Search Results

Search found 2723 results on 109 pages for 'ssrs printing'.

Page 81/109 | < Previous Page | 77 78 79 80 81 82 83 84 85 86 87 88  | Next Page >

  • How to copy a System.Drawing.Graphics over another Graphics?

    - by Simon T.
    We got some code that implement printing using Printdocument and it does all the drawing directly on the Graphics object received in the PrintEventArgs. It would be more convenient if the code doing the drawing used another canvas and we would add this canvas to the PrintEventArgs Graphics after. Since the code already depends on the Graphics object I need a canvas with this object. I also need a way to copy the canvas onto the PrintEventArgs Graphics. I can create a Graphicsfrom an Image but as far as I know it needs to be stored on the disk. Any suggestions?

    Read the article

  • Awk to grab colo(u)r codes from CSS files aka School me in Awk

    - by Andrew Bolster
    Nice and (hopefully) easy. I am trying to work out how to grab the variable #XXX from a text file (css file) containing strings like hr { margin: 18px 0 17px; border-color: #ccc; } h1 a:hover, h2 a:hover, h3 a:hover { color: #001100; } Which I would like to return as ccc 777 The plan then is to throw this through sort and uniq and the end up with a defining colourscheme for the page. Basically, I can't work out how to go from matching /color:#...[...]/ to just printing out the wildcarded sections.

    Read the article

  • Error using traits class.: "expected constructor destructor or type conversion before '&' token"

    - by Mark
    I have a traits class that's used for printing out different character types: template <typename T> class traits { public: static std::basic_ostream<T>& tout; }; template<> std::ostream& traits<char>::tout = std::cout; template<> std::wostream& traits<unsigned short>::tout = std::wcout; gcc (g++) version 3.4.5 (yes somewhat old) is throwing an error: "expected constructor destructor or type conversion before '&' token" And I'm wondering if there's a good way to resolve this. (it's also angry about _O_WTEXT so if anyone's got some insight into that, I'd also appreciate it)

    Read the article

  • Delphi and prevent event handling

    - by pKarelian
    How do you prevent a new event handling to start when an event handling is already running? I press a button1 and event handler start e.g. slow printing job. There are several controls in form buttons, edits, combos and I want that a new event allowed only after running handler is finnished. I have used fRunning variable to lock handler in shared event handler. Is there more clever way to handle this? procedure TFormFoo.Button_Click(Sender: TObject); begin if not fRunning then try fRunning := true; if (Sender = Button1) then // Call something slow ... if (Sender = Button2) then // Call something ... if (Sender = Button3) then // Call something ... finally fRunning := false; end; end;

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Can a struct become deallocated?

    - by brettr
    I've declared a struct in my header file like this: typedef struct { NSString *department; NSString *departmentId; } Department; Department currentDepartment; This struct is in a fairly simple class. I assign the struct values in viewDidLoad. Just before leaving viewDidLoad, I see the struct values are still there. After the user clicks a segment control, I reassign the struct values. Before assigning values, I see the two struct values are 0x0. I do have NSZombieEnabled, which is printing out this when I mouse over the struct while the app is running and one of my breakpoints have been hit: MyApp[25722:207] *** -[CFString _cfTypeID]: message sent to deallocated instance 0xfc0e90 I'm not creating an instance of the struct or deallocating it. How can it be getting deallocated?

    Read the article

  • Is there a stylesheet or Windows commandline tool for controllable XML formatting, specifically putt

    - by Scott Stafford
    Hi - I am searching for an XSLT or command-line tool (or C# code that can be made into a command-line tool, etc) for Windows that will do XML pretty-printing. Specifically, I want one that has the ability to put attributes one-to-a-line, something like: <Node> <ChildNode value1='5' value2='6' value3='happy' /> </Node> It doesn't have to be EXACTLY like that, but I want to use it for an XML file that has nodes with dozens of attributes and spreading them across multiple lines makes them easier to read, edit, and text-diff. NOTE: I think my preferred solution is an XSLT sheet I can pass through a C# method, though a Windows command-line tool is good too.

    Read the article

  • Assinging a GD reference to a new variable fails to copy

    - by Stomped
    This is a contrived example, but it illustrates my problem much more concisely then the code I'm using - and I've tested this and it exhibits the problem: $image = imagecreatefromjpeg('test.jpg'); $copy_of_image = $image; // The important bit imagedestroy($image); header('Content-type: image/jpeg'); imagejpeg($copy_of_image); Now, my expectation is that $copy_of_image is exactly that, but when I run this, it fails, printing out the URL of the script of all things. Comment out the imagedestroy() and it works just fine. a var_dump of $image provides: resource(3) of type (gd) So why can't I copy this? Apparently the assignment $copy_of_image = $image is creating a reference rather then a copy - is there a way to prevent that?

    Read the article

  • Bourne Script: Redirect success messages but NOT error messages

    - by sixtyfootersdude
    This command: keytool -import -file "$serverPath/$serverCer" -alias "$clientTrustedCerAlias" -keystore "$clientPath/$clientKeystore" -storepass "$serverPassword" -noprompt Will when it runs successfully outputs: Certificate was added to keystore I tried redirecting the stdard out with: keytool ... > /dev/null But it is still printing. It appears that the message is being output into standard error. Since when I do this it is not displayed: keytool ... > /dev/null 2>&1 However this is not what I am wanting to do. I would like error messages to be output normally but I do not want "success" messages to be output to the command line. Any ideas? Whatever happened to unix convention: "If it works do not output anything".

    Read the article

  • Reading inputs in java

    - by Gandalf StormCrow
    Hello everyone I'm trying to improve my Java skills by solving some problems from ACM, now the thing is my sample input looks like this : 3 100 34 100 75 250 27 2147483647 101 304 101 303 -1 -1 So at first I'm just trying to read them but its not working here is the java code: import java.io.BufferedInputStream; import java.util.Scanner; public class Main { public static void main(String args[]) { Scanner stdin = new Scanner(new BufferedInputStream(System.in)); while (stdin.hasNext()) { System.out.println(stdin.nextInt() + " and the next " + stdin.nextInt()); } } } I'm trying to send these inputs as an argument, and not by reading them from file, here is how: The program just spins(executes) but not printing anything. How can I fix this?

    Read the article

  • java regex illegal escape character error not occurring from command line arguments

    - by Shades88
    This simple regex program import java.util.regex.*; class Regex { public static void main(String [] args) { System.out.println(args[0]); // #1 Pattern p = Pattern.compile(args[0]); // #2 Matcher m = p.matcher(args[1]); boolean b = false; while(b = m.find()) { System.out.println(m.start()+" "+m.group()); } } } invoked by java regex "\d" "sfdd1" compiles and runs fine. But if #1 is replaced by Pattern p = Pattern.compile("\d");, it gives compiler error saying illegal escape character. In #1 I also tried printing the pattern specified in the command line arguments. It prints \d, which means it is just getting replaced by \d in #2. So then why won't it throw any exception? At the end it's string argument that Pattern.compile() is taking, doesn't it detect illegal escape character then? Can someone please explain why is this behaviour?

    Read the article

  • Object Reference is required for non static field, method, or property

    - by JB
    using System; using System.IO; using System.Data; using System.Text; using System.Drawing; using System.Data.OleDb; using System.Collections; using System.ComponentModel; using System.Windows.Forms; using System.Drawing.Printing; using System.Collections.Generic; namespace Eagle_Eye_Class_Finder { public class GetSchedule { public GetSchedule() { IDnumber[] IDnumbers = new IDnumber[3]; IDnumbers[0] = new IDnumber() { Name = "Joshua Banks", ID = "900456317", year = "Senior", class1 = "TEET 4090", class2 = "TEET 3020", class3 = "TEET 3090", class4 = "TEET 4290" }; IDnumbers[1] = new IDnumber() { Name = "Sean Ward", ID = "900456318", year = "Junior", class1 = "ENGNR 4090", class2 = "ENGNR 3020", class3 = "ENGNR 3090", class4 = "ENGNR 4290" }; IDnumbers[2] = new IDnumber() { Name = "Terrell Johnson", ID = "900456319", year = "Sophomore", class1 = "BUS 4090", class2 = "BUS 3020", class3 = "BUS 3090", class4 = "BUS 4290" }; } public class IDnumber { public string Name { get; set; } public string ID { get; set; } public string year { get; set; } public string class1 { get; set; } public string class2 { get; set; } public string class3 { get; set; } public string class4 { get; set; } public static void ProcessNumber(IDnumber myNum) { StringBuilder myData = new StringBuilder(); myData.AppendLine(IDnumber.Name); myData.AppendLine(": "); myData.AppendLine(IDnumber.ID); myData.AppendLine(IDnumber.year); myData.AppendLine(IDnumber.class1); myData.AppendLine(IDnumber.class2); myData.AppendLine(IDnumber.class3); myData.AppendLine(IDnumber.class4); MessageBox.Show(myData); } public string GetDataFromNumber(string ID) { foreach (IDnumber idCandidateMatch in IDnumbers) { if (IDCandidateMatch.ID == ID) { StringBuilder myData = new StringBuilder(); myData.AppendLine(IDnumber.Name); myData.AppendLine(": "); myData.AppendLine(IDnumber.ID); myData.AppendLine(IDnumber.year); myData.AppendLine(IDnumber.class1); myData.AppendLine(IDnumber.class2); myData.AppendLine(IDnumber.class3); myData.AppendLine(IDnumber.class4); return myData; } } return ""; } } } }using System; using System.IO; using System.Data; using System.Text; using System.Drawing; using System.Data.OleDb; using System.Collections; using System.ComponentModel; using System.Windows.Forms; using System.Drawing.Printing; using System.Collections.Generic; namespace Eagle_Eye_Class_Finder { public class GetSchedule { public GetSchedule() { IDnumber[] IDnumbers = new IDnumber[3]; IDnumbers[0] = new IDnumber() { Name = "Joshua Banks", ID = "900456317", year = "Senior", class1 = "TEET 4090", class2 = "TEET 3020", class3 = "TEET 3090", class4 = "TEET 4290" }; IDnumbers[1] = new IDnumber() { Name = "Sean Ward", ID = "900456318", year = "Junior", class1 = "ENGNR 4090", class2 = "ENGNR 3020", class3 = "ENGNR 3090", class4 = "ENGNR 4290" }; IDnumbers[2] = new IDnumber() { Name = "Terrell Johnson", ID = "900456319", year = "Sophomore", class1 = "BUS 4090", class2 = "BUS 3020", class3 = "BUS 3090", class4 = "BUS 4290" }; } public class IDnumber { public string Name { get; set; } public string ID { get; set; } public string year { get; set; } public string class1 { get; set; } public string class2 { get; set; } public string class3 { get; set; } public string class4 { get; set; } public static void ProcessNumber(IDnumber myNum) { StringBuilder myData = new StringBuilder(); myData.AppendLine(IDnumber.Name); myData.AppendLine(": "); myData.AppendLine(IDnumber.ID); myData.AppendLine(IDnumber.year); myData.AppendLine(IDnumber.class1);// i get it for all of these myData.AppendLine(IDnumber.class2); myData.AppendLine(IDnumber.class3); myData.AppendLine(IDnumber.class4); MessageBox.Show(myData); } public string GetDataFromNumber(string ID) { foreach (IDnumber idCandidateMatch in IDnumbers) { if (IDCandidateMatch.ID == ID) { StringBuilder myData = new StringBuilder(); myData.AppendLine(IDnumber.Name); myData.AppendLine(": "); myData.AppendLine(IDnumber.ID); myData.AppendLine(IDnumber.year); myData.AppendLine(IDnumber.class1); myData.AppendLine(IDnumber.class2); myData.AppendLine(IDnumber.class3); myData.AppendLine(IDnumber.class4); return myData; } } return ""; } } } }

    Read the article

  • Ruby from the command line - sticking - Windows

    - by tyndall
    I have seen this behavior on Windows with Ruby for a long time. If I install a gem sometimes the command line will just get "lost" and stop printing output until you go back to the command line and hit enter a few times. I notice this in other places too. Like starting up a Ruby on Rails console. Or generating a model with Rails. Have other people seen this? What causes this? The weird thing is this doesn't happen all the time. I have never seen this with PHP, Lua, Perl or Python from the command line. I have seen this on Vista and Windows 7 (32-bit and 64-bit). This happens on multiple machines.

    Read the article

  • why does python.subprocess hang after proc.communicate()?

    - by ccfenix
    I've got an interactive program called my_own_exe. First, it prints out alive, then you input S\n and then it prints out alive again. Finally you input L\n. It does some processing and exits. However, when I call it from the following python script, the program seemed to hang after printing out the first 'alive'. Can anyone here tell me why this is happening? Thanks proc2 = subprocess.Popen("my_own_exe", shell=True , stdin=subprocess.PIPE, stdout=subprocess.PIPE) print proc2.communicate()[0] time.sleep(2); print "alive" # 'hang' after print this line proc2.communicate('S\n')[0] print "alive" print proc2.communicate()[0] time.sleep(6)

    Read the article

  • gethostname() returns accurate hostname, bind() doesn't like it

    - by user2072848
    Doing a python socket tutorial, entire codebase is as follows import socket as so s = so.socket() host = so.gethostname() port = 12345 s.bind((host, port)) s.listen(5) while True: c, addr = s.accept() print 'Got connection from', addr c.send('Thank you for connecting') c.close() and error message: Traceback (most recent call last): File "server.py", line 13, in <module> s.bind((host, port)) File "/Users/solid*name*/anaconda/lib/python2.7/socket.py", line 224, in meth return getattr(self._sock,name)(*args) socket.gaierror: [Errno 8] nodename nor servname provided, or not known Printing hostname gives me super*name* Which is, in fact, my computer's hostname.

    Read the article

  • Dinamically creating a member ID card as pdf using PHP?

    - by aefxx
    I need to code a PHP script that would let me generate a pdf file which displays a member ID card (something like a credit card used to identify oneself) at a certain resolution. Let me explain: I do have the basic blueprint of the card in png file format. The script needs to drop in a member's name and birth day along with a serial. So far, no problem - there are plenty of good working PHP librarys out there. My problem is to ensure that the resulting pdf (the generated image of the card, to be precise) meets a certain resolution (preferably 300dpi), so that printing it would look right. Any ideas? EDIT I solved it using the TCPDF library which let's you scale images at a certain resolution. Get it here: http://www.tecnick.com/public/code/cp_dpage.php?aiocp_dp=tcpdf

    Read the article

  • How do I get the java.concurrency.CyclicBarrier to work as expected

    - by Ritesh M Nayak
    I am writing code that will spawn two thread and then wait for them to sync up using the CyclicBarrier class. Problem is that the cyclic barrier isn't working as expected and the main thread doesnt wait for the individual threads to finish. Here's how my code looks: class mythread extends Thread{ CyclicBarrier barrier; public mythread(CyclicBarrier barrier) { this.barrier = barrier; } public void run(){ barrier.await(); } } class MainClass{ public void spawnAndWait(){ CyclicBarrier barrier = new CyclicBarrier(2); mythread thread1 = new mythread(barrier).start(); mythread thread2 = new mythread(barrier).start(); System.out.println("Should wait till both threads finish executing before printing this"); } } Any idea what I am doing wrong? Or is there a better way to write these barrier synchronization methods? Please help.

    Read the article

  • saving the videos and photos in iPhone Simultor 4.0

    - by Mohammed Sadiq
    Hi All, From 4.0 apple has extended their api support to access the videos and photos from the phone. I am using only iPhone 4.0 simulator to test my application. When I try to save the video as apple has mentioned in their api docs, its giving the error something like "Error Saving the Asset". The way I try to store the video is as follows : ALAssetsLibraryWriteVideoCompletionBlock _videoCompblock = ^(NSURL *assetURL, NSError *error){ if(assetURL) { NSLog(@"Video AssetUrl : %@", [assetURL absoluteString]); } else if(error) { NSLog(@"The Error occured : %@", [error localizedDescription]); } }; BOOL isSupported = [library deoAtPathIsCompatibleWithSavedPhotosAlbum:videoFileUrl]; if(isSupported) { [library writeVideoAtPathToSavedPhotosAlbum:videoFileUrl completionBlock:_videoCompblock]; } The above methods should print the url of the video on successful saving of the video file. But its printing the error message as "ERROR SAVING THE ASSET". Any idea or help on this topic will be greatly appreciated. Best Regards, Mohammed Sadiq.

    Read the article

  • RDLC: Is there a way to print multiple tables without SubReports?

    - by Eduardo Molteni
    I'm generating the RDLC XML schema and showing the report in the ReportViewer control. No problems there. Now, I want a report with 2 tables, with 2 differents dataset. Something like this gets generated: <Body> <ReportItems> <Table Name="Table1"> .... </Table> <Table Name="Table2"> .... </Table> </ReportItems> </Body> But, when printed, both tables start from the top, printing on table over the other (not nice) Is there a way to tell that Table2 should start after Table1? Update: I've tried with List with a fake DataSource, but it does not work.

    Read the article

  • grails gsp test evaluates to false, but block is still rendered. Why?

    - by ?????
    I'm baffled with Grails test operator. This expression: <g:if test="${!(preferences.displayOption.equals('ANA') || preferences.displayOption.equals('FLOP'))} "> ${!(preferences.displayOption.equals('ANA') || preferences.displayOption.equals('FLOP'))} </g:if> prints false How can that be? I'm printing the exact same condition I'm testing for! even though I'm certain the test condition evaluates to 'false' because it prints false in the very next line, the statements inside the g:if are being rendered. Anu ideas as to what's going on.

    Read the article

  • smart reversing of compressed javascript with obscured variable & function names ?

    - by Jerome WAGNER
    Hello, I want to know if there exists a tool to help in reversing a compressed javascript that has obscure variable names. I am not looking for a pretty-printing beautifier, but for a tool that actually know a to change & propagate variable name choices. Let me be more specific : - some of the functions belong to the 'public' API and i want to impose readable argument names in their prototypes - there are intermediary variables for document, window and other browser idioms I would like to give this knowledge to the tool and then let it create another javascript where the knowledge would have been correctly propagated. thanks Jerome Wagner

    Read the article

  • Why can't the JVM just make autoboxing "just work"?

    - by Pyrolistical
    Autoboxing is rather scary. While I fully understand the difference between == and .equals I can't but help have the follow bug the hell out of me: final List<Integer> foo = Arrays.asList(1, 1000); final List<Integer> bar = Arrays.asList(1, 1000); System.out.println(foo.get(0) == bar.get(0)); System.out.println(foo.get(1) == bar.get(1)); That prints true false Why did they do it this way? It something to do with cached Integers, but if that is the case why don't they just cache all Integers used by the program? Or why doesn't the JVM always auto unbox to primitive? Printing false false or true true would have been way better.

    Read the article

  • Get input from user with ActivityBuilder in WF 4

    - by avi1234
    Hi, I am trying to write a simple activity that received from the user its name and printing "hello + username" message. the problem is that i cannot access to the username input via code. the function is: static ActivityBuilder CreateTask1() { Dictionary<string, object> properties = new Dictionary<string, object>(); properties.Add("User_Name", new InArgument<string>()); var res = new ActivityBuilder(); res.Name = "Task1"; foreach (var item in properties) { res.Properties.Add(new DynamicActivityProperty { Name = item.Key, Type = item.Value.GetType(), Value = item.Value }); } Sequence c = new Sequence(); c.Activities.Add(new WriteLine { Text = "Hello " + properties["User_Name"] }); res.Implementation = c; return res; } The output of the followed will always be "Hello User_Name". Thanks!

    Read the article

  • How to fill a webdynpro table binded to a BAPI initially?

    - by Philipp Andre
    Hello SAP-Gurus, im fairly new to webdynpro abap and have the following problem: I created a service returning a set of all existing customers. This function works well, if i test it in a litte program simply printing out the lines. now i created a webdynpro containing a table to display these customers. I also did the binding! AND it works, but only if an event fires the execute...function. What i need is kind of "execute initially", means that the function gets executed when the table initially loads. How can i do this? Best regards Philipp

    Read the article

  • When will NAnt reach version 1.0

    - by sundar venugopal
    I like Nant very much. I do a lot of scripting with NAnt. It is a great little tool. Since NAnt is pre 1.0, when problems occur, I often think if that it is a problem with NAnt itself, but this is not always the case. One funny example: After running the oracle scripts I parsed the log output to make sure there was no problem. I was testing this with a small log file and it was fine. I used the task to load the file contents to a string property and used a regex to search for errors. When I used this script for a large log file, I stopped getting the "build failed" message at the bottom, because I was printing the error messages. Because the "build failed" was hiding at the top, I thought NAnt crashed, but it worked fine. It would be better for NAnt to have a 1.0 release. Any reasons why not?

    Read the article

< Previous Page | 77 78 79 80 81 82 83 84 85 86 87 88  | Next Page >