Search Results

Search found 24391 results on 976 pages for 'static methods'.

Page 81/976 | < Previous Page | 77 78 79 80 81 82 83 84 85 86 87 88  | Next Page >

  • C# extension method doesn't seem to exist

    - by blahblah
    I can't seem to get the following extension method to be found in another class in the same namespace (MyProject.Util). using System.Collections.Specialized; namespace MyProject.Util { public static class Extensions { public static string Get( this NameValueCollection me, string key, string def ) { return me[key] ?? def; } } } As you can see it's basically another version of foo[bar] ?? baz, but I still don't understand why VS2008 fails to compile telling me that no version of Get takes two arguments. Any ideas?

    Read the article

  • Integrating Magento with a simple static website.

    - by ExtraLean
    Magento is an awesomely powerful ecommerce platform. That said, it is also very complex, and I'd like to know if there is a relatively simple way to utilize Magento as our mISV site's backend to fulfill orders without actually "using" Magento's framework to build the site, run the site, etc. In other words, I don't want to use the built-in CMS, etc. since we have a static website already built. I'd just like our Buy Now buttons to utilize the checkout stuff, and would like to be able to use the back-end part to keep track of orders etc. I was able to accomplish this "fairly" easily with osCommerce, but Magento is proving to be a little more difficult to wrap my head around since I've only started looking at it for a few days now. I found another person asking this same exact question on the Magento wiki (along with several others in the forum), and none of them ever receive a reply for some reason. I noticed that there are may Magento experts on Stack Overflow, so I thought I'd give it a go here. This is an example of one question asked by someone on their wiki, and it captures the essence of what I'm trying to accomplish: Hi, as far as I understand, all shopping cart/eCommerce solutions I see are full featured PHP driven web sites. This means that all the pages the user interacts with, are server generated, and thus, the experience, is tied to the magento framework/workflow. I’d like to integrate bits and pieces of eCommerce/shopping cart in my existing website. Effectively, I’d like to have: 1) on a product information page, a “buy now/add to cart” button that adds to a cart 2) on every page, a view cart/checkout option 3) on a checkout page, with additional content already in place, having the magento “checkout” block integrated in the page (and not the entire page generated from Magento). Have any of you done this with Magento? This is for a simple one-product website so any advice you could share would be highly appreciated.

    Read the article

  • Sticky/static variable references in for loops

    - by pthulin
    In this example I create three buttons 'one' 'two' 'three'. When clicked I want them to alert their number: <html> <head> <script type="application/javascript" src="jquery.js"></script> <script type="application/javascript"> $(document).ready(function() { var numbers = ['one', 'two', 'three']; for (i in numbers) { var nr = numbers[i]; var li = $('<li>' + nr + '</li>'); li.click(function() { var newVariable = String(nr); alert(i); // 2 alert(nr); // three alert(newVariable); // three alert(li.html()); // three }); $('ul').append(li); } }); </script> </head> <body> <ul> </ul> </body> </html> The problem is, when any of these are clicked, the last value of the loop's variables is used, i.e. alert box always says 'three'. In JavaScript, variables inside for-loops seem to be 'static' in the C language sense. Is there some way to create separate variables for each click function, i.e. not using the same reference? Thanks!

    Read the article

  • Inereritance of clousure objects and overriding of methods

    - by bobikk
    I need to extend a class, which is encapsulated in a closure. This base class is following: var PageController = (function(){ // private static variable var _current_view; return function(request, new_view) { ... // priveleged public function, which has access to the _current_view this.execute = function() { alert("PageController::execute"); } } })();` Inheritance is realised using the following function: function extend(subClass, superClass){ var F = function(){ }; F.prototype = superClass.prototype; subClass.prototype = new F(); subClass.prototype.constructor = subClass; subClass.superclass = superClass.prototype; StartController.cache = ''; if (superClass.prototype.constructor == Object.prototype.constructor) { superClass.prototype.constructor = superClass; } } I subclass the PageController: var StartController = function(request){ // calling the constructor of the super class StartController.superclass.constructor.call(this, request, 'start-view'); } // extending the objects extend(StartController, PageController); // overriding the PageController::execute StartController.prototype.execute = function() { alert('StartController::execute'); } Inheritance is working. I can call every PageController's method from StartController's instance. However, method overriding doesn't work: var startCont = new StartController(); startCont.execute(); alerts "PageController::execute". How should I override this method?

    Read the article

  • Why is one Func valid and the other (almost identical) not.

    - by runrunraygun
    private static Dictionary<Type, Func<string, object>> _parseActions = new Dictionary<Type, Func<string, object>> { { typeof(bool), value => {Convert.ToBoolean(value) ;}} }; The above gives an error Error 14 Not all code paths return a value in lambda expression of type 'System.Func<string,object>' However this below is ok. private static Dictionary<Type, Func<string, object>> _parseActions = new Dictionary<Type, Func<string, object>> { { typeof(bool), value => Convert.ToBoolean(value) } }; I don't understand the difference between the two. I thought the extra braces in example1 are to allow us to use multiple lines in the anon function so why have they affected the meaning of the code?

    Read the article

  • how to create static line in coreplot

    - by Rémi Bédard-Couture
    I am trying to make my control lines static so instead of being displayed as part of the graph(the control lines are moving with the graph), they would be displayed like an axis the app can only scroll horizontally i'm talking about the two red line and the green line(which i put over the x axis) this is how i do my lines: // Center line CPTScatterPlot *centerLinePlot = [[CPTScatterPlot alloc] init]; centerLinePlot.identifier = kCenterLine; CPTMutableLineStyle *lineStyle = [CPTMutableLineStyle lineStyle]; lineStyle.lineWidth = 2.0; lineStyle.lineColor = [CPTColor greenColor]; centerLinePlot.dataLineStyle = lineStyle; centerLinePlot.dataSource = self; [graph addPlot:centerLinePlot]; but maybe it has something to do with the displayed range: ////////ajuste la portion a voir if(data.Resultats.count>10) { plotSpace.xRange = [CPTPlotRange plotRangeWithLocation:CPTDecimalFromDouble(data.Resultats.count - 10) length:CPTDecimalFromDouble(10)]; } plotSpace.yRange = [CPTPlotRange plotRangeWithLocation:CPTDecimalFromDouble(RangeMin) length:CPTDecimalFromDouble(RangeMax-RangeMin)]; // Adjust visible ranges so plot symbols along the edges are not clipped CPTMutablePlotRange *xRange = [plotSpace.xRange mutableCopy]; CPTMutablePlotRange *yRange = [plotSpace.yRange mutableCopy]; //place l'axe x sur la ligne de controle pour voir les WorkOrders x.orthogonalCoordinateDecimal = CPTDecimalFromDouble(center); //x.orthogonalCoordinateDecimal = yRange.location; //y.orthogonalCoordinateDecimal = xRange.location; //x.visibleRange = xRange; //y.visibleRange = yRange; //x.gridLinesRange = yRange; //y.gridLinesRange = xRange; [xRange expandRangeByFactor:CPTDecimalFromDouble(1.15)];//1.05 [yRange expandRangeByFactor:CPTDecimalFromDouble(1.15)]; plotSpace.xRange = xRange; plotSpace.yRange = yRange;

    Read the article

  • dynamic lib can't find static lib

    - by renyufei
    env: gcc version 4.4.1 (Ubuntu 4.4.1-4ubuntu9) app: Bin(main) calls dynamic lib(testb.so), and testb.so contains a static lib(libtesta.a). file list: main.c test.h a.c b.c then compile as: gcc -o testa.o -c a.c ar -r libtesta.a testa.o gcc -shared -fPIC -o testb.so b.c gcc -o main main.c -L. -ltesta -ldl then compile success, but runs an error: ./main: symbol lookup error: ./testb.so: undefined symbol: print code as follows: test.h #include <stdio.h> #include <stdlib.h> #include <errno.h> #include <string.h> #include <dlfcn.h> int printa(const char *msg); int printb(const char *msg); a.c #include "test.h" int printa(const char *msg) { printf("\tin printa\n"); printf("\t%s\n", msg); } b.c #include "test.h" int printb(const char *msg) { printf("in printb\n"); printa("called by printb\n"); printf("%s\n", msg); } main.c #include "test.h" int main(int argc, char **argv) { void *handle; int (*dfn)(const char *); printf("before dlopen\n"); handle = dlopen("./testb.so", RTLD_LOCAL | RTLD_LAZY); printf("after dlopen\n"); if (handle == NULL) { printf("dlopen fail: [%d][%s][%s]\n", \ errno, strerror(errno), dlerror()); exit(EXIT_FAILURE); } printf("before dlsym\n"); dfn = dlsym(handle, "printb"); printf("after dlsym\n"); if (dfn == NULL) { printf("dlsym fail: [%d][%s][%s]\n", \ errno, strerror(errno), dlerror()); exit(EXIT_FAILURE); } printf("before dfn\n"); dfn("printb func\n"); printf("after dfn\n"); exit(EXIT_SUCCESS); }

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • What to name 2 methods with same signatures

    - by coffeeaddict
    Initially I had a method in our DL that would take in the object it's updating like so: internal void UpdateCash(Cash Cash) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set captureID = @captureID, ac_code = @acCode, captureDate = @captureDate, errmsg = @errorMessage, isDebit = @isDebit, SourceInfoID = @sourceInfoID, PayPalTransactionInfoID = @payPalTransactionInfoID, CreditCardTransactionInfoID = @CreditCardTransactionInfoID where id = @cashID"; conn.AddParam("@captureID", cash.CaptureID); conn.AddParam("@acCode", cash.ActionCode); conn.AddParam("@captureDate", cash.CaptureDate); conn.AddParam("@errorMessage", cash.ErrorMessage); conn.AddParam("@isDebit", cyberCash.IsDebit); conn.AddParam("@PayPalTransactionInfoID", cash.PayPalTransactionInfoID); conn.AddParam("@CreditCardTransactionInfoID", cash.CreditCardTransactionInfoID); conn.AddParam("@sourceInfoID", cash.SourceInfoID); conn.AddParam("@cashID", cash.Id); conn.ExecuteNonQuery(); } } My boss felt that creating an object every time just to update one or two fields is overkill. But I had a couple places in code using this. He recommended using just UpdateCash and sending in the ID for CAsh and field I want to update. Well the problem is I have 2 places in code using my original method. And those 2 places are updating 2 completely different fields in the Cash table. Before I was just able to get the existing Cash record and shove it into a Cash object, then update the properties I wanted to be updated in the DB, then send back the cash object to my method above. I need some advice on what to do here. I have 2 methods and they have the same signature. I'm not quite sure what to rename these because both are updating 2 completely different fields in the Cash table: internal void UpdateCash(int cashID, int paypalCaptureID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set CaptureID = @paypalCaptureID where id = @cashID"; conn.AddParam("@captureID", paypalCaptureID); conn.ExecuteNonQuery(); } } internal void UpdateCash(int cashID, int PayPalTransactionInfoID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set PaymentSourceID = @PayPalTransactionInfoID where id = @cashID"; conn.AddParam("@PayPalTransactionInfoID", PayPalTransactionInfoID); conn.ExecuteNonQuery(); } } So I thought hmm, maybe change the names to these so that they are now unique and somewhat explain what field its updating: UpdateCashOrderID UpdateCashTransactionInfoID ok but that's not really very good names. And I can't go too generic, for example: UpdateCashTransaction(int cashID, paypalTransactionID) What if we have different types of transactionIDs that the cash record holds besides just the paypalTransactionInfoID? such as the creditCardInfoID? Then what? Transaction doesn't tell me what kind. And furthermore what if you're updating 2 fields so you have 2 params next to the cashID param: UpdateCashTransaction(int cashID, paypalTransactionID, someOtherFieldIWantToUpdate) see my frustration? what's the best way to handle this is my boss doesn't like my first route?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to unit test private methods in BDD / TDD?

    - by robert_d
    I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

    Read the article

  • HP LaserJet 4250 Printer Networking Problems

    - by MHrappstead
    We've been trying to assign a static IP address to an HP LaserJet 4250 Printer. When we click on the networking tab it asks for a username and password, however it says the admin user is Unauthorized. We've tried IE 8, Firefox, and Chrome and have even updated the firmware to the latest version.

    Read the article

  • C: Global ,Static variables understanding

    - by pavun_cool
    Hi All, In following program . I have one doubt. I have declared one global variable . I am printing the address of the global variable in the function . It is giving me same address when I am not changing the value of global . If I did any changes in the global variables It is giving me different address why...........? Like that it is happening for static also. #include<stdio.h> int global=10 ; // Global variables void function(); main() { global=20; printf ( " %p \n" , global ) ; printf ( " Val: %d\n", global ) ; function(); new(); } void function() { global=30; printf ( " %p \n" , global ) ; printf ( " Val: %d\n", global ) ; } Thanks.

    Read the article

  • How do I avoid boxing/unboxing when extending System.Object?

    - by Robert H.
    I'm working on an extension method that's only applicable to reference types. I think, however, it's currently boxing and unboxing the the value. How can I avoid this? namespace System { public static class SystemExtensions { public static TResult GetOrDefaultIfNull<T, TResult>(this T obj, Func<T, TResult> getValue, TResult defaultValue) { if (obj == null) return defaultValue; return getValue(obj); } } } Example usage: public class Foo { public int Bar { get; set; } } In some method: Foo aFooObject = new Foo { Bar = 1 }; Foo nullReference = null; Console.WriteLine(aFooObject.GetOrDefaultIfNull((o) => o.Bar, 0)); // results: 1 Console.WriteLine(nullReference.GetOrDefaultIfNull((o) => o.Bar, 0)); // results: 0

    Read the article

  • How to set a static system date for one user or application--"Groundhog Day"

    - by aixylinux
    I have a vendor application on AIX which requires the system date to be set to an arbitrary value for QA testing purposes. The application gets its date from the system, and there is no possibility of changing it to get the date from a parameter. The application runs under a specific userid. I'd like to find a way to set the date for this application or user to a private value without affecting all the other users and applications on the system. So far the only thing I have been able to do is dedicate an LPAR to this application. Every day at midnight a root crontab job resets the date to the static value. This works, but it is wasteful of resources; and now I am faced the requirement to do this for other applications, which, of course, require different dates. Is there any clever solution to this? I need a way to create a sandboxed environment where the date returned from the system can be set to a private value. As I said, the OS is AIX, and that can't be changed for this application either.

    Read the article

  • Working with Java using methods and arrays [closed]

    - by jordan
    Hi i'm a newb at java and for one of my labs I have to create a instant messenger client with these requirements: add buddyList instance variable add IMClient constructor to create ArrayList addBuddy method removeBuddy method findBuddy method printBuddyList method what's the best way to go about this? so far I have this: public class IMClient { private String userId; // User id private String password; // Password private int status; // Status code for user: 1 - Online, 2 - Off-line, 3 - Away public IMClient(String userId, String password, int status) { super(); this.userId = userId; this.password = password; this.status = status; } // Returns true if password as a parameter matches password instance variable. public boolean checkPassword(String password) { return this.password.equals(password); } public String toString() { StringBuffer buf = new StringBuffer(100); buf.append(" User id: "); buf.append(userId); buf.append(" Password: "); buf.append(password); buf.append(" Status: "); buf.append(status); return buf.toString(); } public String getUserId() { return userId; } public void setUserId(String userId) { this.userId = userId; } public String getPassword() { return password; } public void setPassword(String password) { this.password = password; } public int getStatus() { return status; } public void setStatus(int status) { this.status = status; } public static void main(String[] args) { } }

    Read the article

  • Behaviour to simulate an enum implementing an interface

    - by fearofawhackplanet
    Say I have an enum something like: enum OrderStatus { AwaitingAuthorization, InProduction, AwaitingDespatch } I've also created an extension method on my enum to tidy up the displayed values in the UI, so I have something like: public static string ToDisplayString(this OrderStatus status) { switch (status) { case Status.AwaitingAuthorization: return "Awaiting Authorization"; case Status.InProduction: return "Item in Production"; ... etc } } Inspired by the excellent post here, I want to bind my enums to a SelectList with an extension method: public static SelectList ToSelectList<TEnum>(this TEnum enumObj) however, to use the DisplayString values in the UI drop down I'd need to add a constraint along the lines of : where TEnum has extension ToDisplayString Obviously none of this is going to work at all with the current approach, unless there's some clever trick I don't know about. Does anyone have any ideas about how I might be able to implement something like this?

    Read the article

  • Any workarounds for non-static member array initialization?

    - by TomiJ
    In C++, it's not possible to initialize array members in the initialization list, thus member objects should have default constructors and they should be properly initialized in the constructor. Is there any (reasonable) workaround for this apart from not using arrays? [Anything that can be initialized using only the initialization list is in our application far preferable to using the constructor, as that data can be allocated and initialized by the compiler and linker, and every CPU clock cycle counts, even before main. However, it is not always possible to have a default constructor for every class, and besides, reinitializing the data again in the constructor rather defeats the purpose anyway.] E.g. I'd like to have something like this (but this one doesn't work): class OtherClass { private: int data; public: OtherClass(int i) : data(i) {}; // No default constructor! }; class Foo { private: OtherClass inst[3]; // Array size fixed and known ahead of time. public: Foo(...) : inst[0](0), inst[1](1), inst[2](2) {}; }; The only workaround I'm aware of is the non-array one: class Foo { private: OtherClass inst0; OtherClass inst1; OtherClass inst2; OtherClass *inst[3]; public: Foo(...) : inst0(0), inst1(1), inst2(2) { inst[0]=&inst0; inst[1]=&inst1; inst[2]=&inst2; }; }; Edit: It should be stressed that OtherClass has no default constructor, and that it is very desirable to have the linker be able to allocate any memory needed (one or more static instances of Foo will be created), using the heap is essentially verboten. I've updated the examples above to highlight the first point.

    Read the article

  • Strange behavior when overloading methods in Java

    - by Sep
    I came across this weird (in my opinion) behavior today. Take this simple Test class: public class Test { public static void main(String[] args) { Test t = new Test(); t.run(); } private void run() { List<Object> list = new ArrayList<Object>(); list.add(new Object()); list.add(new Object()); method(list); } public void method(Object o) { System.out.println("Object"); } public void method(List<Object> o) { System.out.println("List of Objects"); } } It behaves the way you expect, printing "List of Objects". But if you change the following three lines: List<String> list = new ArrayList<String>(); list.add(""); list.add(""); you will get "Object" instead. I tried this a few other ways and got the same result. Is this a bug or is it a normal behavior? And if it is normal, can someone explain why? Thanks.

    Read the article

  • Difference dynami static 2d array c++

    - by snorlaks
    Hello, Im using opensource library called wxFreeChart to draw some XY charts. In example there is code which uses static array as a serie : double data1[][2] = { { 10, 20, }, { 13, 16, }, { 7, 30, }, { 15, 34, }, { 25, 4, }, }; dataset-AddSerie((double *) data1, WXSIZEOF(dynamicArray)); WXSIZEOF ismacro defined like: sizeof(array)/sizeof(array[0]) In this case everything works great but in my program Im using dynamic arrays (according to users input). I made a test and wrotecode like below: double **dynamicArray = NULL; dynamicArray = new double *[5] ; for( int i = 0 ; i < 5 ; i++ ) dynamicArray[i] = new double[2]; dynamicArray [0][0] = 10; dynamicArray [0][1] = 20; dynamicArray [1][0] = 13; dynamicArray [1][1] = 16; dynamicArray [2][0] = 7; dynamicArray [2][1] = 30; dynamicArray [3][0] = 15; dynamicArray [3][1] = 34; dynamicArray [4][0] = 25; dynamicArray [4][1] = 4; dataset-AddSerie((double *) *dynamicArray, WXSIZEOF(dynamicArray)); But it doesnt work correctly. I mean point arent drawn. I wonder if there is any possibility that I can "cheat" that method and give it dynamic array in way it understands it and will read data from correct place thanks for help

    Read the article

  • Trouble with abstract generic methods

    - by DanM
    Let's say I have a class library that defines a couple entity interfaces: public interface ISomeEntity { /* ... */ } public interface ISomeOtherEntity { /* ... */ } This library also defines an IRepository interface: public interface IRepository<TEntity> { /* ... */ } And finally, the library has an abstract class called RepositorySourceBase (see below), which the main project needs to implement. The goal of this class is to allow the base class to grab new Repository objects at runtime. Because certain repositories are needed (in this example a repository for ISomeEntity and ISomeOtherEntity), I'm trying to write generic overloads of the GetNew<TEntity>() method. The following implementation doesn't compile (the second GetNew() method gets flagged as "already defined" even though the where clause is different), but it gets at what I'm trying to accomplish: public abstract class RepositorySourceBase // This doesn't work! { public abstract Repository<TEntity> GetNew<TEntity>() where TEntity : SomeEntity; public abstract Repository<TEntity> GetNew<TEntity>() where TEntity : SomeOtherEntity; } The intended usage of this class would be something like this: public class RepositorySourceTester { public RepositorySourceTester(RepositorySourceBase repositorySource) { var someRepository = repositorySource.GetNew<ISomeEntity>(); var someOtherRepository = repositorySource.GetNew<ISomeOtherEntity>(); } } Meanwhile, over in my main project (which references the library project), I have implementations of ISomeEntity and ISomeOtherEntity: public class SomeEntity : ISomeEntity { /* ... */ } public class SomeOtherEntity : ISomeOtherEntity { /* ... */ } The main project also has an implementation for IRepository<TEntity>: public class Repository<TEntity> : IRepository<TEntity> { public Repository(string message) { } } And most importantly, it has an implementation of the abstract RepositorySourceBase: public class RepositorySource : RepositorySourceBase { public override Repository<SomeEntity> GetNew() { return new Repository<SomeEntity>("stuff only I know"); } public override Repository<SomeOtherEntity> GetNew() { return new Repository<SomeOtherEntity>("other stuff only I know"); } } Just as with RepositorySourceBase, the second GetNew() method gets flagged as "already defined". So, C# basically think I'm repeating the same method because there's no way to distinguish the methods from parameters, but if you look at my usage example, it seems like I should be able to distinguish which GetNew() I want from the generic type parameter, e.g, <ISomeEntity> or <ISomeOtherEntity>. What do I need to do to get this to work?

    Read the article

  • "Method name expected" error when trying add a handler method to a delegate - C#

    - by zakplayyy
    I keep getting the error "Method name expected" when trying add the a method to a delegate. I have a delegate which is invoked when ever my game ends. The function I'm trying to add to the delegate stops a countdown from flashing (the method is in a static class). I've searched about and I'm still unsure why its not working. Here is the line causing the error: LivesManager.gameEnded += new LivesManager.EndGame(CountdownManager.DisableFlashTimer(this)); The this passes the current form to the method so it can disable the timer flash on the form. I have added methods from static classes to the same delegate before and it works fine, the only difference is that I'm passing the form as a paramater and then it doesn't like it. Is there any way to pass the form to the method without the error? Thanks in advance :)

    Read the article

  • Most awkward/misleading method in Java Base API ?

    - by JG
    I was recently trying to convert a string literal into a boolean, when the method "boolean Boolean.getBoolean(String name)" popped out of the auto-complete window. There was also another method ("boolean Boolean.parseBoolean(String s)") appearing right after, which lead me to search to find out what were the differences between these two, as they both seemed to do the same. It turns out that what Boolean.getBoolean(String name) really does is to check if there exists a System property (!) of the given name and if its value is true. I think this is very misleading, as I'm definitely not expecting that a method of Boolean is actually making a call to System.getProperty, and just by looking at the method signature, it sure looks (at least to me) like it should be used to parse a String as a boolean. Sure, the javadoc states it clearly, but I still think the method has a misleading name and is not in the right place. Other primitive type wrappers, such as Integer also have a similar method. Also, it doesn't seem to be a very useful method to belong in the base API, as I think it's not very common to have something like -Darg=true. Maybe it's a good question for a Java position interview: "What is the output of Boolean.getBoolean("true")?". I believe a more appropriate place for those methods would be in the System class, e.g., getPropertyAsBoolean; but again, I still think it's unnecessary to have these methods in the base API. It'd make sense to have these in something like the Properties class, where it's very common to do this kind of type conversions. What do you think of all this ? Also, if there's another "awkward" method that you're aware of, please post it. N.B. I know I can use Boolean.valueOf or Boolean.parseBoolean to convert a string literal into a boolean, but I'm just looking to discuss the API design.

    Read the article

  • C# Method not returning a unique value when it should be.

    - by Josh King
    I have two methods, generateNounPhrase() and generateVerbPhrase(). VerbPhrase will call on NounPhrase half the time and it's output the output should be something to the effect of: the empty lot re-animates this pyramid (bold indicating where generateNounPhrase() is logically called). The true output however is in the form of: the empty lot re-animates the empty lot At first I thought my randomIndex method wasn't working as I had intended, but if I run the two methods again I do get different noun phrases but they are not unique at the beginning and end of the sentence as they should be. Any idea what I am doing wrong in order to get one method to show the same result? private string generateNounPhrase() { string nounPhraseString = ""; nounPhraseString = nounMarkersStringList[randomIndex(0,nounMarkersStringList.Count-1)]; if (included(1, 4, 2) == true) { nounPhraseString += " " + adjectivesStringList[randomIndex(0, adjectivesStringList.Count - 1)]; } nounPhraseString += " " + nounsStringList[randomIndex(0, nounsStringList.Count - 1)]; return nounPhraseString; } private string generateVerbPhrase() { string verbPhraseString = ""; if (included(1, 4, 2) == true) { verbPhraseString = intransitiveVerbsStringList[randomIndex(0, intransitiveVerbsStringList.Count - 1)]; } else { verbPhraseString = transitiveVerbsStringList[randomIndex(0, transitiveVerbsStringList.Count - 1)] + " " + generateNounPhrase(); } return verbPhraseString; }

    Read the article

< Previous Page | 77 78 79 80 81 82 83 84 85 86 87 88  | Next Page >