Search Results

Search found 27233 results on 1090 pages for 'information quality'.

Page 928/1090 | < Previous Page | 924 925 926 927 928 929 930 931 932 933 934 935  | Next Page >

• Recommendations for Continuous integration for Mercurial/Kiln + MSBuild + MSTest

  - by TDD

  We have our source code stored in Kiln/Mercurial repositories; we use MSBuild to build our product and we have Unit Tests that utilize MSTest (Visual Studio Unit Tests). What solutions exist to implement a continuous integration machine (i.e. Build machine). The requirements for this are: A build should be kicked of when necessary (i.e. code has changed in the Repositories we care about) Before the actual build, the latest version of the source code must be acquired from the repository we are building from The build must build the entire product The build must build all Unit Tests The build must execute all unit tests A summary of success/failure must be sent out after the build has finished; this must include information about the build itself but also about which Unit Tests failed and which ones succeeded. The summary must contain which changesets were in this build that were not yet in the previous successful (!) build The system must be configurable so that it can build from multiple branches(/Repositories). Ideally, this system would run on a single box (our product isn't that big) without any server components. What solutions are currently available? What are their pros/cons? From the list above, what can be done and what cannot be done? Thanks

  Read the article

• Visual Studio + Database Edition + CDC = Deploy Fail

  - by Ben

  Hi All, I've got a database using change data capture (CDC) that is created from a Visual Studio database project (GDR2). My problem is that I have a stored procedure that is analyzing the CDC information and then returning data. How is that a problem you ask? Well, the order of operation is as follows. Pre-deployment Script Tables Indexes, keys, etc. Procedures Post-deployment Script Inside the post-deployment script is where I enable CDC. Here-in lies the problem. The procedure that is acting on the CDC tables is bombing because they don't exist yet! I've tried to put the call to sys.sp_cdc_enable_table in the script that creates the table, but it doesn't like that. Error 102 TSD03070: This statement is not recognized in this context. C:...\Schema Objects\Schemas\dbo\Tables\Foo.table.sql 20 1 Foo Is there a better/built-in way to enable CDC such that it's references are available when the stored procedures are created? Is there a way to run a script after tables are created but before other objects are created? How about a way to create the procedure dependencies be damned? Or maybe I'm just doing things that shouldn't be done?!?! Now, I have a work around. Comment out the sproc body Deploy (CDC is created) Uncomment sproc Deploy Everything is great until the next time I update a CDC tracked table. Then I need to comment out the 'offending' procedure. Thanks for reading my question and thanks for your help!

  Read the article

• RTTI Dynamic array TValue Delphi 2010

  - by user558126

  Hello I have a question. I am a newbie with Run Time Type Information from Delphi 2010. I need to set length to a dynamic array into a TValue. You can see the code. Type TMyArray = array of integer; TMyClass = class publihed function Do:TMyArray; end; function TMyClass.Do:TMyArray; begin SetLength(Result,5); for i:=0 to 4 Result[i]=3; end; ....... ....... ...... y:TValue; Param:array of TValue; ......... y=Methods[i].Invoke(Obj,Param);//delphi give me a DynArray type kind, is working, Param works to any functions. if Method[i].ReturnType.TypeKind = tkDynArray then//is working... begin I want to set length for y to 10000//i don't know how to write. end; I don't like Generics Collections.

  Read the article

• Jboss 6 Cluster Singleton Clustered

  - by DanC

  I am trying to set up a Jboss 6 in a clustered environment, and use it to host clustered stateful singleton EJBs. So far we succesfully installed a Singleton EJB within the cluster, where different entrypoints to our application (through a website deployed on each node) point to a single environment on which the EJB is hosted (thus mantaining the state of static variables). We achieved this using the following configuration: Bean interface: @Remote public interface IUniverse { ... } Bean implementation: @Clustered @Stateful public class Universe implements IUniverse { private static Vector<String> messages = new Vector<String>(); ... } jboss-beans.xml configuration: <deployment xmlns="urn:jboss:bean-deployer:2.0"> <!-- This bean is an example of a clustered singleton --> <bean name="Universe" class="Universe"> </bean> <bean name="UniverseController" class="org.jboss.ha.singleton.HASingletonController"> <property name="HAPartition"><inject bean="HAPartition"/></property> <property name="target"><inject bean="Universe"/></property> <property name="targetStartMethod">startSingleton</property> <property name="targetStopMethod">stopSingleton</property> </bean> </deployment> The main problem for this implementation is that, after the master node (the one that contains the state of the singleton EJB) shuts down gracefuly, the Singleton's state is lost and reset to default. Please note that everything was constructed following the JBoss 5 Clustering documents, as no JBoss 6 documents were found on this subject. Any information on how to solve this problem or where to find JBoss 6 documention on clustering is appreciated.

  Read the article

• Combining JSON Arrays

  - by George

  I have 3 json arrays, each with information listed in the same format: Array: ID: NAME: DATA: ID: NAME: DATA: etc... My goal is to combine all 3 arrays into one array, and sort and display by NAME by passing the 3 arrays into a function. The function I've tried is: JSCRIPT Call: // to save time I'm just passing the name of the array, I've tried passing // the full array name as json[0]['DATA'][array_1][0]['NAME'] as well. combineNames(['array_1','array_2']); FUNCTION: function combineNames(names) { var allNames = [] for (i=0;i<names.length;i++) { for (j=0;j<json[0]['DATA'][names[i]].length;j++) { allNames.push(json[0]['DATA'][names[i]][j]['NAME']); } } return allNames.sort(); } The above gives me the error that NAME is null or undefined. I've also tried using the array.concat function which works when I hard code it: var names = []; var allNames = []; var names = names.concat(json[0]['DATA']['array_1'],json[0]['DATA']['array_2']); for (i=0;i<names.length;i++) { allNames.push(names[i]['NAME']); } return allNames.sort(); But I can't figure out how to pass in the arrays into the function (and if possible I would like to just pass in the array name part instead of the whole json[0]['DATA']['array_name'] like I was trying to do in the first function...

  Read the article

• OnConnect event not firing when using TClientSocket inside a TThread on non-blocking mode

  - by mathematician1975

  I am trying to make use of Borlands TClientSocket component in non-blocking mode inside a multithreaded C++ Windows application. I am creating multiple threads (classes derived from TThread), each of which creates its own TClientSocket object. I then assign member functions of the thread class to act as event handlers for the OnConnect, OnDisconnect and OnSocketError events of the socket. The problem I am having here is that whenever I call the TClientSocket::Open() function from within the TThread::Execute() function, the OnConnect event never fires. However, When I call the Open() function from the VCL thread prior to the TThread::Execute() function getting called, all of the events fire and I can use the thread-socket combination as I would like. Now I have not read anything in documentation that says that TClientSocket should not be used in non-blocking mode when used inside a thread, but it appears to me that there is perhaps something wrong conceptually in the way I am trying to use this class. Borland documentation is quite poor on the subject and these components have now been deprecated so reliable information is hard to come by. Despite being deprecated I have to use them as there is no alternative in the Builder 6 package I have. Can anyone please advise me if there is a right/wrong way to use TThread and a non-blocking TClientSocket in combination. I have never had problems using it as part of the VCL thread and never had problems using TServerSocket before and I really cannot understand why some events are not firing.

  Read the article

• How to organize and manage multiple database credentials in application?

  - by Polaris878

  Okay, so I'm designing a stand-alone web service (using RestLET as my framework). My application is divided in to 3 layers: Data Layer (just above the database, provides APIs for connecting to/querying database, and a database object) Object layer (responsible for serialization from the data layer... provides objects which the client layer can use without worrying about database) Client layer (This layer is the RestLET web service... basically just creates objects from the object layer and fulfills webservice request) Now, for each object I create in the object layer, I want to use different credentials (so I can sandbox each object...). The object layer should not know the exact credentials (IE the login/pw/DB URL etc). What would be the best way to manage this? I'm thinking that I should have a super class Database object in my data layer... and each subclass will contain the required log-in information... this way my object layer can just go Database db = new SubDatabase(); and then continue using that database. On the client level, they would just be able to go ItemCollection items = new ItemCollection(); and have no idea/control over the database that gets connected. I'm asking this because I am trying to make my platform extensible, so that others can easily create services off of my platform. If anyone has any experience with these architectural problems or how to manage this sort of thing I'd appreciate any insight or advice... Feel free to ask questions if this is confusing. Thanks! My platform is Java, the REST framework I'm using is RestLET, my database is MySQL.

  Read the article

• Programatically rebuild .exd-files when loading VBA

  - by aspartame

  Hi, After updating Microsoft Office 2007 to Office 2010 some custom VBA scripts embedded in our software failed to compile with the following error message: Object library invalid or contains references to object definitions that could not be found. As far as I know, this error is a result of a security update from Microsoft (Microsoft Security Advisory 960715). When adding ActiveX-controls to VBA scripts, information about the controls are stored in cache files on the local hard drive (.exd-files). The security update modified some of these controls, but the .exd-files were not automatically updated. When the VBA scripts try to load the old versions of the controls stored in the cached files, the error occurs. These cache-files must be removed from the hard drive in order for the controls to load successfully (which will create new, updated .exd-files automatically). What I would like to do is to programatically (using Visual C++) remove the outdated .exd-files when our software loads. When opening a VBA project using CApcProject::ApcProject.Open I set the following flag:axProjectThrowAwayCompiledState. TestHR(ApcProject.Open(pHost, (MSAPC::AxProjectFlag) (MSAPC::axProjectNormal | MSAPC::axProjectThrowAwayCompiledState))); According to the documentation, this flag should cause the VBA project to be recompiled and the temporary files to be deleted and rebuilt. I've also tried to update the checksum of the host application type library which should have the same effect. However none of these fixes seem to do the job and I'm running out of ideas. Help is very much appreciated!

  Read the article

• MySQL Ratings From Two Tables

  - by DirtyBirdNJ

  I am using MySQL and PHP to build a data layer for a flash game. Retrieving lists of levels is pretty easy, but I've hit a roadblock in trying to fetch the level's average rating along with it's pointer information. Here is an example data set: levels Table: level_id | level_name 1 | Some Level 2 | Second Level 3 | Third Level ratings Table: rating_id | level_id | rating_value 1 | 1 | 3 2 | 1 | 4 3 | 1 | 1 4 | 2 | 3 5 | 2 | 4 6 | 2 | 1 7 | 3 | 3 8 | 3 | 4 9 | 3 | 1 I know this requires a join, but I cannot figure out how to get the average rating value based on the level_id when I request a list of levels. This is what I'm trying to do: SELECT levels.level_id, AVG(ratings.level_rating WHERE levels.level_id = ratings.level_id) FROM levels I know my SQL is flawed there, but I can't figure out how to get this concept across. The only thing I can get to work is returning a single average from the entire ratings table, which is not very useful. Ideal Output from the above conceptually valid but syntactically awry query would be: level_id | level_rating 1| 3.34 2| 1.00 3| 4.54 My main issue is I can't figure out how to use the level_id of each response row before the query has been returned. It's like I want to use a placeholder... or an alias... I really don't know and it's very frustrating. The solution I have in place now is an EPIC band-aid and will only cause me problems long term... please help!

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Class design when working with dataset

  - by MC

  If you have to retrieve data from a database and bring this dataset to the client, and then allow the user to manipulate the data in various ways before updating the database again, what is a good class design for this if the data tables will not have a 1:1 relationship with the class objects? Here are some I came up with: Just manipulate the DataSet itself on the client and then send it back to the database as is. This will work though obviously the code will be very dirty and not well-structured. Same as #1, but wrap the dataset code around classes. What I mean is that you may have a class that takes a dataset or a datatable in its constructor, and then provides public methods and properties to simplify the code. Inside these methods and properties it will be reading or manipulating the dataset. To update the database afterwards will be easy because you already have the updated dataset. Get rid of the dataset entirely on the client, convert to objects, then convert back to a dataset when needing to update the database. Is there any good resources where I can find information on this?

  Read the article

• Access modifiers - Property on business objects - getting and setting

  - by Mike

  Hi, I am using LINQ to SQL for the DataAccess layer. I have similar business objects to what is in the data access layer. I have got the dataprovider getting the message #23. On instantiation of the message, in the message constructor, it gets the MessageType and makes a new instance of MessageType class and fills in the MessageType information from the database. Therefore; I want this to get the Name of the MessageType of the Message. user.Messages[23].MessageType.Name I also want an administrator to set the MessageType user.Messages[23].MessageType = MessageTypes.LoadType(3); but I don't want the user to publicly set the MessageType.Name. But when I make a new MessageType instance, the access modifier for the Name property is public because I want to set that from an external class (my data access layer). I could change this to property to internal, so that my class can access it like a public variable, and not allow my other application access to modify it. This still doesn't feel right as it seems like a public property. Are public access modifiers in this situation bad? Any tips or suggestions would be appreciated. Thanks.

  Read the article

• Help me with the simplest program for "Trusted" application

  - by idazuwaika

  Hi, I hope anyone from the large community here can help me write the simplest "Trusted" program that I can expand from. I'm using Ubuntu Linux 9.04, with TPM emulator 0.60 from Mario Strasser (http://tpm-emulator.berlios.de/). I have installed the emulator and Trousers, and can successfully run programs from tpm-tools after running tpmd and tcsd daemons. I hope to start developing my application, but I have problems compiling the code below. #include <trousers/tss.h> #include <trousers/trousers.h> #include <stdio.h> TSS_HCONTEXT hContext; int main() { Tspi_Context_Create(&hContext); Tspi_Context_Close(hContext); return 0; } After trying to compile with g++ tpm.cpp -o tpmexe I receive errors undefined reference to 'Tspi_Context_Create' undefined reference to 'Tspi_Context_Close' What do I have to #include to successfully compile this? Is there anything that I miss? I'm familiar with C, but not exactly so with Linux/Unix programming environment. ps: I am a part time student in Master in Information Security programme. My involvement with programming has been largely for academic purposes.

  Read the article

• JDBC transaction dead-lock solution required?

  - by user49767

  It's a scenario described my friend and challenged to find solution. He is using Oracle database and JDBC connection with read committed as transaction isolation level. In one of the transaction, he updates a record and executes selects statement and commits the transaction. when everything happening within single thread, things are fine. But when multiple requests are handled, dead-lock happens. Thread-A updates a record. Thread B updates another record. Thread-A issues select statement and waits for Thread-B's transaction to complete the commit operation. Thread-B issues select statement and waits for Thread-A's transaction to complete the commit operation. Now above causes dead-lock. Since they use command pattern, the base framework allows to issue commit only once (at the end of all the db operation), so they are unable to issue commit immediately after select statement. My argument was Thread-A supposed to select all the records which are committed and hence should not be issue. But he said that Thread-A will surely wait till Thread-B commits the record. is that true? What are all the ways, to avoid the above issue? is it possible to change isolation-level? (without changing underlying java framework) Little information about base framework, it is something similar to Struts action, their each and every request handled by one action, transaction begins before execution and commits after execution.

  Read the article

• javascript: waiting for an iframe page to load before writing to it (but not from the page that's tr

  - by Bill Dawes

  Apologies if this has been answered elsewhere, but I haven't been able to find it referenced. (Probably because nobody else would want to do such a daft thing, I admit). So, I have a page with three iframes in it. An event on one triggers a javascript function which loads new pages into the other two iframes; ['topright'] and ['bottomright']. However, javascript in the page that is being loaded into iframe 'topright' then needs to send information to elements in the 'bottomright' iframe. window.frames['bottomright'].document.subform.ID_client = client; etc But this will only work if the page has fully loaded into the bottomright frame. So what would be the most efficient way for that code in the 'topright' iframe to check and ensure that that form element in the bottomright frame is actually available to write to, before it does write to it? Bearing in mind that the page load has NOT been triggered from the topright frame, so I can't simply use an onLoad function. (I know this probably sounds like a hideously tortuous route for getting data from one page to another, but that's another story. The client is always right, etc...:-))

  Read the article

• Exposing a service to external systems - How should I design the contract?

  - by Larsi

  Hi! I know this question is been asked before here but still I'm not sure what to select. My service will be called from many 3 party system in the enterprise. I'm almost sure the information the service will collect (MyBigClassWithAllInfo) will change during the products lifetime. Is it still a good idea to expose objects? This is basically what my two alternatives: [ServiceContract] public interface ICollectStuffService { [OperationContract] SetDataResponseMsg SetData(SetDataRequestMsg dataRequestMsg); } // Alternative 1: Put all data inside a xml file [DataContract] public class SetDataRequestMsg { [DataMember] public string Body { get; set; } [DataMember] public string OtherPropertiesThatMightBeHandy { get; set; } // ?? } // Alternative 2: Expose the objects [DataContract] public class SetDataRequestMsg { [DataMember] public Header Header { get; set; } [DataMember] public MyBigClassWithAllInfo ExposedObject { get; set; } } public class SetDataResponseMsg { [DataMember] public ServiceError Error { get; set; } } The xml file would look like this: <?xml version="1.0" encoding="utf-8"?> <Message>   <Header>     <InfoAboutTheSender>...</InfoAboutTheSender>   </Header>   <StuffToCollectWithAllTheInfo>   <stuff1>...</stuff1> </StuffToCollectWithAllTheInfo> </Message> Any thought on how this service should be implemented? Thanks Larsi

  Read the article

• Low Level Console Input

  - by Soulseekah

  I'm trying to send commands to to the input of a cmd.exe application using the low level read/write console functions. I have no trouble reading the text (scraping) using the ReadConsole...() and WriteConsole() functions after having attached to the process console, but I've not figured out how to write for example "dir" and have the console interpret it as a sent command. Here's a bit of my code: CreateProcess(NULL, "cmd.exe", NULL, NULL, FALSE, CREATE_NEW_CONSOLE, NULL, NULL, &si, &pi); AttachConsole(pi.dwProcessId); strcpy(buffer, "dir"); WriteConsole(GetStdHandle(STD_INPUT_HANDLE), buffer, strlen(buffer), &charRead, NULL); STARTUPINFO attributes of the process are all set to zero, except, of course, the .cb attribute. Nothing changes on the screen, however I'm getting an Error 6: Invalid Handle returned from WriteConsole to STD_INPUT_HANDLE. If I write to (STD_OUTPUT_HANDLE) I do get my dir written on the screen, but nothing of course happens. I'm guessing SetConsoleMode() might be of help, but I've tried many mode combinations, nothing helped. I've also created a quick console application that waits for input (scanf()) and echoes back whatever goes in, didn't work. I've also tried typing into the scanf() promp and then peek into the input buffer using PeekConsoleInput(), returns 0, but the INPUT_RECORD array is empty. I'm aware that there is another way around this using WriteConsoleInput() to directly inject INPUT_RECORD structured events into the console, but this would be way too long, I'll have to send each keypress into it. I hope the question is clear. Please let me know if you need any further information. Thanks for your help.

  Read the article

• How to get encoding from MAPI message with PR_BODY_A tag (windows mobile)?

  - by SadSido

  Hi, everyone! I am developing a program, that handles incoming e-mail and sms through windows-mobile MAPI. The code basically looks like that: ulBodyProp = PR_BODY_A; hr = piMessage->OpenProperty(ulBodyProp, NULL, STGM_READ, 0, (LPUNKNOWN*)&piStream); if (hr == S_OK) { // ... get body size in bytes ... STATSTG statstg; piStream->Stat(&statstg, 0); ULONG cbBody = statstg.cbSize.LowPart; // ... allocate memory for the buffer ... BYTE* pszBodyInBytes = NULL; boost::scoped_array<BYTE> szBodyInBytesPtr(pszBodyInBytes = new BYTE[cbBody+2]); // ... read body into the pszBodyInBytes ... } That works and I have a message body. The problem is that this body is multibyte encoded and I need to return a Unicode string. I guess, I have to use ::MultiByteToWideChar() function, but how can I guess, what codepage should I apply? Using CP_UTF8 is naive, because it can simply be not in UTF8. Using CP_ACP works, well, sometimes, but sometimes does not. So, my question is: how can I retrieve the information about message codepage. Does MAPI provide any functions for it? Or is there a way to decode multibyte string, other than MultiByteToWideChar()? Thanks!

  Read the article

• How can I reorder an mbox file chronologically?

  - by Joshxtothe4

  Hello, I have a single spool mbox file that was created with evolution, containing a selection of emails that I wish to print. My problem is that the emails are not placed into the mbox file chronologically. I would like to know the best way to place order the files from first to last using bash, perl or python. I would like to oder by received for files addressed to me, and sent for files sent by me. Would it perhaps be easier to use maildir files or such? The emails currently exist in the format: From [email protected] Fri Aug 12 09:34:09 2005 Message-ID: <[email protected]> Date: Fri, 12 Aug 2005 09:34:09 +0900 From: me <[email protected]> User-Agent: Mozilla Thunderbird 1.0.6 (Windows/20050716) X-Accept-Language: en-us, en MIME-Version: 1.0 To: someone <[email protected]> Subject: Re: (no subject) References: <[email protected]> In-Reply-To: <[email protected]> Content-Type: text/plain; charset=ISO-8859-1; format=flowed Content-Transfer-Encoding: 8bit Status: RO X-Status: X-Keywords: X-UID: 371 X-Evolution-Source: imap://[email protected]/ X-Evolution: 00000002-0010 Hey the actual content of the email someone wrote: > lines of quotedtext I am wondering if there is a way to use this information to easily reorganize the file, perhaps with perl or such.

  Read the article

• object / class methods serialized as well?

  - by Mat90

  I know that data members are saved to disk but I was wondering whether object's/class' methods are saved in binary format as well? Because I found some contradictionary info, for example: Ivor Horton: "Class objects contain function members as well as data members, and all the members, both data and functions, have access specifiers; therefore, to record objects in an external file, the information written to the file must contain complete specifications of all the class structures involved." and: Are methods also serialized along with the data members in .NET? Thus: are method's assembly instructions (opcodes and operands) stored to disk as well? Just like a precompiled LIB or DLL? During the DOS ages I used assembly so now and then. As far as I remember from Delphi and the following site (answer by dan04): Are methods also serialized along with the data members in .NET? sizeof(<OBJECT or CLASS>) will give the size of all data members together (no methods/procedures). Also a nice C example is given there with data and members declared in one class/struct but at runtime these methods are separate procedures acting on a struct of data. However, I think that later class/object implementations like Pascal's VMT may be different in memory.

  Read the article

• To what extent should code try to explain fatal exceptions?

  - by Andrzej Doyle

  I suspect that all non-trivial software is likely to experience situations where it hits an external problem it cannot work around and thus needs to fail. This might be due to bad configuration, an external server being down, disk full, etc. In these situations, especially if the software is running in non-interactive mode, I expect that all one can really do is log an error and wait for the admin to read the logs and fix the problem. If someone happens to interact with the software in the meantime, e.g. a request comes in to a server that failed to initialize properly, then perhaps an appropriate hint can be given to check the logs and maybe even the error can be echoed (depending on whether you can tell if they're a technical guy as opposed to a business user). For the moment though let's not think too hard about this part. My question is, to what extent should the software be responsible for trying to explain the meaning of the fatal error? In general, how much competence/knowledge are you allowed to presume on administrators of the software, and how much should you include troubleshooting information and potential resolution steps when logging fatal errors? Of course if there's something that's unique to the runtime context this should definitely be logged; but lets assume your software needs to talk to Active Directory via LDAP and gets back an error "[LDAP: error code 49 - 80090308: LdapErr: DSID-0C090334, comment: AcceptSecurityContext error, data 525, vece]". Is it reasonable to assume that the maintainers will be able to Google the error code and work out what it means, or should the software try to parse the error code and log that this is caused by an incorrect user DN in the LDAP config? I don't know if there is a definitive best-practices answer for this, so I'm keen to hear a variety of views.

  Read the article

• Creating a complex tree model in Qt

  - by Zeke

  I'm writing an IRC Client (yes another one). Long story short. I'm writing a Server dialogue that keeps a list of this: Identity Networks Channels Addresses I have 3 different list views that will be for the Networks, Channels and Addresses. When the user changes the Identity (combo box). The network listview will lookup all the networks for that specific Identity. After it loads up the Networks it will automatically select the first network and then load all the channels and addresses for that specific network. The problem is I want to have 3 views for 1 model, to minimise all the memory and the loading of data. So that it makes it much easier to manage and not do a bunch of work. If you'd look at QColumnView it's the same exact thing. But I don't need it to be on one exact page since the views are on entirely different tabs to make it easier to go through the Server dialogue. I'm wondering what will be the best way to go about handling this complexity. The information is stored in a SQLite database. I already have the classes written to extract and store it. Just the modelling is the painful part of this solution.

  Read the article

• MySQL managing catalogue views

  - by Mark Lawrence

  A friend of mine has a catalogue that currently holds about 500 rows or 500 items. We are looking at ways that we can provide reports on the catalogue inclduing the number of times an item was viewed, and dates for when its viewed. His site is averaging around 25,000 page impressions per month and if we assumed for a minute that half of these were catalogue items then we'd assume roughly 12,000 catalogue items viewed each month. My question is the best way to manage item views in the database. First option is to insert the catalogue ID into a table and then increment the number of times its viewed. The advantage of this is its compact nature. There will only ever be as many rows in the table as there are catalogue items. `catalogue_id`, `views` The disadvantage is that no date information is being held, short of maintaining the last time an item was viewed. The second option is to insert a new row each time an item is viewed. `catalogue_id`, `timestamp` If we continue with the assumed figure of 12,000 item views that means adding 12,000 rows to the table each month, or 144,000 rows each year. The advantage of this is we know the number of times the item is viewed, and also the dates for when its viewed. The disadvantage is the size of the table. Is a table with 144,000 rows becoming too large for MySQL? Interested to hear any thoughts or suggestions on how to achieve this. Thanks.

  Read the article

• making clean page via page.tpl.php

  - by user360051

  I have a Drupal module creating a page via hook_menu(). I am trying to make it so the page has no extraneous html output, only what I want. You can view the page here, http://www.thomashansen.me/chat/thomas. If you look at the source, you can see a strange script tag at the end. My page-chat.tpl.php looks like this, <?php // $Id$ ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="<?php print $language->language ?>" lang="<?php print $language->language ?>" dir="<?php print $language->dir ?>"> <head> </head> <body> <?php print $content; ?> </body> </html> Where is that script tag coming from? and how do I get rid of it? If you need more information just ask.

  Read the article

• Help me choose a web development framework/platform that will make me learn something

  - by Sergio Tapia

  I'm having a bit of an overload of information these past two days. I'm planning to start my own website that will allow local businesses to list their items on sale, and then users can come in and search for "Abercrombie t-shirt" and the stores that sell them will be listed. It's a neat little project I'm really excited for and I'm sure it'll take off, but I'm having problems from the get go. Sure I could use ASP.Net for it, I'm a bit familiar with it and the IDE for ASP.Net pages is bar-none, but I feel this is a great chance for me to learn something new to branch out a bit and not regurgitate .NET like a robot. I've been looking and asking around but it's all just noise and I can't make an educated decision. Can you help me choose a framework/platform that will make me learn something that's a nice thing to know in the job market, but also nice for me to grow as a professional? So far I've looked at: Ruby on Rails Kohana CakePHP CodeIgniter Symfony But they are all very esoteric to me, and I have trouble even finding out which IDE to use to that will let me use auto-complete for the proprietary keywords/methods. Thank you for your time.

  Read the article

< Previous Page | 924 925 926 927 928 929 930 931 932 933 934 935  | Next Page >