Search Results

Search found 25071 results on 1003 pages for 'information overload'.

Page 841/1003 | < Previous Page | 837 838 839 840 841 842 843 844 845 846 847 848  | Next Page >

• Help me with the simplest program for "Trusted" application

  - by idazuwaika

  Hi, I hope anyone from the large community here can help me write the simplest "Trusted" program that I can expand from. I'm using Ubuntu Linux 9.04, with TPM emulator 0.60 from Mario Strasser (http://tpm-emulator.berlios.de/). I have installed the emulator and Trousers, and can successfully run programs from tpm-tools after running tpmd and tcsd daemons. I hope to start developing my application, but I have problems compiling the code below. #include <trousers/tss.h> #include <trousers/trousers.h> #include <stdio.h> TSS_HCONTEXT hContext; int main() { Tspi_Context_Create(&hContext); Tspi_Context_Close(hContext); return 0; } After trying to compile with g++ tpm.cpp -o tpmexe I receive errors undefined reference to 'Tspi_Context_Create' undefined reference to 'Tspi_Context_Close' What do I have to #include to successfully compile this? Is there anything that I miss? I'm familiar with C, but not exactly so with Linux/Unix programming environment. ps: I am a part time student in Master in Information Security programme. My involvement with programming has been largely for academic purposes.

  Read the article

• MySQL Ratings From Two Tables

  - by DirtyBirdNJ

  I am using MySQL and PHP to build a data layer for a flash game. Retrieving lists of levels is pretty easy, but I've hit a roadblock in trying to fetch the level's average rating along with it's pointer information. Here is an example data set: levels Table: level_id | level_name 1 | Some Level 2 | Second Level 3 | Third Level ratings Table: rating_id | level_id | rating_value 1 | 1 | 3 2 | 1 | 4 3 | 1 | 1 4 | 2 | 3 5 | 2 | 4 6 | 2 | 1 7 | 3 | 3 8 | 3 | 4 9 | 3 | 1 I know this requires a join, but I cannot figure out how to get the average rating value based on the level_id when I request a list of levels. This is what I'm trying to do: SELECT levels.level_id, AVG(ratings.level_rating WHERE levels.level_id = ratings.level_id) FROM levels I know my SQL is flawed there, but I can't figure out how to get this concept across. The only thing I can get to work is returning a single average from the entire ratings table, which is not very useful. Ideal Output from the above conceptually valid but syntactically awry query would be: level_id | level_rating 1| 3.34 2| 1.00 3| 4.54 My main issue is I can't figure out how to use the level_id of each response row before the query has been returned. It's like I want to use a placeholder... or an alias... I really don't know and it's very frustrating. The solution I have in place now is an EPIC band-aid and will only cause me problems long term... please help!

  Read the article

• Looping through a file in VB.NET

  - by Ousman

  I am writing a VB.NET program and I'm trying to accomplish the following: Read and loop through a text file line by line Show the event of the loop on a textbox or label until a button is pressed The loop will then stop on any number that happened to be at the loop event and When a button is pressed again the loop will continue. Code Imports System.IO Public Class Form1 'Dim nFileNum As Integer = FreeFile() ' Get a free file number Dim strFileName As String = "C:\scb.txt" Dim objFilename As FileStream = New FileStream(strFileName, _ FileMode.Open, FileAccess.Read, FileShare.Read) Dim objFileRead As StreamReader = New StreamReader(objFilename) 'Dim lLineCount As Long 'Dim sNextLine As String Private Sub btStart_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles btStart.Click Try If objFileRead.ReadLine = Nothing Then MsgBox("No Accounts Available to show!", _ MsgBoxStyle.Information, _ MsgBoxStyle.DefaultButton2 = MsgBoxStyle.OkOnly) Return Else Do While (objFileRead.Peek() > -1) Loop lblAccounts.Text = objFileRead.ReadLine() 'objFileRead.Close() 'objFilename.Close() End If Catch ex As Exception MessageBox.Show(ex.Message) Finally 'objFileRead.Close() 'objFilename.Close() End Try End Sub Private Sub Form1_Load(ByVal sender As System.Object, _ ByVal e As System.EventArgs) _ Handles MyBase.Load End Sub End Class Problem I'm able to read the text file but my label will only loop if I hit the start button. It goes to the next line, but I want it to continue to loop through the entire file until I hit a button telling it to stop.

  Read the article

• RTTI Dynamic array TValue Delphi 2010

  - by user558126

  Hello I have a question. I am a newbie with Run Time Type Information from Delphi 2010. I need to set length to a dynamic array into a TValue. You can see the code. Type TMyArray = array of integer; TMyClass = class publihed function Do:TMyArray; end; function TMyClass.Do:TMyArray; begin SetLength(Result,5); for i:=0 to 4 Result[i]=3; end; ....... ....... ...... y:TValue; Param:array of TValue; ......... y=Methods[i].Invoke(Obj,Param);//delphi give me a DynArray type kind, is working, Param works to any functions. if Method[i].ReturnType.TypeKind = tkDynArray then//is working... begin I want to set length for y to 10000//i don't know how to write. end; I don't like Generics Collections.

  Read the article

• How to organize and manage multiple database credentials in application?

  - by Polaris878

  Okay, so I'm designing a stand-alone web service (using RestLET as my framework). My application is divided in to 3 layers: Data Layer (just above the database, provides APIs for connecting to/querying database, and a database object) Object layer (responsible for serialization from the data layer... provides objects which the client layer can use without worrying about database) Client layer (This layer is the RestLET web service... basically just creates objects from the object layer and fulfills webservice request) Now, for each object I create in the object layer, I want to use different credentials (so I can sandbox each object...). The object layer should not know the exact credentials (IE the login/pw/DB URL etc). What would be the best way to manage this? I'm thinking that I should have a super class Database object in my data layer... and each subclass will contain the required log-in information... this way my object layer can just go Database db = new SubDatabase(); and then continue using that database. On the client level, they would just be able to go ItemCollection items = new ItemCollection(); and have no idea/control over the database that gets connected. I'm asking this because I am trying to make my platform extensible, so that others can easily create services off of my platform. If anyone has any experience with these architectural problems or how to manage this sort of thing I'd appreciate any insight or advice... Feel free to ask questions if this is confusing. Thanks! My platform is Java, the REST framework I'm using is RestLET, my database is MySQL.

  Read the article

• Jboss 6 Cluster Singleton Clustered

  - by DanC

  I am trying to set up a Jboss 6 in a clustered environment, and use it to host clustered stateful singleton EJBs. So far we succesfully installed a Singleton EJB within the cluster, where different entrypoints to our application (through a website deployed on each node) point to a single environment on which the EJB is hosted (thus mantaining the state of static variables). We achieved this using the following configuration: Bean interface: @Remote public interface IUniverse { ... } Bean implementation: @Clustered @Stateful public class Universe implements IUniverse { private static Vector<String> messages = new Vector<String>(); ... } jboss-beans.xml configuration: <deployment xmlns="urn:jboss:bean-deployer:2.0"> <!-- This bean is an example of a clustered singleton --> <bean name="Universe" class="Universe"> </bean> <bean name="UniverseController" class="org.jboss.ha.singleton.HASingletonController"> <property name="HAPartition"><inject bean="HAPartition"/></property> <property name="target"><inject bean="Universe"/></property> <property name="targetStartMethod">startSingleton</property> <property name="targetStopMethod">stopSingleton</property> </bean> </deployment> The main problem for this implementation is that, after the master node (the one that contains the state of the singleton EJB) shuts down gracefuly, the Singleton's state is lost and reset to default. Please note that everything was constructed following the JBoss 5 Clustering documents, as no JBoss 6 documents were found on this subject. Any information on how to solve this problem or where to find JBoss 6 documention on clustering is appreciated.

  Read the article

• Access modifiers - Property on business objects - getting and setting

  - by Mike

  Hi, I am using LINQ to SQL for the DataAccess layer. I have similar business objects to what is in the data access layer. I have got the dataprovider getting the message #23. On instantiation of the message, in the message constructor, it gets the MessageType and makes a new instance of MessageType class and fills in the MessageType information from the database. Therefore; I want this to get the Name of the MessageType of the Message. user.Messages[23].MessageType.Name I also want an administrator to set the MessageType user.Messages[23].MessageType = MessageTypes.LoadType(3); but I don't want the user to publicly set the MessageType.Name. But when I make a new MessageType instance, the access modifier for the Name property is public because I want to set that from an external class (my data access layer). I could change this to property to internal, so that my class can access it like a public variable, and not allow my other application access to modify it. This still doesn't feel right as it seems like a public property. Are public access modifiers in this situation bad? Any tips or suggestions would be appreciated. Thanks.

  Read the article

• JDBC transaction dead-lock solution required?

  - by user49767

  It's a scenario described my friend and challenged to find solution. He is using Oracle database and JDBC connection with read committed as transaction isolation level. In one of the transaction, he updates a record and executes selects statement and commits the transaction. when everything happening within single thread, things are fine. But when multiple requests are handled, dead-lock happens. Thread-A updates a record. Thread B updates another record. Thread-A issues select statement and waits for Thread-B's transaction to complete the commit operation. Thread-B issues select statement and waits for Thread-A's transaction to complete the commit operation. Now above causes dead-lock. Since they use command pattern, the base framework allows to issue commit only once (at the end of all the db operation), so they are unable to issue commit immediately after select statement. My argument was Thread-A supposed to select all the records which are committed and hence should not be issue. But he said that Thread-A will surely wait till Thread-B commits the record. is that true? What are all the ways, to avoid the above issue? is it possible to change isolation-level? (without changing underlying java framework) Little information about base framework, it is something similar to Struts action, their each and every request handled by one action, transaction begins before execution and commits after execution.

  Read the article

• Reading JSON with Javascript/jQuery

  - by Josephine

  I'm building a game in javascript/html5 and I'm trying to build a database of locked doors in a maze that can be loaded from and overwritten to throughout gameplay. I've found a large number of tutorials online, but nothing is working. I was wondering if someone could look at what I'm trying and let me know what I'm doing wrong. My JSON file looks like this: { "doors": [ {"left":true, "right":false, "bottom":false}, {"left":false, "right":false, "bottom":false}, {"right":false, "bottom":false, "top":false}, {"left":false, "right":false, "top":false} ] } I want to build the HTML page so that when a player collides with a door it checks if its locked or not like: if (player.x < leftDoor.x + leftDoor.width && player.x + player.width > leftDoor.x && player.y < leftDoor.y + leftDoor.height && player.y + player.height > leftDoor.y) { if(doors[0].left == true) alert("door is locked"); else window.location = ( "2.html?p1="); } However I'm having trouble reading from the JSON file itself. I've tried things like: function loadJson() { $(document).ready(function() { $.getJSON('info.json', function(doors) { alert(doors[0].left); }); }); } But nothing happens, and I need to be able to access the information in the HTML as well. I'd rather use jQuery, but I'm not opposed to straight JS if it works. I've been trying to do this for ages and I'm getting absolutely no where. If someone could help that would be amazing. Thanks!

  Read the article

• Can't get KnownType to work with WCF

  - by Kelly Cline

  I have an interface and a class defined in separate assemblies, like this: namespace DataInterfaces { public interface IPerson { string Name { get; set; } } } namespace DataObjects { [DataContract] [KnownType( typeof( IPerson ) ) ] public class Person : IPerson { [DataMember] public string Name { get; set; } } } This is my Service Interface: public interface ICalculator { [OperationContract] IPerson GetPerson ( ); } When I update my Service Reference for my Client, I get this in the Reference.cs: public object GetPerson() { return base.Channel.GetPerson(); I was hoping that KnownType would give me IPerson instead of "object" here. I have also tried [KnownType( typeof( Person ) ) ] with the same result. I have control of both client and server, so I have my DataObjects (where Person is defined) and DataInterfaces (where IPerson is defined) assemblies in both places. Is there something obvious I am missing? I thought KnownType was the answer to being able to use interfaces with WCF. ----- FURTHER INFORMATION ----- I removed the KnownType from the Person class and added [ServiceKnownType( typeof( Person ) ) ] to my service interface, as suggested by Richard. The client-side proxy still looks the same, public object GetPerson() { return base.Channel.GetPerson(); , but now it doesn't blow up. The client just has an "object", though, so it has to cast it to IPerson before it is useful. var person = client.GetPerson ( ); Console.WriteLine ( ( ( IPerson ) person ).Name );

  Read the article

• Class design when working with dataset

  - by MC

  If you have to retrieve data from a database and bring this dataset to the client, and then allow the user to manipulate the data in various ways before updating the database again, what is a good class design for this if the data tables will not have a 1:1 relationship with the class objects? Here are some I came up with: Just manipulate the DataSet itself on the client and then send it back to the database as is. This will work though obviously the code will be very dirty and not well-structured. Same as #1, but wrap the dataset code around classes. What I mean is that you may have a class that takes a dataset or a datatable in its constructor, and then provides public methods and properties to simplify the code. Inside these methods and properties it will be reading or manipulating the dataset. To update the database afterwards will be easy because you already have the updated dataset. Get rid of the dataset entirely on the client, convert to objects, then convert back to a dataset when needing to update the database. Is there any good resources where I can find information on this?

  Read the article

• How to create more complex Lucene query strings?

  - by boris callens

  This question is a spin-off from this question. My inquiry is two-fold, but because both are related I think it is a good idea to put them together. How to programmatically create queries. I know I could start creating strings and get that string parsed with the query parser. But as I gather bits and pieces of information from other resources, there is a programattical way to do this. What are the syntax rules for the Lucene queries? --EDIT-- I'll give a requirement example for a query I would like to make: Say I have 5 fields: First Name Last Name Age Address Everything All fields are optional, the last field should search over all the other fields. I go over every field and see if it's IsNullOrEmpty(). If it's not, I would like to append a part of my query so it adds the relevant search part. First name and last name should be exact matches and have more weight then the other fields. Age is a string and should exact match. Address can varry in order. Everything can also varry in order. How should I go about this?

  Read the article

• Programatically rebuild .exd-files when loading VBA

  - by aspartame

  Hi, After updating Microsoft Office 2007 to Office 2010 some custom VBA scripts embedded in our software failed to compile with the following error message: Object library invalid or contains references to object definitions that could not be found. As far as I know, this error is a result of a security update from Microsoft (Microsoft Security Advisory 960715). When adding ActiveX-controls to VBA scripts, information about the controls are stored in cache files on the local hard drive (.exd-files). The security update modified some of these controls, but the .exd-files were not automatically updated. When the VBA scripts try to load the old versions of the controls stored in the cached files, the error occurs. These cache-files must be removed from the hard drive in order for the controls to load successfully (which will create new, updated .exd-files automatically). What I would like to do is to programatically (using Visual C++) remove the outdated .exd-files when our software loads. When opening a VBA project using CApcProject::ApcProject.Open I set the following flag:axProjectThrowAwayCompiledState. TestHR(ApcProject.Open(pHost, (MSAPC::AxProjectFlag) (MSAPC::axProjectNormal | MSAPC::axProjectThrowAwayCompiledState))); According to the documentation, this flag should cause the VBA project to be recompiled and the temporary files to be deleted and rebuilt. I've also tried to update the checksum of the host application type library which should have the same effect. However none of these fixes seem to do the job and I'm running out of ideas. Help is very much appreciated!

  Read the article

• Exposing a service to external systems - How should I design the contract?

  - by Larsi

  Hi! I know this question is been asked before here but still I'm not sure what to select. My service will be called from many 3 party system in the enterprise. I'm almost sure the information the service will collect (MyBigClassWithAllInfo) will change during the products lifetime. Is it still a good idea to expose objects? This is basically what my two alternatives: [ServiceContract] public interface ICollectStuffService { [OperationContract] SetDataResponseMsg SetData(SetDataRequestMsg dataRequestMsg); } // Alternative 1: Put all data inside a xml file [DataContract] public class SetDataRequestMsg { [DataMember] public string Body { get; set; } [DataMember] public string OtherPropertiesThatMightBeHandy { get; set; } // ?? } // Alternative 2: Expose the objects [DataContract] public class SetDataRequestMsg { [DataMember] public Header Header { get; set; } [DataMember] public MyBigClassWithAllInfo ExposedObject { get; set; } } public class SetDataResponseMsg { [DataMember] public ServiceError Error { get; set; } } The xml file would look like this: <?xml version="1.0" encoding="utf-8"?> <Message>   <Header>     <InfoAboutTheSender>...</InfoAboutTheSender>   </Header>   <StuffToCollectWithAllTheInfo>   <stuff1>...</stuff1> </StuffToCollectWithAllTheInfo> </Message> Any thought on how this service should be implemented? Thanks Larsi

  Read the article

• javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

  - by Bill Dawes

  Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

  Read the article

• How can I reorder an mbox file chronologically?

  - by Joshxtothe4

  Hello, I have a single spool mbox file that was created with evolution, containing a selection of emails that I wish to print. My problem is that the emails are not placed into the mbox file chronologically. I would like to know the best way to place order the files from first to last using bash, perl or python. I would like to oder by received for files addressed to me, and sent for files sent by me. Would it perhaps be easier to use maildir files or such? The emails currently exist in the format: From [email protected] Fri Aug 12 09:34:09 2005 Message-ID: <[email protected]> Date: Fri, 12 Aug 2005 09:34:09 +0900 From: me <[email protected]> User-Agent: Mozilla Thunderbird 1.0.6 (Windows/20050716) X-Accept-Language: en-us, en MIME-Version: 1.0 To: someone <[email protected]> Subject: Re: (no subject) References: <[email protected]> In-Reply-To: <[email protected]> Content-Type: text/plain; charset=ISO-8859-1; format=flowed Content-Transfer-Encoding: 8bit Status: RO X-Status: X-Keywords: X-UID: 371 X-Evolution-Source: imap://[email protected]/ X-Evolution: 00000002-0010 Hey the actual content of the email someone wrote: > lines of quotedtext I am wondering if there is a way to use this information to easily reorganize the file, perhaps with perl or such.

  Read the article

• OnConnect event not firing when using TClientSocket inside a TThread on non-blocking mode

  - by mathematician1975

  I am trying to make use of Borlands TClientSocket component in non-blocking mode inside a multithreaded C++ Windows application. I am creating multiple threads (classes derived from TThread), each of which creates its own TClientSocket object. I then assign member functions of the thread class to act as event handlers for the OnConnect, OnDisconnect and OnSocketError events of the socket. The problem I am having here is that whenever I call the TClientSocket::Open() function from within the TThread::Execute() function, the OnConnect event never fires. However, When I call the Open() function from the VCL thread prior to the TThread::Execute() function getting called, all of the events fire and I can use the thread-socket combination as I would like. Now I have not read anything in documentation that says that TClientSocket should not be used in non-blocking mode when used inside a thread, but it appears to me that there is perhaps something wrong conceptually in the way I am trying to use this class. Borland documentation is quite poor on the subject and these components have now been deprecated so reliable information is hard to come by. Despite being deprecated I have to use them as there is no alternative in the Builder 6 package I have. Can anyone please advise me if there is a right/wrong way to use TThread and a non-blocking TClientSocket in combination. I have never had problems using it as part of the VCL thread and never had problems using TServerSocket before and I really cannot understand why some events are not firing.

  Read the article

• Combining JSON Arrays

  - by George

  I have 3 json arrays, each with information listed in the same format: Array: ID: NAME: DATA: ID: NAME: DATA: etc... My goal is to combine all 3 arrays into one array, and sort and display by NAME by passing the 3 arrays into a function. The function I've tried is: JSCRIPT Call: // to save time I'm just passing the name of the array, I've tried passing // the full array name as json[0]['DATA'][array_1][0]['NAME'] as well. combineNames(['array_1','array_2']); FUNCTION: function combineNames(names) { var allNames = [] for (i=0;i<names.length;i++) { for (j=0;j<json[0]['DATA'][names[i]].length;j++) { allNames.push(json[0]['DATA'][names[i]][j]['NAME']); } } return allNames.sort(); } The above gives me the error that NAME is null or undefined. I've also tried using the array.concat function which works when I hard code it: var names = []; var allNames = []; var names = names.concat(json[0]['DATA']['array_1'],json[0]['DATA']['array_2']); for (i=0;i<names.length;i++) { allNames.push(names[i]['NAME']); } return allNames.sort(); But I can't figure out how to pass in the arrays into the function (and if possible I would like to just pass in the array name part instead of the whole json[0]['DATA']['array_name'] like I was trying to do in the first function...

  Read the article

• Recommendations for Continuous integration for Mercurial/Kiln + MSBuild + MSTest

  - by TDD

  We have our source code stored in Kiln/Mercurial repositories; we use MSBuild to build our product and we have Unit Tests that utilize MSTest (Visual Studio Unit Tests). What solutions exist to implement a continuous integration machine (i.e. Build machine). The requirements for this are: A build should be kicked of when necessary (i.e. code has changed in the Repositories we care about) Before the actual build, the latest version of the source code must be acquired from the repository we are building from The build must build the entire product The build must build all Unit Tests The build must execute all unit tests A summary of success/failure must be sent out after the build has finished; this must include information about the build itself but also about which Unit Tests failed and which ones succeeded. The summary must contain which changesets were in this build that were not yet in the previous successful (!) build The system must be configurable so that it can build from multiple branches(/Repositories). Ideally, this system would run on a single box (our product isn't that big) without any server components. What solutions are currently available? What are their pros/cons? From the list above, what can be done and what cannot be done? Thanks

  Read the article

• making clean page via page.tpl.php

  - by user360051

  I have a Drupal module creating a page via hook_menu(). I am trying to make it so the page has no extraneous html output, only what I want. You can view the page here, http://www.thomashansen.me/chat/thomas. If you look at the source, you can see a strange script tag at the end. My page-chat.tpl.php looks like this, <?php // $Id$ ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="<?php print $language->language ?>" lang="<?php print $language->language ?>" dir="<?php print $language->dir ?>"> <head> </head> <body> <?php print $content; ?> </body> </html> Where is that script tag coming from? and how do I get rid of it? If you need more information just ask.

  Read the article

• How to get encoding from MAPI message with PR_BODY_A tag (windows mobile)?

  - by SadSido

  Hi, everyone! I am developing a program, that handles incoming e-mail and sms through windows-mobile MAPI. The code basically looks like that: ulBodyProp = PR_BODY_A; hr = piMessage->OpenProperty(ulBodyProp, NULL, STGM_READ, 0, (LPUNKNOWN*)&piStream); if (hr == S_OK) { // ... get body size in bytes ... STATSTG statstg; piStream->Stat(&statstg, 0); ULONG cbBody = statstg.cbSize.LowPart; // ... allocate memory for the buffer ... BYTE* pszBodyInBytes = NULL; boost::scoped_array<BYTE> szBodyInBytesPtr(pszBodyInBytes = new BYTE[cbBody+2]); // ... read body into the pszBodyInBytes ... } That works and I have a message body. The problem is that this body is multibyte encoded and I need to return a Unicode string. I guess, I have to use ::MultiByteToWideChar() function, but how can I guess, what codepage should I apply? Using CP_UTF8 is naive, because it can simply be not in UTF8. Using CP_ACP works, well, sometimes, but sometimes does not. So, my question is: how can I retrieve the information about message codepage. Does MAPI provide any functions for it? Or is there a way to decode multibyte string, other than MultiByteToWideChar()? Thanks!

  Read the article

• Unable to create PDB file

  - by Ryan Smith

  For some reason this error started popping up today on one of my projects. Error 1 Unable to write to output file 'C:\MyProject\Release\MyProject.pdb': Unspecified error If I go into advanced compile options and change it to not generate and debug info, my project compiles fine. I have tried setting the permissions on the Release folder to full for everyone, so I would assume it's not a permissions issue. Also, I don't see anything in my log files that would provide me with more information about the issue. Does anyone know why this error would just start showing up or a way to fix it? Thanks. Update: I have rebooted my machine, restarted VS several times and have even completely deleted the existing OBJ file where the issue is happening. It's still giving me the same error. This is a simple one project solution that was working fine just last week. It appears to be an issue with VS trying to build the PDB file because I can delete them out of the Release and Debug folders without issue. When I try rebuilding them VS will start creating the file (about 1.4MB is size) but I still get the error.

  Read the article

• To what extent should code try to explain fatal exceptions?

  - by Andrzej Doyle

  I suspect that all non-trivial software is likely to experience situations where it hits an external problem it cannot work around and thus needs to fail. This might be due to bad configuration, an external server being down, disk full, etc. In these situations, especially if the software is running in non-interactive mode, I expect that all one can really do is log an error and wait for the admin to read the logs and fix the problem. If someone happens to interact with the software in the meantime, e.g. a request comes in to a server that failed to initialize properly, then perhaps an appropriate hint can be given to check the logs and maybe even the error can be echoed (depending on whether you can tell if they're a technical guy as opposed to a business user). For the moment though let's not think too hard about this part. My question is, to what extent should the software be responsible for trying to explain the meaning of the fatal error? In general, how much competence/knowledge are you allowed to presume on administrators of the software, and how much should you include troubleshooting information and potential resolution steps when logging fatal errors? Of course if there's something that's unique to the runtime context this should definitely be logged; but lets assume your software needs to talk to Active Directory via LDAP and gets back an error "[LDAP: error code 49 - 80090308: LdapErr: DSID-0C090334, comment: AcceptSecurityContext error, data 525, vece]". Is it reasonable to assume that the maintainers will be able to Google the error code and work out what it means, or should the software try to parse the error code and log that this is caused by an incorrect user DN in the LDAP config? I don't know if there is a definitive best-practices answer for this, so I'm keen to hear a variety of views.

  Read the article

• Low Level Console Input

  - by Soulseekah

  I'm trying to send commands to to the input of a cmd.exe application using the low level read/write console functions. I have no trouble reading the text (scraping) using the ReadConsole...() and WriteConsole() functions after having attached to the process console, but I've not figured out how to write for example "dir" and have the console interpret it as a sent command. Here's a bit of my code: CreateProcess(NULL, "cmd.exe", NULL, NULL, FALSE, CREATE_NEW_CONSOLE, NULL, NULL, &si, &pi); AttachConsole(pi.dwProcessId); strcpy(buffer, "dir"); WriteConsole(GetStdHandle(STD_INPUT_HANDLE), buffer, strlen(buffer), &charRead, NULL); STARTUPINFO attributes of the process are all set to zero, except, of course, the .cb attribute. Nothing changes on the screen, however I'm getting an Error 6: Invalid Handle returned from WriteConsole to STD_INPUT_HANDLE. If I write to (STD_OUTPUT_HANDLE) I do get my dir written on the screen, but nothing of course happens. I'm guessing SetConsoleMode() might be of help, but I've tried many mode combinations, nothing helped. I've also created a quick console application that waits for input (scanf()) and echoes back whatever goes in, didn't work. I've also tried typing into the scanf() promp and then peek into the input buffer using PeekConsoleInput(), returns 0, but the INPUT_RECORD array is empty. I'm aware that there is another way around this using WriteConsoleInput() to directly inject INPUT_RECORD structured events into the console, but this would be way too long, I'll have to send each keypress into it. I hope the question is clear. Please let me know if you need any further information. Thanks for your help.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

< Previous Page | 837 838 839 840 841 842 843 844 845 846 847 848  | Next Page >