Search Results

Search found 22835 results on 914 pages for 'applications menu'.

Page 827/914 | < Previous Page | 823 824 825 826 827 828 829 830 831 832 833 834  | Next Page >

  • Custom model validation of dependent properties using Data Annotations

    - by Darin Dimitrov
    Since now I've used the excellent FluentValidation library to validate my model classes. In web applications I use it in conjunction with the jquery.validate plugin to perform client side validation as well. One drawback is that much of the validation logic is repeated on the client side and is no longer centralized at a single place. For this reason I'm looking for an alternative. There are many examples out there showing the usage of data annotations to perform model validation. It looks very promising. One thing I couldn't find out is how to validate a property that depends on another property value. Let's take for example the following model: public class Event { [Required] public DateTime? StartDate { get; set; } [Required] public DateTime? EndDate { get; set; } } I would like to ensure that EndDate is greater than StartDate. I could write a custom validation attribute extending ValidationAttribute in order to perform custom validation logic. Unfortunately I couldn't find a way to obtain the model instance: public class CustomValidationAttribute : ValidationAttribute { public override bool IsValid(object value) { // value represents the property value on which this attribute is applied // but how to obtain the object instance to which this property belongs? return true; } } I found that the CustomValidationAttribute seems to do the job because it has this ValidationContext property that contains the object instance being validated. Unfortunately this attribute has been added only in .NET 4.0. So my question is: can I achieve the same functionality in .NET 3.5 SP1? UPDATE: It seems that FluentValidation already supports clientside validation and metadata in ASP.NET MVC 2. Still it would be good to know though if data annotations could be used to validate dependent properties.

    Read the article

  • Set-Cookie error appearing in logs when deployed to google appengine

    - by Jesse
    I have been working towards converting one of our applications to be threadsafe. When testing on the local dev app server everything is working as expected. However, upon deployment of the application it seems that Cookies are not being written correctly? Within the logs there is an error with no stack trace: 2012-11-27 16:14:16.879 Set-Cookie: idd_SRP=Uyd7InRpbnlJZCI6ICJXNFdYQ1ZITSJ9JwpwMAou.Q6vNs9vGR-rmg0FkAa_P1PGBD94; expires=Wed, 28-Nov-2012 23:59:59 GMT; Path=/ Here is the block of code in question: # area of the code the emits the cookie cookie = Cookie.SimpleCookie() if not domain: domain = self.__domain self.__updateCookie(cookie, expires=expires, domain=domain) self.__updateSessionCookie(cookie, domain=domain) print cookie.output() Cookie helper methods: def __updateCookie(self, cookie, expires=None, domain=None): """ Takes a Cookie.SessionCookie instance an updates it with all of the private persistent cookie data, expiry and domain. @param cookie: a Cookie.SimpleCookie instance @param expires: a datetime.datetime instance to use for expiry @param domain: a string to use for the cookie domain """ cookieValue = AccountCookieManager.CookieHelper.toString(self.cookie) cookieName = str(AccountCookieManager.COOKIE_KEY % self.partner.pid) cookie[cookieName] = cookieValue cookie[cookieName]['path'] = '/' cookie[cookieName]['domain'] = domain if not expires: # set the expiry date to 1 day from now expires = datetime.date.today() + datetime.timedelta(days = 1) expiryDate = expires.strftime("%a, %d-%b-%Y 23:59:59 GMT") cookie[cookieName]['expires'] = expiryDate def __updateSessionCookie(self, cookie, domain=None): """ Takes a Cookie.SessionCookie instance an updates it with all of the private session cookie data and domain. @param cookie: a Cookie.SimpleCookie instance @param expires: a datetime.datetime instance to use for expiry @param domain: a string to use for the cookie domain """ cookieValue = AccountCookieManager.CookieHelper.toString(self.sessionCookie) cookieName = str(AccountCookieManager.SESSION_COOKIE_KEY % self.partner.pid) cookie[cookieName] = cookieValue cookie[cookieName]['path'] = '/' cookie[cookieName]['domain'] = domain Again, the libraries in use are: Python 2.7 Django 1.2 Any suggestion on what I can try?

    Read the article

  • DDD and Client/Server apps

    - by Christophe Herreman
    I was wondering if any of you had successfully implemented DDD in a Client/Server app and would like to share some experiences. We are currently working on a smart client in Flex and a backend in Java. On the server we have a service layer exposed to the client that offers CRUD operations amongst some other service methods. I understand that in DDD these services should be repositories and services should be used to handle use cases that do not fit inside a repository. Right now, we mimic these services on the client behind an interface and inject implementations (Webservices, RMI, etc) via an IoC container. So some questions arise: should the server expose repositories to the client or do we need to have some sort of a facade (that is able to handle security for instance) should the client implement repositories (and DDD in general?) knowing that in the client, most of the logic is view related and real business logic lives on the server. All communication with the server happens asynchronously and we have a single threaded programming model on the client. how about mapping client to server objects and vice versa? We tried DTO's but reverted back to exposing the state of our objects and mapping directly to them. I know this is considered bad practice, but it saves us an incredible amount of time) In general I think a new generation of applications is coming with the growth of Flex, Silverlight, JavaFX and I'm curious how DDD fits into this.

    Read the article

  • Link Maven OSGi to Maven NetBeans Platform Project

    - by mxro
    I am using NetBeans 6.9 Beta and I would like to accomplish the following: Set up a project representing the main application using Maven (for instance "Maven Project", "Maven NetBeans Application") Ideally, the project should only contain the necessary libraries to run in Apache Felix (I would like to be able to right-click the project and select "Run in Felix") I do not want that the project contains all the NetBean Platform APIs I would prefer to implement the modules using OSGi. For instance "Maven OSGi Bundle", "Maven NetBeans Module" + OSGi These are the problems, which I have at the moment: The standard Maven archetype ("Maven NetBeans Application") seems always to select all APIs and I have not found a way to deselect APIs - in normal NetBeans Platform Applications that can be accomplished by going to the project properties and deselected the platform modules) - I guess it has something to do with the NetBeans repository (http://bits.netbeans.org/maven2)? Do I have to create another repository? When creating normal "NetBeans Module" with OSGi support, the modules contain both NetBeans Module and OSGi meta data, which is nice. But the "Maven NetBeans Modules" have only NetBeans meta data and the Maven OSGi Bundles have only OSGi meta data). I figured out how to add modules to the project by using project / new and then placing the modules in the Maven project folder. However, I do not quite know yet how I could link to modules from other locations (NetBeans uses Maven modules, which have to be in the same directory as the project?). Below some useful links for Maven + OSGi in NetBeans wiki.netbeans.org/STS_69_Maven_OSGI NetBeans Maven OSGi Test Specification platform.netbeans.org/tutorials/nbm-maven-quickstart.html NetBeans Platform Quick Start Using Maven (6.9) wiki.netbeans.org/MavenBestPractices NetBeans Maven BestPractices maven.apache.org/pom.html#Aggregation Maven Documentation Multi-Module Projects (sorry about the missing protocol but couldn't post the message otherwise)

    Read the article

  • iPhone offline reading

    - by Andy
    Hi, first of all - I am quite new to iPhone App development (3 months). I am working for a software company that offers a content management system. Our customers are for the main part publishing houses for magazines. They use our software to write articles to their homepages. Now we want to offer iPhone Applications to go with our cms. What I have accomplished so far is an RSS reader that shows newly published articles in a list view. The user selects one article and is redirected to a specially formatted detail view of this article. The next step is to add offline reading capabilities. I have searched the internet up and down but couldn't find anything like a best practice for that. I get it that there are two possibilities in general: Store the contents of the uiwebview locally on the iPhone/iPad (including css, images, js and so on). There would be the need to rework the basic html to use the downloaded css, images and js. Also I would have to somehow edit hyperlinks to following pages in multipage articles - Sounds like a lot of work ;) Create a PDF on the server side and download that to the mobile device. Rework the RSS Source to point to the locally saved pdf instead of the website on the server. My question is - what is the better way to go? Are there any downsides for either of the possibilities? Are there other (simple ;)) ways to implement offline reading features? Are there possibly any howto's that I could've missed? Thanks y'all!

    Read the article

  • Z-Index and javascript for rollover

    - by Raffaele
    I have a container (div) with a background image. In this div there is a menu - a horizontal list. What I need is to insert an image onMouseOver, positioning it absolutely, and showing it behind the text (of course!) AND on top of the div's background image. I also use jQuery, but I think this doesn't matter. The problem can be viewed online. Go to http://www.w3schools.com/css/tryit.asp?filename=trycss_zindex and paste the following text <html> <head> <style type="text/css"> img { top: 0; left: 0; position:absolute; z-index:-1; } #main { color: red; margin: 30px; padding: 20px; width: 700px; min-height: 400px; z-index: -2; background-image: url("http://www.google.com/logos/mother10-hp.gif"); background-repeat: no-repeat; } </style> </head> <body> <div id="main"> <h1>Z-Index question:</h1> <img src="w3css.gif" width="100" height="140" /> <p>How can we place the green pic between the text and the div#main?</p> <p>I need the green gif to appear</p> <ol> <li>On top of #main's background image</li> <li>Behind the text</li> </ol> </div> </body> </html>

    Read the article

  • Non RBAC User Roles and Permissions System: checking the user's City

    - by micha12
    We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

    Read the article

  • Wordpress Template HTML CSS Layout Confusion

    - by Jess McKenzie
    I am having huge confusion with a template that I have purchased and I am trying to modify to handle a widget contact form. I am getting close with this but I have now muddled up the CSS or I have a feeling every page has a different CSS structure. The General Layout: What I Manage To Get: HTML View Source: <div id="innerright"> <div id="home" class="page"> <div id="homeslides"> <div class="welcomeslide"> <h1 class="large">Welcome</h1> </div> </div><!-- end home slides --> </div><!-- end page --> <div id="portfolio" class="page"> <div class="verticalline"> <div class="scrollprevnext"></div> </div> <div class="pageheader"> <h3><span>P</span>ortfolio</h3> </div><!--end pageheader --> <div id="portfolioscroller" class="scrollerenabledpage"> <div class="content"> <h5>Recent Work</h5> <ul class="thumb"> <li><a rel="precision_gallery" href="" title=""><img alt="" src="" /></a></li> </ul> </div> </div><!--end v scroll inner--> </div><!-- end page --> <div id="contact" class="page"> <div class="verticalline"> <div class="scrollprevnext"></div> </div> <div class="pageheader"> <h3><span>C</span>ontact</h3> </div><!--end pageheader --> <div id="contactscroller"> <h5>Get In Touch</h5> <div id="contactform">content</div> </div><!--end v scroll inner--> </div><!-- end page --> </div><!--end innerright--> CSS: CSS index.php: <!DOCTYPE HTML> <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> <title><?php bloginfo('name'); ?></title> <link rel="stylesheet" type="text/css" href="<?php echo get_template_directory_uri(); ?>/style.css" /> <link rel="stylesheet" type="text/css" href="<?php echo get_template_directory_uri(); ?>/fancybox/jquery.fancybox-1.3.4.css" media="screen" /> <?php // jquery will be included by wp_head function as well as scripts and styles by third party plugins wp_head(); ?> <script type="text/javascript" src="<?php echo get_template_directory_uri(); ?>/js/plugins.js"></script> <script type="text/javascript" src="<?php echo get_template_directory_uri(); ?>/js/script.js"></script> <script type="text/javascript" src="<?php echo get_template_directory_uri(); ?>/fancybox/jquery.fancybox-1.3.4.pack.js"></script> <?php // background image if one has been set via options if (function_exists('get_option_tree')) { $background_image = get_option_tree('precision_background_image'); //$background_image = ''; $background_color = get_option_tree('precision_background_color'); if ($background_color != '') { echo '<style>body { background-color:'.$background_color.'; }</style>'; } } ?> <script type="text/javascript"> jQuery(document).ready(function($) { $('.page').each(function(index, element) { $(this).css('left', index * 500); }); <?php // if background is set via the OptionTree then load it first if ($background_image != '') { ?> $.vegas({ src:'<?php echo $background_image; ?>', fade:1000, complete:function() { $("#wrapper").fadeIn(1000); $("#bgpanel").fadeIn(1000); $('#mainslide').crossSlide( { speed: 15, fade: 1 }, [ <?php echo $slides; ?> ] ) $('#homeslides').bxSlider({ mode: 'fade', auto: true, controls:false, speed:1000, pause:5000 }); } }); <?php } else { // if no background has been set then fade-in the page ?> $("#wrapper").fadeIn(1000); $("#bgpanel").fadeIn(1000); $('#mainslide').crossSlide( { speed: 15, fade: 1 }, [ //ENTER YOUR MAIN SLIDESHOW IMAGES HERE\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ <?php echo $slides; ?> ] ) $('#homeslides').bxSlider({ mode: 'fade', auto: true, controls:false, speed:1000, pause:5000 }); <?php } ?> //BX SLIDER INNER PAGE SCROLLERS//////////////////////// $('.scrollerenabledpage').each(function(index, element) { $('#' + $(this).attr('id')).bxSlider({ mode: 'vertical', easing: 'easeInOutQuint', auto: false, controls: true, prevImage:'<?php echo get_template_directory_uri(); ?>/images/up.png', nextImage:'<?php echo get_template_directory_uri(); ?>/images/down.png', infiniteLoop: false, hideControlOnEnd: true, pager: true, pagerType:'short', pagerShortSeparator:'of', speed:800, }); }); //END BX SLIDER INNER PAGE SCROLLERS///////////////// $('#submit').click(function(e) { e.preventDefault(); $('form').submit(); }); // contact form $('form').submit(function(e) { $('#main').append('<img src="<?php echo get_template_directory_uri(); ?>/images/loader.gif" class="loaderIcon" alt="Loading..." />'); $.post("<?php bloginfo('wpurl'); ?>/wp-admin/admin-ajax.php", {action:'precision_contact_form_handler', uname:$('input#uname').val(), uemail:$('input#uemail').val(), ucomments:$('textarea#ucomments').val()}, function(data) { $('#main img.loaderIcon').fadeOut(1000); if (data.status == "success") { $('#response').html("Forum has been successfully submitted."); } else { if (data.response != '') { $('#response').html(data.response); } else { $('#response').html("An error occurred while submitting the form. Please try again."); } } }, "json"); return false; }); }); //hides contact form labels when a field gets focus function initOverLabels () { if (!document.getElementById) return; var labels, id, field; labels = document.getElementsByTagName('label'); for (var i = 0; i < labels.length; i++) { if (labels[i].className == 'overlabel') { id = labels[i].htmlFor || labels[i].getAttribute('for'); if (!id || !(field = document.getElementById(id))) { continue; } labels[i].className = 'overlabel-apply'; if (field.value !== '') { hideLabel(field.getAttribute('id'), true); } field.onfocus = function () { hideLabel(this.getAttribute('id'), true); }; field.onblur = function () { if (this.value === '') { hideLabel(this.getAttribute('id'), false); } }; labels[i].onclick = function () { var id, field; id = this.getAttribute('for'); if (id && (field = document.getElementById(id))) { field.focus(); } }; } } }; function hideLabel(field_id, hide) { var field_for; var labels = document.getElementsByTagName('label'); for (var i = 0; i < labels.length; i++) { field_for = labels[i].htmlFor || labels[i].getAttribute('for'); if (field_for == field_id) { labels[i].style.textIndent = (hide) ? '-1000px' : '0px'; return true; } } } window.onload = function () { setTimeout(initOverLabels, 50); }; </script> <?php if (function_exists('get_option_tree')) { $precision_font_family_1 = get_option_tree('precision_font_family_1'); ?> <link href='http://fonts.googleapis.com/css?family=<?php echo $precision_font_family_1; ?>' rel='stylesheet' type='text/css'> <?php } ?> <style> h1, h2 { font-family:<?php echo $precision_font_family_1; ?>; } </style> </head> <body> <div id="wrapper"> <div id="innerleft"> <div id="header"> <?php if (function_exists('get_option_tree')) { $site_logo = get_option_tree('precision_site_logo'); ?> <a href="/" title="<?php bloginfo('name');?>"><img src="<?php echo $site_logo; ?>" alt="<?php bloginfo('name');?>" /></a> <?php } ?> </div><!--end header--> <?php if (function_exists('get_option_tree')) { $precision_slideshow_image = get_option_tree('precision_slideshow_image'); } ?> <ul id="nav"><!--Navigation--> <?php //instead of using wp_nav_menu, we use wp_get_nav_menu_items so that we can store the data in array and re-use it again //wp_nav_menu(array('theme_location' => 'precision-main-menu', 'container' => 'false')); $slt_menuItems = wp_get_nav_menu_items( "precision-main-menu" ); $menusItems = array(); foreach ($slt_menuItems as $slt_menuItem) { $page_title = $slt_menuItem->title; $menuItem = new stdClass; $menuItem->title = $page_title; $menuItem->page_id = $slt_menuItem->object_id; $menusItems[] = $menuItem; ?> <li id="<?php echo strtolower($page_title); ?>nav"><a href="#<?php echo strtolower($page_title); ?>"><?php echo $page_title; ?></a></li> <?php } ?> </ul> <div id="socialMedia"> <ul class="social"> <?php if (function_exists('get_option_tree')) { $twitter_link = get_option_tree('precision_twitter_link'); $facebook_link = get_option_tree('precision_facebook_link'); $gplus_link = get_option_tree('precision_gplus_link'); $delicious_link = get_option_tree('precision_delicious_link'); $flickr_link = get_option_tree('precision_flickr_link'); $vimeo_link = get_option_tree('precision_vimeo_link'); $youtube_link = get_option_tree('precision_youtube_link'); $linkedin_link = get_option_tree('precision_linkedin_link'); ?> <!-- start linkedin icon --> <?php if($linkedin_link != ''){ ?> <li><a href="<?php echo $linkedin_link;?>" title="Follow <?php bloginfo('name'); ?> on Linkedin"><img src="<?php echo get_template_directory_uri();?>/images/social-icons/linkedin.png" width="49" height="64" alt="<?php bloginfo('name'); ?> Linkedin"/></a><li> <?php } ?> <!-- end linkedin icon --> <!--start twitter icon--> <?php if ($twitter_link != '') { ?> <li><a href="<?php echo $twitter_link; ?>" title="Follow <?php bloginfo('name'); ?> on Twitter"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/twitter.png" width="49" height="64" alt="<?php bloginfo('name'); ?> Twitter" /></a></li> <?php } ?> <!--end twitter icon--> <!--start facebook icon--> <?php if ($facebook_link != '') { ?> <li><a href="<?php echo $facebook_link; ?>" title="Follow <?php bloginfo('name'); ?> on Facebook"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/facebook.png" width="49" height="64" alt="<?php bloginfo('name'); ?> Facebook" /></a></li> <?php } ?> <!--end facebook icon--> <!--start google plus icon--> <?php if ($gplus_link != '') { ?> <li><a href="<?php echo $gplus_link; ?>"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/google_plus.png" width="16" height="16" alt="google+" /></a></li> <?php } ?> <!--end google plus icon--> <!--start delicious icon--> <?php if ($delicious_link != '') { ?> <li><a href="<?php echo $delicious_link; ?>"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/delicious.png" width="16" height="16" alt="delicious" /></a></li> <?php } ?> <!--end delicious icon--> <!--start flickr icon--> <?php if ($flickr_link != '') { ?> <li><a href="<?php echo $flickr_link; ?>"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/flickr.png" width="16" height="16" alt="flickr" /></a></li> <?php } ?> <!--end flickr icon--> <!--start vimeo icon--> <?php if ($vimeo_link != '') { ?> <li><a href="<?php echo $vimeo_link; ?>"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/vimeo.png" width="16" height="16" alt="vimeo" /></a></li> <?php } ?> <!--end vimeo icon--> <!--start youtube icon--> <?php if ($youtube_link != '') { ?> <li><a href="<?php echo $youtube_link; ?>"><img src="<?php echo get_template_directory_uri(); ?>/images/social-icons/youtube.png" width="16" height="16" alt="youtube" /></a></li> <?php } ?> <!--end youtube icon--> <?php } ?> </ul> </div> </div><!--end innerleft--> <div id="innerright"> <?php if (function_exists('get_option_tree')) { $precision_home_page_option = get_option_tree('precision_home_page'); $precision_home_page = strtolower(get_the_title($precision_home_page_option)); if ($precision_home_page == '') { $precision_home_page = 'home'; } $precision_contact_page_option = get_option_tree('precision_contact_page'); $precision_contact_page = strtolower(get_the_title($precision_contact_page_option)); if ($precision_contact_page == '') { $precision_contact_page = 'contact'; } } foreach ($menusItems as $menuItem) { ?> <div id="<?php echo strtolower($menuItem->title); ?>" class="page"> <?php if (strtolower($menuItem->title) == $precision_home_page) { ?> <div id="homeslides"> <?php $page_data = get_page($menuItem->page_id); $content = apply_filters('the_content', $page_data->post_content); echo $content; ?> </div><!-- end home slides --> <?php } else { ?> <div class="verticalline"> <div class="scrollprevnext"></div> </div> <div class="pageheader"> <h3><span><?php echo substr($menuItem->title, 0, 1); ?></span><?php echo substr($menuItem->title, 1); ?></h3> </div><!--end pageheader --> <?php $classes = ''; if (strtolower($menuItem->title) == $precision_contact_page) { ?> <div id="<?php echo strtolower($menuItem->title); ?>scroller"> <?php $page_data = get_page($menuItem->page_id); $content = apply_filters('the_content', $page_data->post_content); echo $content; ?> </div><!--end v scroll inner--> <?php } else { $classes = 'scrollerenabledpage'; ?> <div id="<?php echo strtolower($menuItem->title); ?>scroller" class="<?php echo $classes; ?>"> <?php $page_data = get_page($menuItem->page_id); $content = apply_filters('the_content', $page_data->post_content); echo $content; ?> </div><!--end v scroll inner--> <?php } } ?> </div><!-- end page --> <?php } ?> </div><!--end innerright--> <div id="footer"> <p>&copy; <a href="/"><?php bloginfo('name');?></a> | <?php echo date('Y');?></p> </div> </div><!--end wrapper--> </div> <!--Live Preview--> </body> </html>

    Read the article

  • How do I create a .NET Web Service that Posts items to a users Facebook Wall?

    - by Jourdan
    I'm currently toying around with the Clarity .NET Facebook API but am finding certain situations with authentication to be kind of limiting. I keep going through the tutorials but always end up hitting a brick wall with what I want to do. Perhaps I just cannot do it? I want to make a Web Service that takes in the require credentials (APIKey, SecretKey, UsersId (or Session Key?) and whatever else I would need), and then do various tasks: Post to users wall, add events etc. The problem I am having is this: The current documentation, examples and support provide a way to do this within the context of a Web site. Within this context, the required "connect" popup can be initiated and allow the user to authenticate and and connect the application. From that point on the Web can go on with its business to do what it needs to do. If I close the browser and come back to the page, I have to push the connect button again. Except this time, since I was already logged into facebook, I don't have to go through the whole connection process. But still ... How do applications like Tweetdeck get around this? They seemingly have you connect once, when you install their application, and you don't have to do it again. I would assume that this same idea would have to applied towards making a web service because: You don't know what context the user is in when making the Web service call. The web service methods being called could be coming from a Windows Form app, or code behind in a workflow.

    Read the article

  • What exactly is the difference between the Dreamhost IDE and Netbeans?

    - by mikemick
    I just started using Netbeans about a week ago, and really like it thus far. Now I'm seeing something about Dreamhost IDE which I guess is a program that is built using the Netbeans platform. I use Dreamhost as the hosting company for many of my projects. What is the benefit of using Dreamhost IDE over Netbeans? Documentation on the software is non-existent from what I can tell (not even a mention in the Dreamhost wiki). All I was able to find was a short description of what it was on a Sourceforge download page, and I found a short silent video on YouTube demoing it. So I guess I'm asking, what features is it bringing to the table, and what is the difference between it and Netbeans? The description on the Sourceforge page is as follows (typos retained)... DreamHost IDE is php and ruby integrated development environment built on NetBeans IDE and provides easy deploy of your applications to the DreamHost services. Also provides you an easy eay hew to setup these services. Maybe the answer is in the description, and I just don't comprehend it?

    Read the article

  • Automatically generating Regex from set of strings residing in DB C#

    - by Muhammad Adeel Zahid
    Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

    Read the article

  • Memory mapped files and "soft" page faults. Unavoidable?

    - by Robert Oschler
    I have two applications (processes) running under Windows XP that share data via a memory mapped file. Despite all my efforts to eliminate per iteration memory allocations, I still get about 10 soft page faults per data transfer. I've tried every flag there is in CreateFileMapping() and CreateFileView() and it still happens. I'm beginning to wonder if it's just the way memory mapped files work. If anyone there knows the O/S implementation details behind memory mapped files I would appreciate comments on the following theory: If two processes share a memory mapped file and one process writes to it while another reads it, then the O/S marks the pages written to as invalid. When the other process goes to read the memory areas that now belong to invalidated pages, this causes a soft page fault (by design) and the O/S knows to reload the invalidated page. Also, the number of soft page faults is therefore directly proportional to the size of the data write. My experiments seem to bear out the above theory. When I share data I write one contiguous block of data. In other words, the entire shared memory area is overwritten each time. If I make the block bigger the number of soft page faults goes up correspondingly. So, if my theory is true, there is nothing I can do to eliminate the soft page faults short of not using memory mapped files because that is how they work (using soft page faults to maintain page consistency). What is ironic is that I chose to use a memory mapped file instead of a TCP socket connection because I thought it would be more efficient. Note, if the soft page faults are harmless please note that. I've heard that at some point if the number is excessive, the system's performance can be marred. If soft page faults intrinsically are not significantly harmful then if anyone has any guidelines as to what number per second is "excessive" I'd like to hear that. Thanks.

    Read the article

  • iPhone Landscape FAQ and Solutions

    - by Johannes Rudolph
    There has been a lot of confusion and a set of corresponding set of questions here on SO how iPhone applications with proper handling for Landscape/Portrait mode autorotation can be implemented. It is especially difficult to implement such an application when starting in landscape mode is desired. The most common observed effect are scrambled layouts and areas of the screen where touches are no longer recognized. A simple search for questions tagged iphone and landscape reveals these issues, which occur under certain scenarios: Landscape only iPhone app with multiple nibs: App started in Landscape mode, view from first nib is rendered fine, everything view loaded from a different nib is not displayed correctly. Iphone Landscape mode switching to Portraite mode on loading new controller: Self explanatory iPhone: In landscape-only, after first addSubview, UITableViewController doesn’t rotate properly: Same issue as above. iPhone Landscape-Only Utility-Template Application: Layout errors, controller does not seem to recognize the view should be rotated but displays a clipped portrait view in landscape mode, causing half of the screen to stay blank. presentModalViewController in landscape after portrait viewController: Modal views are not correctly rendered either. A set of different solutions have been presented, some of them including completely custom animation via CoreGraphics, while others build on the observation that the first view controller loaded from the main nib is always displayed correct. I have spent a significant amount of time investigating this issue and finally found a solution that is not only a partial solution but should work under all these circumstances. It is my intend with this CW post to provide sort of a FAQ for others having issues with UIViewControllers in Landscape mode. Please provide feedback and help improve the quality of this Post by incorporating any related observations. Feel free to edit and post other/better answers if you know of any.

    Read the article

  • Better why of looping to detect change.

    - by Dremation
    As of now I'm using a while(true) method to detect changes in memory. The problem with this is it's kill the applications performance. I have a list of 30 pointers that need checked as rapidly as possible for changes, without sacrificing a huge performance loss. Anyone have ideas on this? memScan = new Thread(ScanMem); public static void ScanMem() { int i = addy.Length; while (true) { Thread.Sleep(30000); //I do this to cut down on cpu usage for (int j = 0; j < i; j++) { string[] values = addy[j].Split(new char[] { Convert.ToChar(",") }); //MessageBox.Show(values[2]); try { if (Memory.Scanner.getIntFromMem(hwnd, (IntPtr)Convert.ToInt32(values[0], 16), 32).ToString() != values[1].ToString()) { //Ok, it changed lets do our work //work if (Globals.Working) return; SomeFunction("Results: " + values[2].ToString(), "Memory"); Globals.Working = true; }//end if }//end try catch { } }//end for }//end while }//end void

    Read the article

  • How can I display the users profile pic using the facebook graph api?

    - by kielie
    Hi, I would like to display the users profile picture inside of my applications canvas page, is there a way to do that using the graph api? I know I can do it using FBML but I would also like to pass the profile pic to a flash game I am making, so I would have to get the profile pic from the api and send it as a variable, here is the code I have thus far, $facebook = new Facebook(array( 'appId' => FACEBOOK_APP_ID, 'secret' => FACEBOOK_SECRET_KEY, 'cookie' => true, 'domain' => 'myurl/facebook-test' )); $session = $facebook->getSession(); $uid = $facebook->getUser(); $me = $facebook->api('/me'); $updated = date("l, F j, Y", strtotime($me['updated_time'])); echo "Hello " . $me['name'] . $me['picture'] . "<br />"; echo "<div style=\"background:url(images/bg.jpg); width:760px; height:630px;\">" . "You last updated your profile on " . $updated . "</div>" . "<br /> your uid is" . $uid; Thanx in advance!

    Read the article

  • Linux System Programming

    - by AJ
    I wanted to get into systems programming for linux and wanted to know how to approach that and where to begin. I come from a web development background (Python, PHP) but I also know some C and C++. Essentially, I would like to know: Which language(s) to learn and pursue (I think mainly C and C++)? How/Where to learn those languages specific to Systems Programming? Books, websites, blogs, tutorials etc. Any other good places where I can start this from basics? Any good libraries to begin with? What environment setup (or approx.) do I need? Assuming linux has to be there but I have a linux box which I rarely log into using GUI (always use SSH). Is GUI a lot more helpful or VI editor is enough? (Please let me know if this part of the question should go to serverfault.com) PS: Just to clarify, by systems programming I mean things like writing device drivers, System tools, write native applications which are not present on Linux platform but are on others, play with linux kernel etc.

    Read the article

  • Common JNDI resources in Tomcat

    - by Lehane
    Hi, I’m running a couple of servlet applications in Tomcat (5.5). All of the servlets use a common factory resource that is shared out using JNDI. At the moment, I can get everything working by including the factory resource as a GlobalNamingResource in the /conf/server.xml file, and then having each servlet’s META-INF/context.xml file include a ResourceLink to the resource. Snippets from the XML files are included below. NOTE: I’m not that familiar with tomcat, so I’m not saying that this is a good configuration!!! However, I now want to be able install these servlets into multiple tomcat instances automatically using an RPM. The RPM will firstly copy the WARs to the webapps directory, and the jars for the factory into the common/lib directory (which is fine). But it will also need to make sure that the factory resource is included as a resource for all of the servlets. What is the best way add the resource globally? I’m not too keen on writing a script that goes into the server.xml file and adds in the resource that way. Is there any way for me to add in multiple server.xml files so that I can write a new server-app.xml file and it will concatenate my settings to server.xml? Or, better still to add this JNDI resource to all the servlets without using server.xml at all? p.s. Restarting the server will not be an issue, so I don’t mind if the changes don’t get picked up automatically. Thanks Snippet from server.xml <!-- Global JNDI resources --> <GlobalNamingResources> <Resource name="bean/MyFactory" auth="Container" type="com.somewhere.Connection" factory="com.somewhere.MyFactory"/> </GlobalNamingResources> The entire servlet’s META-INF/context.xml file <?xml version="1.0" encoding="UTF-8"?> <Context> <ResourceLink global="bean/MyFactory" name="bean/MyFactory" type="com.somewhere.MyFactory"/> </Context>

    Read the article

  • TLS with SNI in Java clients

    - by ftrotter
    There is an ongoing discussion on the security and trust working group for NHIN Direct regarding the IP-to-domain mapping problem that is created with traditional SSL. If an HISP (as defined by NHIN Direct) wants to host thousands of NHIN Direct "Health Domains" for providers, then it will an "artificially inflated cost" to have to purchase an IP for each of those domains. Because Apache and OpenSSL have recently released TLS with support for the SNI extension, it is possible to use SNI as a solution to this problem on the server side. However, if we decide that we will allow server implementations of the NHINDirect transport layer to support TLS+SNI, then we must require that all clients support SNI too. OpenSSL based clients should do this by default and one could always us stunnel to implement an TLS+SNI aware client to proxy if your given programming language SSL implementation does not support SNI. It appears that native Java applications using OpenJDK do not yet support SNI, but I cannot get a straight answer out of that project. I know that there are OpenSSL Java libraries available but I have no idea if that would be considered viable. Can you give me a "state of the art" summary of where TLS+SNI support is for Java clients? I need a Java implementers perspective on this.

    Read the article

  • iPhone OpenGL Splash Screen? How?

    - by Kyle
    My app is based pretty much on the EAGLView in the SDK. It doesn't incorporate a ViewController. Rather it simply inits GL and starts painting immediately.. Currently, my app will load a very small PNG and displays it as quickly as possible. On a 3GS this is rather instant, but on a 3G it can take about 2 seconds. In the latter case of the 3G, the user is looking at a black screen for that time. Is this behavior allowed by Apple? Is there any way to alter this SDK example so that it makes use of 'default.png'? It doesn't seem so straight forward to me. I want my user to see an image as quickly as possible, and I also don't want to be rejected for such a little quirk like this as well. In the guidelines, they encourage you to use default.png for standard applications to show a sort of mockup of the interface while it actually loads. I want to initialize OpenGL, and ALSO display this. This default.png is loaded before the app screen launches. This is EXACLTY what I want to make use of. Any help is appreciated. Thanks!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Linux Lightweight Distro and X Windows for Development

    - by Fernando Barrocal
    Heyall... I want to build a lightweight linux configuration to use for development. The first idea is to use it inside a Virtual Machine under Windows, or old Laptops with 1Gb RAM top. Maybe even a distributable environment for developers. So the whole idea is to use a LAMP server, Java Application Server (Tomcat or Jetty) and X Windows (any Window manager, from FVWM to Enlightment), Eclipse, maybe jEdit and of course Firefox. Edit: I am changing this post to compile a possible list of distros and window managers that can be used to configure a real lightweight development environment. I am using as base personal experiences on this matter. Info about the distros can be easily found in their sites. So please, focus on personal use of those systems Distros Ubuntu / Xubuntu Pros: Personal Experience in old systems or low RAM environment - @Schroeder, @SCdF Several sugestions based on personal knowledge - @Kyle, @Peter Hoffmann Gentoo Pros: Not targeted to Desktop Users - @paan Don't come with a huge ammount of applications - @paan Slackware Pros: Suggested as best performance in a wise install/configuration - @Ryan Damn Small Linux Pros: Main focus is the lightweight factor - 50MB LiveCD - @Ryan Debian Pros: Very versatile, can be configured for both heavy and lightweight computers - @Ryan APT as package manager - @Kyle Based on compatibility and usability - @Kyle -- Fell Free to add Prós and Cons on this, so we can compile a good Reference. -- X Windows suggestion keep coming about XFCE. If others are to add here, open a session for it Like the distro one :)

    Read the article

  • What are alternatives to Win32 PulseEvent() function?

    - by Bill
    The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

    Read the article

  • How to run an application as root without asking for an admin password?

    - by kvaruni
    I am writing a program in Objective-C (XCode 3.2, on Snow Leopard) that is capable of either selectively blocking certain sites for a duration or only allow certain sites (and thus block all others) for a duration. The reasoning behind this program is rather simple. I tend to get distracted when I have full internet access, but I do need internet access during my working hours to get to a number of work-related websites. Clearly, this is not a permanent block, but only helps me to focus whenever I find myself wandering a bit too much. At the moment, I am using a Unix script that is called via AppleScript to obtain Administrator permissions. It then activates a number of ipfw rules and clears those after a specific duration to restore full internet access. Simple and effective, but since I am running as a standard user, it gets cumbersome to enter my administrator password each and every time I want to go "offline". Furthermore, this is a great opportunity to learn to work with XCode and Objective-C. At the moment, everything works as expected, minus the actual blocking. I can add a number of sites in a list, specify whether or not I want to block or allow these websites and I can "start" the blocking by specifying a time until which I want to stay "offline". However, I find it hard to obtain clear information on how I can run a privileged Unix command from Objective-C. Ideally, I would like to be able to store information with respect to the Administrator account into the Keychain to use these later on, so that I can simply move into "offline" mode with the convenience of clicking a button. Even more ideally, there might be some class in Objective-C with which I can block access to some/all websites for this particular user without needing to rely on privileged Unix commands. A third possibility is in starting this program with root permissions and the reducing the permissions until I need them, but since this is a GUI application that is nested in the menu bar of OS X, the results are rather awkward and getting it to run each and every time with root permission is no easy task. Anyone who can offer me some pointers or advice? Please, no security-warnings, I am fully aware that what I want to do is a potential security threat.

    Read the article

  • How can I call from my PC through my cisco ip phone?

    - by Enjoy coding
    Hi gurus, I am trying to call a telephone number fro my PC through my ip phone once my application completes its work. So I am searching for a way to access my ip phone from my PC. Please correct me if I am wrong or missing the obvious. On my PC in office selecting a phone in Microsoft office communicator and making calls from PC through my Cisco IP Phone is disabled. Is there any way i can programmatically call a external phone or mobile number from my PC as my ip phone is connected to my PC. I tried out etQuickDial and Make/Drop calls. But I am not able to find the appropriate way or setup to make calls. I also googled for any libraries and i saw some TAPI but was not able to get correct way. Please help me out with this. My cisco ip phone is 7940. My environment is Windows XP. Please let me know if you need more details. No problems with me even if you propose a solution involving coding or a non coding way of downloading and installing any applications. Thanks in advance. If you dont want me to post it here and If I need to put it in super user or server fault or some where else please direct me appropriately. I did not use any of these two before so I posted this question here.

    Read the article

  • Game login authentication and security.

    - by Charles
    First off I will say I am completely new to security in coding. I am currently helping a friend develop a small game (in Python) which will have a login server. I don't have much knowledge regarding security, but I know many games do have issues with this. Everything from 3rd party applications (bots) to WPE packet manipulation. Considering how small this game will be and the limited user base, I doubt we will have serious issues, but would like to try our best to limit problems. I am not sure where to start or what methods I should use, or what's worth it. For example, sending data to the server such as login name and password. I was told his information should be encrypted when sending, so in-case someone was viewing it (with whatever means), that they couldn't get into the account. However, if someone is able to capture the encrypted string, wouldn't this string always work since it's decrypted server side? In other words, someone could just capture the packet, reuse it, and still gain access to the account? The main goal I am really looking for is to make sure the players are logging into the game with the client we provide, and to make sure it's 'secure' (broad, I know). I have looked around at different methods such as Public and Private Key encryption, which I am sure any hex editor could eventually find. There are many other methods that seem way over my head at the moment and leave the impression of overkill. I realize nothing is 100% secure. I am just looking for any input or reading material (links) to accomplish the main goal stated above. Would appreciate any help, thanks.

    Read the article

< Previous Page | 823 824 825 826 827 828 829 830 831 832 833 834  | Next Page >