Search Results

Search found 2490 results on 100 pages for 'matching'.

Page 91/100 | < Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >

  • regex to break a string into "key" / "value" pairs when # of pairs is variable?

    - by user141146
    Hi, I'm using Ruby 1.9 and I'm wondering if there's a simple regex way to do this. I have many strings that look like some variation of this: str = "Allocation: Random, Control: Active Control, Endpoint Classification: Safety Study, Intervention Model: Parallel Assignment, Masking: Double Blind (Subject, Caregiver, Investigator, Outcomes Assessor), Primary Purpose: Treatment" The idea is that I'd like to break this string into its functional components Allocation: Random Control: Active Control Endpoint Classification: Safety Study Intervention Model: Parallel Assignment Masking: Double Blind (Subject, Caregiver, Investigator, Outcomes, Assessor) Primary Purpose: Treatment The "syntax" of the string is that there is a "key" which consists of one or more "words or other characters" (e.g. Intervention Model) followed by a colon (:). Each key has a corresponding "value" (e.g., Parallel Assignment) that immediately follows the colon (:)…The "value" consists of words, commas (whatever), but the end of the "value" is signaled by a comma. The # of key/value pairs is variable. I'm also assuming that colons (:) aren't allowed to be part of the "value" and that commas (,) aren't allowed to be part of the "key". One would think that there is a "regexy" way to break this into its component pieces, but my attempt at making an appropriate matching regex only picks up the first key/value pair and I'm not sure how to capture the others. Any thoughts on how to capture the other matches? regex = /(([^,]+?): ([^:]+?,))+?/ => /(([^,]+?): ([^:]+?,))+?/ irb(main):139:0> str = "Allocation: Random, Control: Active Control, Endpoint Classification: Safety Study, Intervention Model: Parallel Assignment, Masking: Double Blind (Subject, Caregiver, Investigator, Outcomes Assessor), Primary Purpose: Treatment" => "Allocation: Random, Control: Active Control, Endpoint Classification: Safety Study, Intervention Model: Parallel Assignment, Masking: Double Blind (Subject, Caregiver, Investigator, Outcomes Assessor), Primary Purpose: Treatment" irb(main):140:0> str.match regex => #<MatchData "Allocation: Random," 1:"Allocation: Random," 2:"Allocation" 3:" Random,"> irb(main):141:0> $1 => "Allocation: Random," irb(main):142:0> $2 => "Allocation" irb(main):143:0> $3 => " Random," irb(main):144:0> $4 => nil

    Read the article

  • Calculating rotation and translation matrices between two odometry positions for monocular linear triangulation

    - by user1298891
    Recently I've been trying to implement a system to identify and triangulate the 3D position of an object in a robotic system. The general outline of the process goes as follows: Identify the object using SURF matching, from a set of "training" images to the actual live feed from the camera Move/rotate the robot a certain amount Identify the object using SURF again in this new view Now I have: a set of corresponding 2D points (same object from the two different views), two odometry locations (position + orientation), and camera intrinsics (focal length, principal point, etc.) since it's been calibrated beforehand, so I should be able to create the 2 projection matrices and triangulate using a basic linear triangulation method as in Hartley & Zissermann's book Multiple View Geometry, pg. 312. Solve the AX = 0 equation for each of the corresponding 2D points, then take the average In practice, the triangulation only works when there's almost no change in rotation; if the robot even rotates a slight bit while moving (due to e.g. wheel slippage) then the estimate is way off. This also applies for simulation. Since I can only post two hyperlinks, here's a link to a page with images from the simulation (on the map, the red square is simulated robot position and orientation, and the yellow square is estimated position of the object using linear triangulation.) So you can see that the estimate is thrown way off even by a little rotation, as in Position 2 on that page (that was 15 degrees; if I rotate it any more then the estimate is completely off the map), even in a simulated environment where a perfect calibration matrix is known. In a real environment when I actually move around with the robot, it's worse. There aren't any problems with obtaining point correspondences, nor with actually solving the AX = 0 equation once I compute the A matrix, so I figure it probably has to do with how I'm setting up the two camera projection matrices, specifically how I'm calculating the translation and rotation matrices from the position/orientation info I have relative to the world frame. How I'm doing that right now is: Rotation matrix is composed by creating a 1x3 matrix [0, (change in orientation angle), 0] and then converting that to a 3x3 one using OpenCV's Rodrigues function Translation matrix is composed by rotating the two points (start angle) degrees and then subtracting the final position from the initial position, in order to get the robot's straight and lateral movement relative to its starting orientation Which results in the first projection matrix being K [I | 0] and the second being K [R | T], with R and T calculated as described above. Is there anything I'm doing really wrong here? Or could it possibly be some other problem? Any help would be greatly appreciated.

    Read the article

  • How to optimize this SQL query for a rectangular region?

    - by Andrew B.
    I'm trying to optimize the following query, but it's not clear to me what index or indexes would be best. I'm storing tiles in a two-dimensional plane and querying for rectangular regions of that plane. The table has, for the purposes of this question, the following columns: id: a primary key integer world_id: an integer foreign key which acts as a namespace for a subset of tiles tileY: the Y-coordinate integer tileX: the X-coordinate integer value: the contents of this tile, a varchar if it matters. I have the following indexes: "ywot_tile_pkey" PRIMARY KEY, btree (id) "ywot_tile_world_id_key" UNIQUE, btree (world_id, "tileY", "tileX") "ywot_tile_world_id" btree (world_id) And this is the query I'm trying to optimize: ywot=> EXPLAIN ANALYZE SELECT * FROM "ywot_tile" WHERE ("world_id" = 27685 AND "tileY" <= 6 AND "tileX" <= 9 AND "tileX" >= -2 AND "tileY" >= -1 ); QUERY PLAN ------------------------------------------------------------------------------------------------------------------------------------------- Bitmap Heap Scan on ywot_tile (cost=11384.13..149421.27 rows=65989 width=168) (actual time=79.646..80.075 rows=96 loops=1) Recheck Cond: ((world_id = 27685) AND ("tileY" <= 6) AND ("tileY" >= (-1)) AND ("tileX" <= 9) AND ("tileX" >= (-2))) -> Bitmap Index Scan on ywot_tile_world_id_key (cost=0.00..11367.63 rows=65989 width=0) (actual time=79.615..79.615 rows=125 loops=1) Index Cond: ((world_id = 27685) AND ("tileY" <= 6) AND ("tileY" >= (-1)) AND ("tileX" <= 9) AND ("tileX" >= (-2))) Total runtime: 80.194 ms So the world is fixed, and we are querying for a rectangular region of tiles. Some more information that might be relevant: All the tiles for a queried region may or may not be present The height and width of a queried rectangle are typically about 10x10-20x20 For any given (world, X) or (world, Y) pair, there may be an unbounded number of matching tiles, but the worst case is currently around 10,000, and typically there are far fewer. New tiles are created far less frequently than existing ones are updated (changing the 'value'), and that itself is far less frequent that just reading as in the query above. The only thing I can think of would be to index on (world, X) and (world, Y). My guess is that the database would be able to take those two sets and intersect them. The problem is that there is a potentially unbounded number of matches for either for either of those. Is there some other kind of index that would be more appropriate?

    Read the article

  • How we can perform Action on Sequence UIButtons?

    - by Prince Shazad
    As My Screen shot show that i am working on word matching game.In this game i assign my words to different UIButtons in Specific sequence on different loctions(my red arrow shows this sequence)and of rest UIButtons i assign a one of random character(A-Z).when i Click on any UIButtons its title will be assign to UILabel which is in Fornt of Current Section:i campare this UILabel text to below UILabels text which is in fornt of timer.when it match to any of my UILabels its will be deleted.i implement all this process already. But my problem is that which is show by black lines.if the player find the first word which is "DOG". he click the Two UIButtons in Sequence,but not press the Third one in Sequence.(as show by black line).so here i want that when player press the any UIButtons which is not in Sequence then remove the previous text(which is "DO") of UILabel and now the Text of UILabel is only "G" . Here is my code to get the UIButtons titles and assign it UILabel. - (void)aMethod:(id)sender { UIButton *button = (UIButton *)sender; NSString *get = (NSString *)[[button titleLabel] text]; NSString *origText = mainlabel.text; mainlabel.text = [origText stringByAppendingString:get]; if ([mainlabel.text length ]== 3) { if([mainlabel.text isEqualToString: a]){ lbl.text=@"Right"; [btn1 removeFromSuperview]; score=score+10; lblscore.text=[NSString stringWithFormat:@"%d",score]; words=words-1; lblwords.text=[NSString stringWithFormat:@"%d",words]; mainlabel.text=@""; a=@"tbbb"; } else if([mainlabel.text isEqualToString: c]){ lbl.text=@"Right"; [btn2 removeFromSuperview]; score=score+10; lblscore.text=[NSString stringWithFormat:@"%d",score]; words=words-1; lblwords.text=[NSString stringWithFormat:@"%d",words]; mainlabel.text=@""; c=@"yyyy"; } else if([mainlabel.text isEqualToString: d]){ lbl.text=@"Right"; [btn3 removeFromSuperview]; score=score+10; lblscore.text=[NSString stringWithFormat:@"%d",score]; words=words-1; lblwords.text=[NSString stringWithFormat:@"%d",words]; mainlabel.text=@""; d=@"yyyy"; } else { lbl.text=@"Wrong"; mainlabel.text=@""; } }} Thanx in advance

    Read the article

  • Many-To-Many Query with Linq-To-NHibernate

    - by rjygraham
    Ok guys (and gals), this one has been driving me nuts all night and I'm turning to your collective wisdom for help. I'm using Fluent Nhibernate and Linq-To-NHibernate as my data access story and I have the following simplified DB structure: CREATE TABLE [dbo].[Classes]( [Id] [bigint] IDENTITY(1,1) NOT NULL, [Name] [nvarchar](100) NOT NULL, [StartDate] [datetime2](7) NOT NULL, [EndDate] [datetime2](7) NOT NULL, CONSTRAINT [PK_Classes] PRIMARY KEY CLUSTERED ( [Id] ASC ) CREATE TABLE [dbo].[Sections]( [Id] [bigint] IDENTITY(1,1) NOT NULL, [ClassId] [bigint] NOT NULL, [InternalCode] [varchar](10) NOT NULL, CONSTRAINT [PK_Sections] PRIMARY KEY CLUSTERED ( [Id] ASC ) CREATE TABLE [dbo].[SectionStudents]( [SectionId] [bigint] NOT NULL, [UserId] [uniqueidentifier] NOT NULL, CONSTRAINT [PK_SectionStudents] PRIMARY KEY CLUSTERED ( [SectionId] ASC, [UserId] ASC ) CREATE TABLE [dbo].[aspnet_Users]( [ApplicationId] [uniqueidentifier] NOT NULL, [UserId] [uniqueidentifier] NOT NULL, [UserName] [nvarchar](256) NOT NULL, [LoweredUserName] [nvarchar](256) NOT NULL, [MobileAlias] [nvarchar](16) NULL, [IsAnonymous] [bit] NOT NULL, [LastActivityDate] [datetime] NOT NULL, PRIMARY KEY NONCLUSTERED ( [UserId] ASC ) I omitted the foreign keys for brevity, but essentially this boils down to: A Class can have many Sections. A Section can belong to only 1 Class but can have many Students. A Student (aspnet_Users) can belong to many Sections. I've setup the corresponding Model classes and Fluent NHibernate Mapping classes, all that is working fine. Here's where I'm getting stuck. I need to write a query which will return the sections a student is enrolled in based on the student's UserId and the dates of the class. Here's what I've tried so far: 1. var sections = (from s in this.Session.Linq<Sections>() where s.Class.StartDate <= DateTime.UtcNow && s.Class.EndDate > DateTime.UtcNow && s.Students.First(f => f.UserId == userId) != null select s); 2. var sections = (from s in this.Session.Linq<Sections>() where s.Class.StartDate <= DateTime.UtcNow && s.Class.EndDate > DateTime.UtcNow && s.Students.Where(w => w.UserId == userId).FirstOrDefault().Id == userId select s); Obviously, 2 above will fail miserably if there are no students matching userId for classes the current date between it's start and end dates...but I just wanted to try. The filters for the Class StartDate and EndDate work fine, but the many-to-many relation with Students is proving to be difficult. Everytime I try running the query I get an ArgumentNullException with the message: Value cannot be null. Parameter name: session I've considered going down the path of making the SectionStudents relation a Model class with a reference to Section and a reference to Student instead of a many-to-many. I'd like to avoid that if I can, and I'm not even sure it would work that way. Thanks in advance to anyone who can help. Ryan

    Read the article

  • Deterministic key serialization

    - by Mike Boers
    I'm writing a mapping class which uses SQLite as the storage backend. I am currently allowing only basestring keys but it would be nice if I could use a couple more types hopefully up to anything that is hashable (ie. same requirements as the builtin dict). To that end I would like to derive a deterministic serialization scheme. Ideally, I would like to know if any implementation/protocol combination of pickle is deterministic for hashable objects (e.g. can only use cPickle with protocol 0). I noticed that pickle and cPickle do not match: >>> import pickle >>> import cPickle >>> def dumps(x): ... print repr(pickle.dumps(x)) ... print repr(cPickle.dumps(x)) ... >>> dumps(1) 'I1\n.' 'I1\n.' >>> dumps('hello') "S'hello'\np0\n." "S'hello'\np1\n." >>> dumps((1, 2, 'hello')) "(I1\nI2\nS'hello'\np0\ntp1\n." "(I1\nI2\nS'hello'\np1\ntp2\n." Another option is to use repr to dump and ast.literal_eval to load. This would only be valid for builtin hashable types. I have written a function to determine if a given key would survive this process (it is rather conservative on the types it allows): def is_reprable_key(key): return type(key) in (int, str, unicode) or (type(key) == tuple and all( is_reprable_key(x) for x in key)) The question for this method is if repr itself is deterministic for the types that I have allowed here. I believe this would not survive the 2/3 version barrier due to the change in str/unicode literals. This also would not work for integers where 2**32 - 1 < x < 2**64 jumping between 32 and 64 bit platforms. Are there any other conditions (ie. do strings serialize differently under different conditions)? (If this all fails miserably then I can store the hash of the key along with the pickle of both the key and value, then iterate across rows that have a matching hash looking for one that unpickles to the expected key, but that really does complicate a few other things and I would rather not do it.) Any insights?

    Read the article

  • Clojure vars and Java static methods

    - by j-g-faustus
    I'm a few days into learning Clojure and are having some teething problems, so I'm asking for advice. I'm trying to store a Java class in a Clojure var and call its static methods, but it doesn't work. Example: user=> (. java.lang.reflect.Modifier isPrivate 1) false user=> (def jmod java.lang.reflect.Modifier) #'user/jmod user=> (. jmod isPrivate 1) java.lang.IllegalArgumentException: No matching method found: isPrivate for class java.lang.Class (NO_SOURCE_FILE:0) at clojure.lang.Compiler.eval(Compiler.java:4543) From the exception it looks like the runtime expects a var to hold an object, so it calls .getClass() to get the class and looks up the method using reflection. In this case the var already holds a class, so .getClass() returns java.lang.Class and the method lookup obviously fails. Is there some way around this, other than writing my own macro? In the general case I'd like to have either an object or a class in a varible and call the appropriate methods on it - duck typing for static methods as well as for instance methods. In this specific case I'd just like a shorter name for java.lang.reflect.Modifier, an alias if you wish. I know about import, but looking for something more general, like the Clojure namespace alias but for Java classes. Are there other mechanisms for doing this? Edit: Maybe I'm just confused about the calling conventions here. I thought the Lisp (and by extension Clojure) model was to evaluate all arguments and call the first element in the list as a function. In this case (= jmod java.lang.reflect.Modifier) returns true, and (.getName jmod) and (.getName java.lang.reflect.Modifier) both return the same string. So the variable and the class name clearly evaluate to the same thing, but they still cannot be called in the same fashion. What's going on here? Edit 2 Answering my second question (what is happening here), the Clojure doc says that If the first operand is a symbol that resolves to a class name, the access is considered to be to a static member of the named class... Otherwise it is presumed to be an instance member http://clojure.org/java_interop under "The Dot special form" "Resolving to a class name" is apparently not the same as "evaluating to something that resolves to a class name", so what I am trying to do here is something the dot special form does not support.

    Read the article

  • Optimize MySQL query (ngrams, COUNT(), GROUP BY, ORDER BY)

    - by Gerardo
    I have a database with thousands of companies and their locations. I have implemented n-grams to optimize search. I am making one query to retrieve all the companies that match with the search query and another one to get a list with their locations and the number of companies in each location. The query I am trying to optimize is the latter. Maybe the problem is this: Every company ('anunciante') has a field ('estado') to make logical deletes. So, if 'estado' equals 1, the company should be retrieved. When I run the EXPLAIN command, it shows that it goes through almost 40k rows, when the actual result (the reality matching companies) are 80. How can I optimize this? This is my query (XXX represent the n-grams for the search query): SELECT provincias.provincia AS provincia, provincias.id, COUNT(*) AS cantidad FROM anunciantes JOIN anunciante_invertido AS a_i0 ON anunciantes.id = a_i0.id_anunciante JOIN indice_invertido AS indice0 ON a_i0.id_invertido = indice0.id LEFT OUTER JOIN domicilios ON anunciantes.id = domicilios.id_anunciante LEFT OUTER JOIN localidades ON domicilios.id_localidad = localidades.id LEFT OUTER JOIN provincias ON provincias.id = localidades.id_provincia WHERE anunciantes.estado = 1 AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') AND indice0.id IN (SELECT invertido_ngrama.id_palabra FROM invertido_ngrama JOIN ngrama ON ngrama.id = invertido_ngrama.id_ngrama WHERE ngrama.ngrama = 'XXX') GROUP BY provincias.id ORDER BY cantidad DESC And this is the query explained (hope it can be read in this format): id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY anunciantes ref PRIMARY,estado estado 1 const 36669 Using index; Using temporary; Using filesort 1 PRIMARY domicilios ref id_anunciante id_anunciante 4 db84771_viaempresas.anunciantes.id 1 1 PRIMARY localidades eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.domicilios.id_localidad 1 1 PRIMARY provincias eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.localidades.id_provincia 1 1 PRIMARY a_i0 ref PRIMARY,id_anunciante,id_invertido PRIMARY 4 db84771_viaempresas.anunciantes.id 1 Using where; Using index 1 PRIMARY indice0 eq_ref PRIMARY PRIMARY 4 db84771_viaempresas.a_i0.id_invertido 1 Using index 6 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 6 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 5 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 5 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 4 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 4 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 3 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 3 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index 2 DEPENDENT SUBQUERY ngrama const PRIMARY,ngrama ngrama 5 const 1 Using index 2 DEPENDENT SUBQUERY invertido_ngrama eq_ref PRIMARY,id_palabra,id_ngrama PRIMARY 8 func,const 1 Using index

    Read the article

  • Spring constructor injection error

    - by Jeune
    I am getting the following error for a bean in my application context: Related cause: org.springframework.beans.factory.UnsatisfiedDependencyException: Error creating bean with name 'businessLogicContext' d efined in class path resource [activemq-jms-consumer.xml]: Unsatisfied dependency expressed through constructor argument with index 0 of type [java.lang.String]: Could not convert constructor argument value of type [java.util.ArrayList] to required type [java.lang.String]: Failed to convert value of type [java.util.ArrayList] to required type [java.lang.Stri ng]; nested exception is java.lang.IllegalArgumentException: Cannot convert value of type [java.util.ArrayList] to requi red type [java.lang.String]: no matching editors or conversion strategy found at org.springframework.beans.factory.support.ConstructorResolver.createArgumentArray(ConstructorResolver.java:53 4) at org.springframework.beans.factory.support.ConstructorResolver.autowireConstructor(ConstructorResolver.java:18 6) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.autowireConstructor(AbstractAuto wireCapableBeanFactory.java:855) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.createBeanInstance(AbstractAutow ireCapableBeanFactory.java:765) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.doCreateBean(AbstractAutowireCap ableBeanFactory.java:412) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory$1.run(AbstractAutowireCapableBea nFactory.java:383) at java.security.AccessController.doPrivileged(Native Method) at org.springframework.beans.factory.support.AbstractAutowireCapableBeanFactory.createBean(AbstractAutowireCapab leBeanFactory.java:353) at org.springframework.beans.factory.support.AbstractBeanFactory$1.getObject(AbstractBeanFactory.java:245) at org.springframework.beans.factory.support.DefaultSingletonBeanRegistry.getSingleton(DefaultSingletonBeanRegis try.java:169) at org.springframework.beans.factory.support.AbstractBeanFactory.getBean(AbstractBeanFactory.java:242) at org.springframework.beans.factory.support.AbstractBeanFactory.getBean(AbstractBeanFactory.java:164) at org.springframework.beans.factory.support.DefaultListableBeanFactory.preInstantiateSingletons(DefaultListable BeanFactory.java:400) at org.springframework.context.support.AbstractApplicationContext.finishBeanFactoryInitialization(AbstractApplic ationContext.java:736) at org.springframework.context.support.AbstractApplicationContext.refresh(AbstractApplicationContext.java:369) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java :123) at org.springframework.context.support.ClassPathXmlApplicationContext.<init>(ClassPathXmlApplicationContext.java :66) Here is my bean: <bean id="businessLogicContext" class="org.springframework.context.support.ClassPathXmlApplicationContext" depends-on="resolveProperty"> <constructor-arg index="0"> <list> <value>jms-applicationContext.xml</value> <value>jms-managerBeanContext.xml</value> <value>jms-daoContext.xml</value> <value>jms-serviceContext.xml</value> </list> </constructor-arg> </bean> I don't know what's wrong, I have googled how to inject a string array via constructor injection and the way I do it above seems okay.

    Read the article

  • translating specifications into query predicates

    - by Jeroen
    I'm trying to find a nice and elegant way to query database content based on DDD "specifications". In domain driven design, a specification is used to check if some object, also known as the candidate, is compliant to a (domain specific) requirement. For example, the specification 'IsTaskDone' goes like: class IsTaskDone extends Specification<Task> { boolean isSatisfiedBy(Task candidate) { return candidate.isDone(); } } The above specification can be used for many purposes, e.g. it can be used to validate if a task has been completed, or to filter all completed tasks from a collection. However, I want to re-use this, nice, domain related specification to query on the database. Of course, the easiest solution would be to retrieve all entities of our desired type from the database, and filter that list in-memory by looping and removing non-matching entities. But clearly that would not be optimal for performance, especially when the entity count in our db increases. Proposal So my idea is to create a 'ConversionManager' that translates my specification into a persistence technique specific criteria, think of the JPA predicate class. The services looks as follows: public interface JpaSpecificationConversionManager { <T> Predicate getPredicateFor(Specification<T> specification, Root<T> root, CriteriaQuery<?> cq, CriteriaBuilder cb); JpaSpecificationConversionManager registerConverter(JpaSpecificationConverter<?, ?> converter); } By using our manager, the users can register their own conversion logic, isolating the domain related specification from persistence specific logic. To minimize the configuration of our manager, I want to use annotations on my converter classes, allowing the manager to automatically register those converters. JPA repository implementations could then use my manager, via dependency injection, to offer a find by specification method. Providing a find by specification should drastically reduce the number of methods on our repository interface. In theory, this all sounds decent, but I feel like I'm missing something critical. What do you guys think of my proposal, does it comply to the DDD way of thinking? Or is there already a framework that does something identical to what I just described?

    Read the article

  • Android pluginable application

    - by Alxandr
    I've been trying to create an android-application the last couple of weeks, and mostly everything has worked out great, but there is one thing that I was wondering about, and that is pluginability trough the use of intents. What I'm trying to create is basically a comic-reader. As of the version I use now, I open the application and get a list of commics that are my favourites, then I enter one to get a detailed view, and finally I enter a page. This is managed trough 3 activities. List, Details and Page. However, as of now the application can only read comics of one source (a specialiced xml-feed comming from my server), and I was hoping to be able to expand this a litle (also, the page-activity and some other stuff needs to be cleaned up in, so I'm thinking about remaking from scratch, and just take the first go as a learning-round). And I came up with an idea which I think sounds great, but I don't know if it's possible, but this is what I'm thinking about: The user enters the application and get an (first time empty) list of comics. The user hits a button to find comics, this launces an intent that says something like "find comic" or something like that. This should cause the system to display all matching activities. This would make it possible to provide different comic-providers trough different applications. Another activity kicks in and might displays some options to the user (for instance a file-browser), or might not (in the example of an xml-feed, which should just load). The list is returned to the first activity and displayed to the user. The second (find) activity is closed. The user picks a comic from the list. This should open some details-activity. The details-activity should receive a key which corresponds to the comic selected. This should be unique amongst the comic-providers. The details-view should get it's data trough some cind of content-provider, or an activity (whichever is most suited, if one of them is). The user can select a page. This should be the same routine as step 5. My question is, is this possible in the android system, and if it is, is it a bad idea? And also, is there any better way to achieve more or less the same thing?

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • Dynamic Multiple Choice (Like a Wizard) - How would you design it? (e.g. Schema, AI model, etc.)

    - by henry74
    This question can probably be broken up into multiple questions, but here goes... In essence, I'd like to allow users to type in what they would like to do and provide a wizard-like interface to ask for information which is missing to complete a requested query. For example, let's say a user types: "What is the weather like in Springfield?" We recognize the user is interested in weather, but it could be Springfield, Il or Springfield in another state. A follow-up question would be: What Springfield did you want weather for? 1 - Springfield, Il 2 - Springfield, Wi You can probably think of a million examples where a request is missing key data or its ambiguous. Make the assumption the gist of what the user wants can be understood, but there are missing pieces of data required to complete the request. Perhaps you can take it as far back as asking what the user wants to do and "leading" them to a query. This is not AI in the sense of taking any input and truly understanding it. I'm not referring to having some way to hold a conversation with a user. It's about inferring what a user wants, checking to see if there is an applicable service to be provided, identifying the inputs needed and overlaying that on top of what's missing from the request, then asking the user for the remaining information. That's it! :-) How would you want to store the information about services? How would you go about determining what was missing from the input data? My thoughts: Use regex expressions to identify clear pieces of information. These will be matched to the parameters of a service. Figure out which parameters do not have matching data and look up the associated question for those parameters. Ask those questions and capture answers. Re-run the service passing in the newly captured data. These would be more free-form questions. For multiple choice, identify the ambiguity and search for potential matches ranked in order of likelihood (add in user history/preferences to help decide). Provide the top 3 as choices. Thoughts appreciated. Cheers, Henry

    Read the article

  • Is this a legitimate implementation of a 'remember me' function for my web app?

    - by user246114
    Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

    Read the article

  • meteor mongodb _id changing after insert (and UUID property as well)

    - by lommaj
    I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • Check my anagram code from a job interview in the past.

    - by Michael Dorgan
    Had the following as an interview question a while ago and choked so bad on basic syntax that I failed to advance (once the adrenalin kicks in, coding goes out the window.) Given a list of string, return a list of sets of strings that are anagrams of the input set. i.e. "dog","god", "foo" should return {"dog","god"}. Afterward, I created the code on my own as a sanity check and it's been around now for a bit. I'd welcome input on it to see if I missed anything or if I could have done it much more efficiently. Take it as a chance to improve myself and learn other techniques: void Anagram::doWork(list input, list &output) { typedef list SortType; SortType sortedInput; // sort each string and pair it with the original for(list<string>::iterator i = input.begin(); i != input.end(); ++i) { string tempString(*i); std::sort(tempString.begin(), tempString.end()); sortedInput.push_back(make_pair(*i, tempString)); } // Now step through the new sorted list for(SortType::iterator i = sortedInput.begin(); i != sortedInput.end();) { set<string> newSet; // Assume (hope) we have a match and pre-add the first. newSet.insert(i->first); // Set the secondary iterator one past the outside to prevent // matching the original SortType::iterator j = i; ++j; while(j != sortedInput.end()) { if(i->second == j->second) { // If the string matches, add it to the set and remove it // so that future searches need not worry about it newSet.insert(j->first); j = sortedInput.erase(j); } else { // else, next element ++j; } } // If size is bigger than our original push, we have a match - save it to the output if(newSet.size() > 1) { output.push_back(newSet); } // erase this element and update the iterator i = sortedInput.erase(i); } }

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Help with IF THEN breaking when comparing results from MYSQL query.

    - by roydukkey
    I'm have a problem with an invite system. The if statement seems to break. It shows the message "Fail" but the UPDATE statement still executes. Why do both the THEN and the ELSE excute? $dbConn = new dbConn(); // Check if POST user_username and user_hash are matching and valid; both are hidden for fields $sql = "SELECT user_username " . "FROM table_users " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"])." " . "AND user_hash='".mysql_real_escape_string($_POST["user_hash"])."' " . "AND user_enabled=0;"; $objUser = $dbConn->query($sql); // If result contains 1 or more rows if( mysql_num_rows($objUser) != NULL ){ $objUser = mysql_fetch_assoc($objUser); $ssnUser->login( $objUser["user_username"] ); $sql = "UPDATE table_users SET " . "user_enabled=1, " . "user_first_name='".mysql_real_escape_string($_POST["user_first_name"])."', " . "user_last_name='".mysql_real_escape_string($_POST["user_last_name"])."', " . "user_password='".mysql_real_escape_string( md5($_POST["user_password"]) )."' " . "WHERE user_id=".mysql_real_escape_string($_POST["user_id"]).";"; $dbConn->query($sql); echo "Success"; header( "Refresh: 5; url=/account/?action=domains" ); } else { echo "Fail"; } This dbConn Class is as follows: class dbConn{ var $username = "xxxx_admin"; var $password = "xxxxxxxx"; var $server = "localhost"; var $database = "xxxx"; var $objConn; function __construct(){ $conn = mysql_connect( $this->server, $this->username, $this->password, true ); if( !$conn ){ die("Could not connect: ".mysql_error() ); } else { $this->objConn = $conn; } unset($conn); } function __destruct(){ mysql_close( $this->objConn ); unset( $this ); } function query( $query, $db = false ){ mysql_select_db( $db != false ? $db : $this->database, $this->objConn ); $result = mysql_query( $query ); unset($query,$db); return $result; } }

    Read the article

  • I want to get the value from one class (SearchTableViewController.m) to another class (HistoryTableV

    - by ahmet732
    #import <UIKit/UIKit.h> @class SearchDetailViewController; @interface SearchTableViewController : UITableViewController <UISearchBarDelegate, UITableViewDelegate, UITableViewDataSource>{ IBOutlet UITableView *myTableView; NSMutableArray *tableData;//will be storing data that will be displayed in table. //Search array den buna aktarma yapcaz ilerde görceksin. NSMutableArray *searchedData;//will be storing data matching with the search string UISearchBar *sBar;//search bar NSMutableArray *searchArray; // It holds the medicines that are shown in tableview SearchDetailViewController * searchDetailViewController; NSMutableArray *deneme; } @property(nonatomic,retain)UISearchBar *sBar; @property(nonatomic,retain)IBOutlet UITableView *myTableView; @property(nonatomic,retain)NSMutableArray *tableData; @property(nonatomic,retain)NSMutableArray *searchedData; @property (nonatomic, retain) NSMutableArray *searchArray; @property (nonatomic, retain) SearchDetailViewController *searchDetailViewController; @property (nonatomic, copy) NSMutableArray *deneme; @end SearchTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **deneme= [[NSMutableArray alloc]init]; deneme=[tableData objectAtIndex:indexPath.row];** ****NSLog(@"my row = %@", deneme);**// I holded one of the selected cells here** HistoryTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **SearchTableViewController *obj= [[SearchTableViewController alloc]init];** **NSLog(@"my 2nd row= %@", [obj deneme]); //it prints nil** } My project is TabBar. There are two buttons on it- Search and History. I want to display selected items in a table in History tab. But i can not bring the selected item from SearchTableViewController.m to the class (HistoryTableViewController.m) The problem is : I can hold one of the selected items in an array (named deneme)from table in SearchTableViewController.m but i can not take it to HistoryTableViewController.m. It prints nil in console screen.... If I can make it visible in History class, I display those selected items on table. Please help me !!!

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • Replace text in XSL using wildcards

    - by JosephThomas
    This is similar to an earlier problem I was having which you guys solved in less than a day. I am working with XML files that are generated by a digital video camera. The camera allows the user to save all of the camera's settngs to an SD card so that the settings can be recalled or loaded into another camera. The XSL stylesheet I am writing will allow users to view the camera's settings, as saved to the SD card in a web browser. While most of the values in the XML file -- as formatted by my stylesheet -- make sense to humans, some do not. What I would like to do is have the stylesheet display text that is based on the value in the XML file but more easily understood by humans. A typical value that can be written to the XML file is "_23_970" which represents the camera's frame rate. This would be better displayed as 23.970 (or 023.970). The first underscore is a sort of place holder to make a space for values over 099.999. The second underscore, obviously represents the decimal. My previous (similar) question involved replacing predictable text, and the solution was matching templates. In this case, however, the camera can be set at any one of 119,999 frame rates (I think I did that math correctly). The approach, I would guess, is to pass a value to the displayed webpage that keeps the numeric values (each digit), replaces the second underscore with a decimal, and replaces the first underscore with either an nbsp or a zero (whichever is easier). If the first character in the string is a "1" (the camera can run at frame rates up to 120.000) then the one should be passed on to the page displayed by the stylesheet. I have read other posts here regarding wildcards, but couldn't find one that answered this question. EDIT: Sorry for leaving out important info. I fared better on my first try at asking a question! I guess I got complacent. Anyhow . . . I should have shown you the code that displays the text in the XSL file as is: <tr> <xsl:for-each select="Settings/Groups/Recording"> <tr><td class="title_column">Frame Rate</td><td><xsl:value-of select="RecOutLinkSpeed"/></td></tr> </xsl:for-each> </tr> I should also have given you the URL for the sample file I have been working with: http://josephthomas.info/Alexa/Setup_120511_140322.xml

    Read the article

< Previous Page | 87 88 89 90 91 92 93 94 95 96 97 98  | Next Page >