Search Results

Search found 85647 results on 3426 pages for 'file write'.

Page 91/3426 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • Online File Sharing that acts just like LAN shared drives, etc.

    - by Dayton Brown
    Hi All, Have a small business client that wants to move their current file share to the web. Specs are as follows, 20 to 30 GB of space, file sizes are normal (nothing more than 50 to 100 mb) 3 users ideal solution would be exact same functionality as windows explorer. CHEAP!!! But not super cheap. I would like to keep it around $20 per user per month. I've explored a bunch of solutions, but they are all a bit on the complicated side. Thanks in advance for the recommendations.

    Read the article

  • www-data is unable to write to an NFS share

    - by Bastian
    On Debian Squeeze, I created an NFS share with these options rw,sync,no_root_squash,no_subtree_check,insecure and on the other Debian Squeeze I can successfully mount it and read write with root, but this share is intended to be used by Apache. I changed the permission to 777 just to make sure. And still, the www-data user can read, create files but not write to them! It does not sound to me like the typical permissions problem, maybe something related to NFS, a lock problem that I am not aware of. Any idea is welcome.

    Read the article

  • Puzzled about PHP file permission and shared webhosting - what are some explanations?

    - by extrakun
    I have this issue with different web-hosting, particular upload scripts which can only upload to a folder only if it has 777 permission (which is risky). On the test server (on a different webhost), 755 works well. On another web-hosting, log files generated by PHP file functions cannot be write to some time, but other files are mysteriously unaffected (for instance, the log files for the entire week is 655, and they work well, but just today's log-file doesn't work unless it is set to 777). I am more of an application developer than a server backend expert, so these behaviours puzzle me to no end. Why are they happening? What can be done?

    Read the article

  • What naming pattern can I use for sequential file naming (photos) when only their relative sequence is known?

    - by Juhele
    I got some old scanned photos and I want to put them in correct order. Unfortunately, I have no possibility to find out the exact order, only relative one like: "hm, this photo was surely taken after this one" and organize them step-by-step by manually changing numbering again and again. Is there any program (best free or opensource), where could I interactively put the photo in correct order straightaway (maybe by changing the order by dragging with mouse) and finally apply some file renaming to keep the file order? thank you in advance PS: running Windows (XP and 7), but if you know something for linux, let me kno too, please

    Read the article

  • How to write to Samba folder?

    - by Darren
    I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • How to configure Notepad++ (Scintilla) to write below EOF after EOL [on hold]

    - by Piotr Piaseczny
    Is it possible to configure scintilla to "brake" EOL/EOF while writing ? Now, if I want to begin writing in a column after EOL, I use ALT+left mouse button and start typing after click. No idea how to begin writing below EOF. Pressing Enter key many times is the only method now. Other explanation: If You open a new document, doesnt matter what kind of (php/txt etc) all You have is just one line. If You want to write in line 5 - must press Enter 5 times. Every other editor I know (IDE in Builder C++/MultiEdit) "ignore" eof and you can write anywhere in document. Because of php/html I've found notepad++ as a best editor but I'd like to "brake" limitations of (probably) scintilla

    Read the article

  • Why is file sharing over internet still working, despite all firewall exceptions for filesharing being disabled?

    - by Triynko
    Every exception in my windows server firewall that starts with "File and Printer Sharing" is disabled (ordered by name, so that includes domain, public (active), and private profiles). The Network and Sharing Center's options for everything except password protected sharing are off. Why would I still be able to access a network share on that server via an address like "\\my.server.com\" over the internet? The firewall is on for all profiles and blocking incoming connections by default. A "netstat -an" command on the server reveals the share connection is occurring over port 445 (SMB). I restarted the client to ensure it was actually re-establishing a new connection successfully. Is the "Password protected sharing: On" option in Network and Sharing Center bypassing the firewall restrictions, or adding some other exception somewhere that I'm missing? EDIT: "Custom" rules are not the problem. It's the "built-in" rules for Terminal Services that was the problem. Can you believe port 445 (File Sharing Port) has to be wide open to the internet to use Terminal Services Licensing?)

    Read the article

  • Create text file named after a cell containing other cell data

    - by user143041
    I tried using the code below for the Excel program on my `Mac Mini using the OS X Version 10.7.2 and it keeps saying Error due to file name / path: (The Excel file I am creating is going to be a template with my formulas and macros installed which will be used over and over). Sub CreateFile() Do While Not IsEmpty(ActiveCell.Offset(0, 1)) MyFile = ActiveCell.Value & ".txt" fnum = FreeFile() Open MyFile For Output As fnum Print #fnum, ActiveCell.Offset(0, 1) & " " & ActiveCell.Offset(0, 2) Close #fnum ActiveCell.Offset(1, 0).Select Loop End Sub What Im trying to do: 1st Objective I would like to have the following data to be used to create a text file. A:A is what I need the name of the file to be. B:2 is the content I need in the text file. So, A2 - "repair-video-game-Glassboro-NJ-08028.txt" is the file name and B2 to be the content in the file. Next, A3 is the file name and B3 is the content for the file, etc. ONCE the content reads what is in cell A16 and B16 (length will vary), the file creation should stop, if not then I can delete the additional files created. This sheet will never change. Is there a way to establish the excel macro to always go to this sheet instead of have to select it with the mouse to identify the starting point? 2nd Objective I would like to have the following data to be used to create a text file. A:1 is what I need the name of the file to be. B:B is the content I want in the file. So, A2 - is the file name "geo-sitemap.xml" and B:B to be the content in the file (ignore the .xml file extension in the photo). ONCE the content cell reads what is in cell "B16" (length will vary), the file creation should stop, if not then I can adjust the cells that have need content (formulated content you see in the image is preset for 500 rows). This sheet will never change. Is there a way to establish the excel macro to always go to this sheet instead of have to select it with the mouse to identify the starting point? I can Provide the content in the cells that are filled in by excel formulas that are not not to be included in the .txt files. It is ok if it is not possible. I can delete the extra cells that are not populated (based on the data sheet). Please let me know if you need any more additional information or clarity and I will be happy to provide it.

    Read the article

  • pscp: how to copy a file from a windows machine to a non-home location on another windows machine?

    - by help
    I want to copy a file from C:\temp on MachineA to C:\final on MachineB. I tried to use the following command, but it gave me an error (permission denied): C:\PROGRA~1\putty\pscp.exe -i C:\PROGRA~1\cwRsync\home\rcadmin\.ssh\id_rsa_private.ppk [email protected]:C:\final\test.txt C:\temp\test.txt It turned out I can only access C:\users\direcpc in my source computer. So if I put the file in C:\users\direcpc\text.txt, then it would work: C:\PROGRA~1\putty\pscp.exe -i C:\PROGRA~1\cwRsync\home\rcadmin\.ssh\id_rsa_private.ppk [email protected]:/test.txt C:\temp\test.txt But I want to access any location on my source computer instead of just my user home directory, is there a way to do this?

    Read the article

  • How to write to Samba folder?

    - by Darren
    Hi all, I created a Samba share on my CentOS machine and I can connect to the share and read the contents but I cannot write files to it or delete them. In Samba I have set readable to yes and writeable to yes, as well as made the folder I want to access apart of the wheel group of which I added the user that is accessing it from Samba. The folder in quesiton is /var/www/. I have set that folder and all folders under it to the wheel group which can read and write to it. What am I doing wrong here?

    Read the article

  • How to remove file permissions from an external hard drive?

    - by user2540416
    My macbook recently died and I am currently trying to figure out how to copy my data. What I did was, I took out the hard drive, put it in an enclosure and plugged it in to my other laptop that runs linux. The problem is, I cannot copy files from the hard drive due to file permissions. I tried to access the hard drive as root. But I still cannot copy files. How do I remove file permissions from the harddrive?

    Read the article

  • How can I open a file as read-only from Windows Explorer?

    - by Daniel Daranas
    Is there an easy way to open a file as read-only from Windows Explorer? My inmediate interest is in a Microsoft Access file. I am doing some sanity checks in old MS Access databases and I see that their date is automatically updated when I open them. I don't like this, since it will look like all the old files have been modified today. I am working with Windows XP. Update: As Yoda said, "Do, or do not. There is no try." In my case, it was "do not". I ended up copying the entire (big) folder tree to MyDocuments, and then opening all the databases from there.

    Read the article

  • /etc/hosts file for a multi-homed, multi-domain machine?

    - by threecheeseopera
    I have a server (debian) with two network interfaces that I would like to host multiple services and domains on; it is not entirely clear to me how the hosts file should be set up. Example: eth0, bound to WAN interface 1.2.3.4: mail.example.com www.example.com eth0:1, bound to WAN interface 1.2.3.5: www.other-domain.com eth1, bound to LAN 192.168.1.123: some-clever-hostname What should my hosts file look like? (including localhost,localhost.localdomain, etc.) Should I use DNS for some of these entries? Which ones? Thanks!

    Read the article

  • USB Permission - Write protection

    - by dekhadmai
    I have an external harddisk and my friends asked for it. The point is I don't trust in his anti-virus software. Is there anyway to allow some folders (I prepare hdd space for him) to write-able and all others is read-only ? or is there a software that can do like this ? And it would be great if I can have full access on my computer ONLY (may be with some specific software on my PC) and without having to modify anything. I don't ask for hdd-encryption since I only want to limit the area of write-able folder (and allow my friend to read through all my data), later I can scan for virus myself only in that area ... scanning entire hdd with 500gb/friend is not fun at all ! Sorry if this doesn't seems like the programming questions. Any help would be appreciate, Thank you.

    Read the article

  • SQL SERVER – FIX: ERROR Msg 5169, Level 16: FILEGROWTH cannot be greater than MAXSIZE for file

    - by pinaldave
    I am writing this blog post right after I resolve this error for one of the system. Recently one of the my friend who is expert in infrastructure as well private cloud was working on SQL Server installation. Please note he is seriously expert in what he does but he has never worked SQL Server before and have absolutely no experience with its installation. He was modifying database file and keep on getting following error. As soon as he saw me he asked me where is the maxfile size setting so he can change. Let us quickly re-create the scenario he was facing. Error Message: Msg 5169, Level 16, State 1, Line 1 FILEGROWTH cannot be greater than MAXSIZE for file ‘NewDB’. Creating Scenario: CREATE DATABASE [NewDB] ON PRIMARY (NAME = N'NewDB', FILENAME = N'D:\NewDB.mdf' , SIZE = 4096KB, FILEGROWTH = 1024KB, MAXSIZE = 4096KB) LOG ON (NAME = N'NewDB_log', FILENAME = N'D:\NewDB_log.ldf', SIZE = 1024KB, FILEGROWTH = 10%) GO Now let us see what exact command was creating error for him. USE [master] GO ALTER DATABASE [NewDB] MODIFY FILE ( NAME = N'NewDB', FILEGROWTH = 1024MB ) GO Workaround / Fix / Solution: The reason for the error is very simple. He was trying to modify the filegrowth to much higher value than the maximum file size specified for the database. There are two way we can fix it. Method 1: Reduces the filegrowth to lower value than maxsize of file USE [master] GO ALTER DATABASE [NewDB] MODIFY FILE ( NAME = N'NewDB', FILEGROWTH = 1024KB ) GO Method 2: Increase maxsize of file so it is greater than new filegrowth USE [master] GO ALTER DATABASE [NewDB] MODIFY FILE ( NAME = N'NewDB', FILEGROWTH = 1024MB, MAXSIZE = 4096MB) GO I think this blog post will help everybody who is facing similar issues. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Error Messages, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Changing the BizTalk message output file name

    - by Bill Osuch
    By default, BizTalk creates the filename of the message dropped to a send port as %MessageID%, which is the unique identifier (GUID) of the message. What if you want to create your own filename? To start, create a simple schema, and a basic orchestration that will receive the message and send it right back out, like this: If you deploy this and wire up the ports, you can drop an xml file into your receive port and have it come out at your send port named something like {7A63CAF8-317B-49D5-871F-9FD57910C3A0}.xml. Now, we'll create a new message with a custom filename. First, create a new orchestration variable called NewFileName, of the type System.String. Next, create a second message using the same schema as the message you're receiving in the Receive shape. Now, drag a Construct Message shape to the orchestration. In the shape's properties, set Messages Constructed to be the new message you just created. Double click the Message Assignment shape (inside the Construct shape...) and paste in the following code: Message_2 = Message_1;   NewFileName = Message_1(FILE.ReceivedFileName); NewFileName = NewFileName.Replace(".xml","_"); NewFileName = NewFileName + "output_" + System.DateTime.Now.Year.ToString() + "-" + System.DateTime.Now.Month.ToString();   Message_2(FILE.ReceivedFileName) = NewFileName; Here we make a copy of the received message, get it's original file name (ReceivedFileName), replace its extension with an underscore, and date-stamp it. Finally, add a Send shape and a Port to the surface, and configure them to send the message you just created. You should wind up with an orchestration like this: Deploy it, and create a new send port. It should be just about identical to the first send port, except this time the file name will be "%SourceFileName%.xml" (without the quotes of course). Fire up the application, drop in a test file, and you should now get both the xml file named with a GUID, and a second file named something along the lines of "MySchemaTestFile_output_2011-6.xml".

    Read the article

  • FileOpenPicker/FileSavePicker doesn't allow *.* wildcard file associations

    - by mbrit
    On Twitter, Matthias Jauernig commented that the FileOpenPicker and FileSavePicker doesn't allow *.* wildcard file associations. I was relaxed about this and wrote back that it was related to sandboxing implying it was a "good thing", however as Matthias commented back, perhaps it's not.In Metro-style the sandboxing works that if something gives you a file (e.g. the picker, or a share operation), you can access it regardless of where on the system. If you find the file yourself, you have to declare the type.The reason why I think it's related to sandboxing is because if you work with files programmatically you have to be explicit about the file types. This is to stop malware that you think is only interested in - say .PDF files, scanning and uploading any .EML files that it can find on the machine. It follows then on the pickers that restriction would continue. It allow's the retail store team to validate that an app is likely to behave itself. If it's an app that works with images, locking down the picker so that it can only access image file types makes sense.However Matthias mentioned that he has an app that should allow files of any arbitrary file. That fits more into the "if the user selects it, it must be OK" camp than the "programmatic scanning" camp. So now I'm left wondering why the picker doesn't allow any type to be selected.I think then maybe the decision comes down to simplicity. A lot of the decisions in Metro-style design relate to ideas about "zero intimidation". Allow the user to select any file is too much like Old Windows, and not enough like Reimagined Windows. What happens in Matthias's app if the user selects Explorer.exe as the file he or she wants to work with? I guess it's fine if you expect your user to know what they're doing (Old Windows), but not so fine if you're expecting a three year old to work with it (Reimagined Windows).

    Read the article

  • BizTalk 2009 - Error when Testing Map with Flat File Source Schema

    - by StuartBrierley
    I have recently been creating some flat file schemas using the BizTalk Server 2009 Flat File Schema Wizard.  I have then been mapping these flat file schemas to a "normal" xml schema format. I have not previsouly had any cause to map flat files and ran into some trouble when testing the first of these flat file maps; with an instance of the flat file as the source it threw an XSL transform error: Test Map.btm: error btm1050: XSL transform error: Unable to write output instance to the following <file:///C:\Documents and Settings\sbrierley\Local Settings\Temp\_MapData\Test Mapping\Test Map_output.xml>. Data at the root level is invalid. Line 1, position 1. Due to the complexity of the map in question I decided to created a small test map using the same source and destination schemas to see if I could pinpoint the problem.  Although the source message instance vaildated correctly against the flat file schema, when I then tested this simplified map I got the same error. After a time of fruitless head scratching and some serious google time I figured out what the problem was. Looking at the map properties I noticed that I had the test map input set to "XML" - for a flat file instance this should be set to "native".

    Read the article

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • How does DataContractSerializer write to private fields?

    - by Eric
    I understand how XMLSerializer could work by using reflection to figure out what public read/write fields or properties it should be using to serialize or de-serialize XML. Yet XMLSerializer requires that the fields be public and read/write. However, DataContractSerializer is able to read or write to or from completely private fields in a class. So I'm wondering how this is even possible with out explicitly giving DataContractSerializer additional access rights to my class(es).

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >