private int genFBO(GL gl) { int[] array = new int[1]; IntBuffer ib = IntBuffer.wrap(array); gl.glGenFramebuffersEXT(1, ib); return ib.get(0); } private int genTexture(GL gl) { final int[] tmp = new int[1]; gl.glGenTextures(1, tmp, 0); return tmp[0]; } /* mouse and keyboard callback functions */ public void reshape(GLAutoDrawable drawable, int x, int y, int width, int height) { winW = width; winH = height; gl.glViewport(0, 0, width, height); } //Sorry about these, I just had to delete massive amounts of code to boil this thing down and these are hangers-on public void mousePressed(MouseEvent e) {} public void mouseDragged(MouseEvent e) {} public void mouseReleased(MouseEvent e) {} public void keyPressed(KeyEvent e) {} public void displayChanged(GLAutoDrawable drawable, boolean modeChanged, boolean deviceChanged) { } public void keyTyped(KeyEvent e) { } public void keyReleased(KeyEvent e) { } public void mouseMoved(MouseEvent e) { } public void actionPerformed(ActionEvent e) { } public void mouseClicked(MouseEvent e) { } public void mouseEntered(MouseEvent e) { } public void mouseExited(MouseEvent e) { } }

    Read the article

  • GMLib Could not complete the operation due to error 80020101

    - by Pierrie
    I get this error "Could not complete the operation due to error 80020101." at random times when displaying a map with a marker on it. I use Delphi 2007 and GMLib [1.2.0 Final]. I have read up on the issue and some suggestions was that the problem is due to commenting or bad syntax in java code, and it was suggested that i take out all the commenting and check for errors in the java code. This i did, i recompiled and reinstalled GMLib after modifying the map.html file. I stripped it of all commenting and parsed it through ie for faults but found none, as expected. But the problem still occurs. Here is a sample of my code to show the map and add the marker : Var newmarker : TMarker; begin newmarker := GMMarker1.Add(); newmarker.Position.Lat := MarkersToPaint[i].Latitude; newmarker.Position.Lng := MarkersToPaint[i].Longitude; newmarker.Visible := True; newmarker.Title := MarkersToPaint[i].Title; GMMap1.RequiredProp.Center.Lat := midlat; GMMap1.RequiredProp.Center.Lng := midlong; GMMap1.RequiredProp.Zoom := 18; GMMarker1.ShowElements; GMMap1.Active := True; Any help in this matter will be greatly appreciated.

    Read the article

  • Refresh RadGridview when Insert,Update and Delete Operation done on Database in WPF

    - by patelriki13
    WPF and C#: Problem: 1. How to Refresh Radgridview when i Insert,update and Delete Record in database anrecord. 2.when i am Insert or Update Record than in radgridview that row is selected. i am useing sql server 2005. i am use to set data source of radgridview like " radgridview1.ItemsSource = ds; " == ds is dataset. i am beginner so if possible than tel me by code it is easy to understand....... can u help me as early as possible .... i give some code which i am useing for update RadGridview con.ConnectionString = @"Data Source=(local);Initial Catalog=DigiDms;Integrated Security=True"; cmd1.Connection = con; con.Open(); cmd1.CommandType = CommandType.StoredProcedure; cmd1.CommandText = "Pro_Insurance_Master_Select"; da1.SelectCommand = cmd1; da1.Fill(ds1); con.Close(); //dataGrid.clear(); //dsGrid.Reset(); //dsGrid = dataGrid.GetData("Pro_Insurance_Master_Select"); //set datasource of gridview gridShowData.ItemsSource = null; gridShowData.ItemsSource = ds1; doing this , when i am delete or update record than folloning error generated... Error: "Object reference not set to an object" when i am doing the "gridShowData.ItemsSource = null;" and when i am doing insert operation than this error is not generated and RadGridview also updated..... so pls help me as early as possible.... i am beginer ........ my email address is [email protected]

    Read the article

  • Ajax Asynchronous in IE - Error "The Data Necessary to Complete This Operation is Not Yet Available"

    - by Supernovah
    Hey there. I have a 100% valid Ajax model written in Javascript with a few inputs I use being, Get or Post method, What page to communicate with, What String to send to that page and What element on my own page I might be fiddling with when I receive my response. The problem is that, should I set the request to Asynchronous (Hence Ajax), IE returns the error "The Data Necessary to Complete This Operation is Not Yet Available" in the onreadystatechange event where all I do is check if the readystate is 4 and the status is 200. The error doesn't come up in Firefox or Chrome as I would exepect as the Ajax is Asynchronous. Heres a snippet from the Post method xmlhttp.open("POST", commPage, true); xmlhttp.setRequestHeader("Content-Type","application/x-www-form-urlencoded; charset=UTF-8"); xmlhttp.onreadystatechange = function() { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { j = xmlhttp.responseText; i.innerHTML = j; } } xmlhttp.send(str); Edit: I should point out that in IE, I'm using the ActiveX Control - Msxml2.XMLHTTP or Microsoft.XMLHTTP or whichever returns true first.

    Read the article

  • WCF Ria Services Error : Load operation failed for query 'GetTranslationProgress'

    - by Manoj
    Hello, I am using WCF Ria Services beta in my silverlight application. I have a long running task on the server which keeps writing its status to a database table. I have a "GetTranslationProgress" Ria Service Query method which queries the state to get the status. This query method is called continuously at a regular interval of 5 seconds until a status = Finished or Error is retrieved. In some cases if the task on the server is running for a long duration 2-3 minutes then I receives this error:- Load operation failed for query 'GetTranslationProgress'. The server did not provide a meaningful reply; this might be caused by a contract mismatch, a premature session shutdown or an internal server error. at System.Windows.Ria.OperationBase.Complete(Exception error) at System.Windows.Ria.LoadOperation.Complete(Exception error) at System.Windows.Ria.DomainContext.CompleteLoad(IAsyncResult asyncResult) at System.Windows.Ria.DomainContext.<c_DisplayClass17.b_13(Object ) The error occurs intermittently and I have no idea what could be causing this error. I have checked most of the forums and sites but I have not been able to find out any solution to this issue. Please help.

    Read the article

  • Encrypting using RSA via COM Interop = "The requested operation requires delegation to be enabled on

    - by Mr AH
    Hi Guys, So i've got this little static method in a .Net class which takes a string, uses some stored public key and returns the encrypted version of that key. This is basically so some user entered data can be saved an encrypted, then retrieved and decrypted at a later date. Pretty basic stuff and the unit test works fine. However, part of the application is in classic ASP. This then uses some COM visible version of the class to go off and invoke the method on the real class and return the same string to the COM client (classic ASP). I use this kind of stuff all the time, but in this case we have a major problem. As the method is doing something with RSA keys and has to access certain machine information to do so, we get the error: "The requested operation requires delegation to be enabled on the machine. I've searched around a lot, but can't really understand what this means. I assume I am getting this error on the COM but not the UT because the UT runs as me (Administrator) and classic ASP as IWAM. Anyone know what I need to do to enable IWAM to do this? Or indeed if this is the real problem here?

    Read the article

  • Why is TransactionScope operation is not valid?

    - by Cragly
    I have a routine which uses a recursive loop to insert items into a SQL Server 2005 database The first call which initiates the loop is enclosed within a transaction using TransactionScope. When I first call ProcessItem the myItem data gets inserted into the database as expected. However when ProcessItem is called from either ProcessItemLinks or ProcessItemComments I get the following error. “The operation is not valid for the state of the transaction” I am running this in debug with VS 2008 on Windows 7 and have the MSDTC running to enable distributed transactions. The code below isn’t my production code but is set out exactly the same. The AddItemToDatabase is a method on a class I cannot modify and uses a standard ExecuteNonQuery() which creates a connection then closes and disposes once completed. I have looked at other posting on here and the internet and still cannot resolve this issue. Any help would be much appreciated. using (TransactionScope processItem = new TransactionScope()) { foreach (Item myItem in itemsList) { ProcessItem(myItem); } processItem.Complete(); } private void ProcessItem(Item myItem) { AddItemToDatabase(myItem); ProcessItemLinks(myItem); ProcessItemComments(myItem); } private void ProcessItemLinks(Item myItem) { foreach (Item link in myItem.Links) { ProcessItem(link); } } private void ProcessItemComments(Item myItem) { foreach (Item comment in myItem.Comments) { ProcessItem(comment); } } Here is top part of the stack trace. Unfortunatly I cant show the build up to this point as its company sensative information which I can not disclose. Hope this is enough information. at System.Transactions.TransactionState.EnlistPromotableSinglePhase(InternalTransaction tx, IPromotableSinglePhaseNotification promotableSinglePhaseNotification, Transaction atomicTransaction) at System.Transactions.Transaction.EnlistPromotableSinglePhase(IPromotableSinglePhaseNotification promotableSinglePhaseNotification) at System.Data.SqlClient.SqlInternalConnection.EnlistNonNull(Transaction tx) at System.Data.SqlClient.SqlInternalConnection.Enlist(Transaction tx) at System.Data.SqlClient.SqlInternalConnectionTds.Activate(Transaction transaction) at System.Data.ProviderBase.DbConnectionInternal.ActivateConnection(Transaction transaction) at System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.SqlClient.SqlConnection.Open()

    Read the article

  • Call long running operation in WSS feature OnActivated Event

    - by dirq
    More specifically - How do I reference SPContext in Web Service with [SoapDocumentMethod(OneWay=true)]? We are creating a feature that needs to run a job when a site is created. The job takes about 4 minutes to complete. So, we made a web service that we can call when the feature is activated. This works but we want it to run asynchronously now. We've found the SoapDocumentMethod's OneWay property and that would work awesomely but the SPContext is now NULL. We have our web services in the _vti_bin virtual directory so it's available in each Windows Sharepoint Services site. I was using the SPContext.Current.Web to get the site and perform the long running operation. I wanted to just fire and forget about it by returning a soap response right away and letting the process run. How can I get the current SPContext? I used to be able to do this in my web service: SPWeb mySite = SPContext.Current.Web; Can I get the same context when I have the [SoapDocumentMethod(OneWay=true)] attribute applied to my web service? Or must I recreate the SPWeb from the url? This is similar to this thread: http://stackoverflow.com/questions/340192/webservice-oneway-and-new-spsitemyurl Update: I've tried these two ways but they didn't work: SPWeb targetSite = SPControl.GetContextWeb(this.Context); SPWeb targetSite2 = SPContext.GetContext(this.Context).Web;

    Read the article

  • edmx - The operation could not be completed - After adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

    Read the article

  • Asp.net Crawler Webresponse Operation Timed out.

    - by Leon
    Hi I have built a simple threadpool based web crawler within my web application. Its job is to crawl its own application space and build a Lucene index of every valid web page and their meta content. Here's the problem. When I run the crawler from a debug server instance of Visual Studio Express, and provide the starting instance as the IIS url, it works fine. However, when I do not provide the IIS instance and it takes its own url to start the crawl process(ie. crawling its own domain space), I get hit by operation timed out exception on the Webresponse statement. Could someone please guide me into what I should or should not be doing here? Here is my code for fetching the page. It is executed in the multithreaded environment. private static string GetWebText(string url) { string htmlText = ""; HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url); request.UserAgent = "My Crawler"; using (WebResponse response = request.GetResponse()) { using (Stream stream = response.GetResponseStream()) { using (StreamReader reader = new StreamReader(stream)) { htmlText = reader.ReadToEnd(); } } } return htmlText; } And the following is my stacktrace: at System.Net.HttpWebRequest.GetResponse() at CSharpCrawler.Crawler.GetWebText(String url) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 366 at CSharpCrawler.Crawler.CrawlPage(String url, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 105 at CSharpCrawler.Crawler.CrawlSiteBuildIndex(String hostUrl, String urlToBeginSearchFrom, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 89 at crawler_Default.threadedCrawlSiteBuildIndex(Object threadedCrawlerObj) in c:\myAppDev\myApp\site\crawler\Default.aspx.cs:line 108 at System.Threading.QueueUserWorkItemCallback.WaitCallback_Context(Object state) at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.RunInternal(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state, Boolean ignoreSyncCtx) at System.Threading.QueueUserWorkItemCallback.System.Threading.IThreadPoolWorkItem.ExecuteWorkItem() at System.Threading.ThreadPoolWorkQueue.Dispatch() at System.Threading._ThreadPoolWaitCallback.PerformWaitCallback() Thanks and cheers, Leon.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • edmx - The operation could not be completed - When adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas??? this is driving me crazy...

    Read the article

  • Invalid Pointer Operation, advice requested with debugging

    - by Xanyx
    I appear to have created code that is trashing memory. Having never had such problems before, i am now settign an Invalid Pointer Operation. In the following the value of the const string sFilename gets trashed after my call to PromptForXYZPropertiesSettings. // Allow the user to quickly display the properties of XYZ without needing to display the full Editor function PromptForXYZProperties(const sFilename:string; var AXYZProperties: TXYZProperties): boolean; var PropEditor: TdlgEditor; begin PropEditor:= TdlgEditor.create(nil); try PropEditor.LoadFromFile(sFilename); Other Details: Delphi 2007, Windows 7 64 bit, but can reproduce when testing EXE on XP REMOVING CONST STOPS PROBLEM FROM EXHIBITING (but presumably the problem is thus just lurking) PropEditor.PromptForXYZPropertiesSettings creates and shows a form. If I disable the ShowModal call then the memory is not trashed. Even though i have REMOVED ALL CONTROLS AND CODE from the form So I would like some advice on how to debug the issue. I was thinking perhaps watching the memory pointer where the sFilename var exists to see where it gets trashed, but not sure how i would do that (obviously needs to be done within the app so is owned memory). Thanks

    Read the article

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >