Search Results

Search found 10374 results on 415 pages for 'close'.

Page 93/415 | < Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >

  • JQuery Simplemodal and Tabs Help Needed

    - by Dave R
    Hi, I've got an asp.net page containing a Textbox with an Autocomplete extender on it. It's setup so the user can type a short reference code into the textbox and then choose from the list of matching codes returned by the autocomplete. On the "select", I then call the server using JQuery. I'm currently using $.get here.... The callback function from $.get checks for "success" and then displays a simple-modal dialog containing info about the item they've just selected. if (sStatus == "success") { $.modal(sText, { overlayClose: true, appendTo:'form', onShow: function(dialog) { $("#ccTargets_tabContainer").tabs(); }, onClose: function(dialog) { $("#<%=TextBox1.ClientID%>").val(""); $.modal.close(); } }); $.ready(); } One of the bits of info being loaded here is a JQuery TABS setup, so the onShow function of the simplemodal is used to initiate the tabs which are within the simplemodal. Now to the crux of my problem. If I do multiple consecutive "autocompletes" on the same page it all works fine Unless I have selected a different tab on the tabs in the simplemodal ....If I select a different tab, close the simplemodal and then do another autocomplete I get a JQuery error which seems to relate to a selector doing something with the "old" selected tab that was on the "closed" modal. I'm clearly missing some sort of cleardown / initialisation somewhere, but can't find what it is. Help? I've tried "tabs.destroy" before the modal call in the code above and I've tried a $.ready() call as indicated too.... UPDATE: Is it something to do with JQuery Tabs appending my addressbar URL with the selected tab's ID?

    Read the article

  • WCF configuration and ISA Proxies

    - by Morten Louw Nielsen
    Hi, I have a setup with a .NET WCF Service hosted on IIS. The client apps are connecting to the service through a set of ISA proxy's. I don't know how many and don't know about their configuration etc. In the client apps I open a client to the service and make several calls via the same client. It works great in my office, but when I deploy at the customer (using the ISAs), after some calls, the connection breaks. In a successfull case, the client will maximum live a few seconds, but is that too much? I think there might be several proxyes. Maybe it's using load ballancing. pseudo code is something like this: WcfClient myClient = new WcfClient(); foreach (WorkItem Item in WorkItemsStack) myClient.ProcessItem(Item); myClient.Close(); I am thinking whether I have to do something like this foreach (WorkItem Item in WorkItemsStack) { WcfClient myClient = new WcfClient(); myClient.ProcessItem(Item); myClient.Close(); } Any one with experience with this field? Kind Regards, Morten, Denmark

    Read the article

  • Problem with closing excel by c#

    - by phenevo
    Hi, I've got unit test with this code: Excel.Application objExcel = new Excel.Application(); Excel.Workbook objWorkbook = (Excel.Workbook)(objExcel.Workbooks._Open(@"D:\Selenium\wszystkieSeba2.xls", true, false, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value)); Excel.Worksheet ws = (Excel.Worksheet)objWorkbook.Sheets[1]; Excel.Range r = ws.get_Range("A1", "I2575"); DateTime dt = DateTime.Now; Excel.Range cellData = null; Excel.Range cellKwota = null; string cellValueData = null; string cellValueKwota = null; double dataTransakcji = 0; string dzien = null; string miesiac = null; int nrOperacji = 1; int wierszPoczatkowy = 11; int pozostalo = 526; cellData = r.Cells[wierszPoczatkowy, 1] as Excel.Range; cellKwota = r.Cells[wierszPoczatkowy, 6] as Excel.Range; if ((cellData != null) && (cellKwota != null)) { object valData = cellData.Value2; object valKwota = cellKwota.Value2; if ((valData != null) && (valKwota != null)) { cellValueData = valData.ToString(); dataTransakcji = Convert.ToDouble(cellValueData); Console.WriteLine("data transakcji to: " + dataTransakcji); dt = DateTime.FromOADate((double)dataTransakcji); dzien = dt.Day.ToString(); miesiac = dt.Month.ToString(); cellValueKwota = valKwota.ToString(); } } r.Cells[wierszPoczatkowy, 8] = "ok"; objWorkbook.Save(); objWorkbook.Close(true, @"C:\Documents and Settings\Administrator\Pulpit\Selenium\wszystkieSeba2.xls", true); objExcel.Quit(); Why after finish test I'm still having excel in process (it does'nt close) And : is there something I can improve to better perfomance ??

    Read the article

  • Trouble parsing some RSS feeds using Java and Sax

    - by brockoli
    I've written an RSS feed parser in Java (running on Android) and it parses some feeds perfectly, and others not at all. I get the following error when it tries to parse Slashdot (http://rss.slashdot.org/Slashdot/slashdot) org.apache.harmony.xml.ExpatParser$ParseException: At line 1, column 0: unbound prefix If I try to parse Wired (http://feeds.wired.com/wired/index) org.apache.harmony.xml.ExpatParser$ParseException: At line 1, column 0: syntax error If I try to parse AndroidGuys (http://feeds.feedburner.com/androidguyscom) org.apache.harmony.xml.ExpatParser$ParseException: At line 1, column 0: syntax error Here is some code for my parser. public void updateArticles(Context ctx, Feed feed, int numDaysToGet) { try { targetFlag = TARGET_ARTICLES; tweetDB = new TweetMonsterDBAdapter(ctx); tweetDB.open(); currentFeed = feed; TimeZone.setDefault(TimeZone.getTimeZone("UTC")); // or "Etc/GMT-1" Date currentDate = new Date(); long dateInMillis = currentDate.getTime(); oldestDate.setTime(dateInMillis-(dayInMillis*numDaysToGet)); SAXParserFactory spf = SAXParserFactory.newInstance(); SAXParser sp = spf.newSAXParser(); XMLReader xr = sp.getXMLReader(); xr.setContentHandler(this); xr.parse(new InputSource(currentFeed.url.openStream())); } catch (IOException e) { Log.e("TweetMonster", e.toString()); } catch (SAXException e) { tweetDB.close(); Log.e("TweetMonster", e.toString()); } catch (ParserConfigurationException e) { Log.e("TweetMonster", e.toString()); } tweetDB.close(); } It doesn't even get into my startElement method.

    Read the article

  • php: fopen() of an URL breaks for domain names, not for numerical addresses

    - by b0fh
    After hours of trying to debug a third-party application having trouble with fopen(), i finally discovered that php -r 'echo(file_get_contents("http://www.google.com/robots.txt"));' fails, but php -r 'echo(file_get_contents("http://173.194.32.81/robots.txt"));' Succeeds. Note that as the webserver user, I can ping www.google.com and it resolves just fine. I straced both executions of PHP, and they diverge like this: For the numerical v4 URL: socket(PF_INET, SOCK_STREAM, IPPROTO_IP) = 3 fcntl(3, F_GETFL) = 0x2 (flags O_RDWR) fcntl(3, F_SETFL, O_RDWR|O_NONBLOCK) = 0 connect(3, {sa_family=AF_INET, sin_port=htons(80), sin_addr=inet_addr("173.194 poll([{fd=3, events=POLLOUT}], 1, 0) = 0 (Timeout) ...[bunch of poll/select/recvfrom]... close(3) = 0 For the domain name: socket(PF_INET6, SOCK_DGRAM, IPPROTO_IP) = 3 close(3) = 0 PHP didn't even try to do anything with that socket, it seems. Or even resolve the domain, for that matter. WTF ? Recompiling PHP with or without ipv6 support did not seem to matter. Disabling ipv6 on this system is not desirable. Gentoo Linux, PHP 5.3.14, currently giving a try to PHP 5.4 and see if it helps. Anyone has an idea ? EDIT: php -r 'echo gethostbyname("www.google.com");' Works and yield an ipv4, while php -r 'echo(file_get_contents("http://[2a00:1450:4007:803::1011]/"));' Seems to return a blank result. EDIT 2: I didn't even notice the first time, that the v6 socket opened when the name is used is a SOCK_DGRAM.

    Read the article

  • Python - Code snippet not working on Python 2.5.6, using IDLE

    - by Francisco P.
    Hello, everyone I am using a piece of self-modifying code for a college project. Here it is: import datetime import inspect import re import sys def main(): # print the time it is last run lastrun = 'Mon Jun 8 16:31:27 2009' print "This program was last run at ", print lastrun # read in the source code of itself srcfile = inspect.getsourcefile(sys.modules[__name__]) f = open(srcfile, 'r') src = f.read() f.close() # modify the embedded timestamp timestamp = datetime.datetime.ctime(datetime.datetime.now()) match = re.search("lastrun = '(.*)'", src) if match: src = src[:match.start(1)] + timestamp + src[match.end(1):] # write the source code back f = open(srcfile, 'w') f.write(src) f.close() if __name__=='__main__': main() Unfortunately, it doesn't work. Error returned: # This is the script's output This program is last run at Mon Jun 8 16:31:27 2009 # This is the error message Traceback (most recent call last): File "C:\Users\Rui Gomes\Desktop\teste.py", line 30, in <module> main() File "C:\Users\Rui Gomes\Desktop\teste.py", line 13, in main srcfile = inspect.getsourcefile(sys.modules[__name__]) File "C:\Python31\lib\inspect.py", line 439, in getsourcefile filename = getfile(object) File "C:\Python31\lib\inspect.py", line 401, in getfile raise TypeError('{!r} is a built-in module'.format(object)) TypeError: <module '__main__' (built-in)> is a built-in module I'd be thankful for any solutions.

    Read the article

  • Forking with Pipes

    - by Luke
    Hello I have tried to do fork() and piping in main and it works perfectly fine but when I try to implement it in a function for some reason I don't get any output, this is my code: void cmd(int **pipefd,int count,int type, int last); int main(int argc, char *argv[]) { int pipefd[3][2]; int i, total_cmds = 3,count = 0; int in = 1; for(i = 0; i < total_cmds;i++){ pipe(pipefd[count++]); cmd(pipefd,count,i,0); } /*Last Command*/ cmd(pipefd,count,i,1); exit(EXIT_SUCCESS); } void cmd(int **pipefd,int count,int type, int last){ int child_pid,i,i2; if ((child_pid = fork()) == 0) { if(count == 1){ dup2(pipefd[count-1][1],1); /*first command*/ } else if(last!=0){ dup2(pipefd[count - 2][0],0); /*middle commands*/ dup2(pipefd[count - 1][1],1); } else if(last == 1){ dup2(pipefd[count - 1][0],0); /*last command*/ } for(i = 0; i < count;i++){/*close pipes*/ for(i2 = 0; i2 < 2;i2++){ close(pipefd[i][i2]); }} if(type == 0){ execlp("ls","ls","-al",NULL); } else if(type == 1){ execlp("grep","grep",".bak",NULL); } else if(type==2){ execl("/usr/bin/wc","wc",NULL); } else if(type ==3){ execl("/usr/bin/wc","wc","-l",NULL); } perror("exec"); exit(EXIT_FAILURE); } else if (child_pid < 0) { perror("fork"); exit(EXIT_FAILURE); } } I checked the file descriptors and it is opening the right ones, not sure what the problem could be..

    Read the article

  • Problems with QDialog in Qt

    - by Martin
    I'm using Qt for Symbian. I have some problems with a QDialog that I open from a QMenu. The QDialog shows up fine and in the QDialog I have a QDialogButtonBox with a button to Close the QDialog. BUT if I close the QDialog and then open it from the QMenu again, it will show up but the button from the QDialogButtonBox will not show up. Instead the buttons from the QMainWindow will show but they are grayed out. How can I get the QDialog buttons to show every time? Maybe I have some problems with setting focus on the QDialog? I really can't see what I'm doing wrong here. It's not much code that I use, you can try it yourself. This is my code: In QMainWindow I use the following to create the menu: QAction *menuButton = new QAction("Menu", this); menuButton->setSoftKeyRole(QAction::PositiveSoftKey); QMenu *menu = new QMenu(this); menuButton->setMenu(menu); QAction *popup = new QAction("Show popup",this); connect(popup, SIGNAL(triggered()), this, SLOT(showPopup())); menu->addAction(popup); addAction(menuButton); This shows the QDialog: void MyMainWindow::showPopup(){ TestDialog *test = new TestDialog(this); test->setAttribute(Qt::WA_DeleteOnClose); test->show(); } This is the TestDialog: TestDialog::TestDialog(QWidget *parent) : QDialog(parent) { ui.setupUi(this); QDesktopWidget* desktopWidget = QApplication::desktop(); QRect rect = desktopWidget->availableGeometry(); this->setFixedWidth(rect.width()); }

    Read the article

  • How can I improve my real-time behavior in multi-threaded app using pthreads and condition variables

    - by WilliamKF
    I have a multi-threaded application that is using pthreads. I have a mutex() lock and condition variables(). There are two threads, one thread is producing data for the second thread, a worker, which is trying to process the produced data in a real time fashion such that one chuck is processed as close to the elapsing of a fixed time period as possible. This works pretty well, however, occasionally when the producer thread releases the condition upon which the worker is waiting, a delay of up to almost a whole second is seen before the worker thread gets control and executes again. I know this because right before the producer releases the condition upon which the worker is waiting, it does a chuck of processing for the worker if it is time to process another chuck, then immediately upon receiving the condition in the worker thread, it also does a chuck of processing if it is time to process another chuck. In this later case, I am seeing that I am late processing the chuck many times. I'd like to eliminate this lost efficiency and do what I can to keep the chucks ticking away as close to possible to the desired frequency. Is there anything I can do to reduce the delay between the release condition from the producer and the detection that that condition is released such that the worker resumes processing? For example, would it help for the producer to call something to force itself to be context switched out? Bottom line is the worker has to wait each time it asks the producer to create work for itself so that the producer can muck with the worker's data structures before telling the worker it is ready to run in parallel again. This period of exclusive access by the producer is meant to be short, but during this period, I am also checking for real-time work to be done by the producer on behalf of the worker while the producer has exclusive access. Somehow my hand off back to running in parallel again results in significant delay occasionally that I would like to avoid. Please suggest how this might be best accomplished.

    Read the article

  • Coherent access to mainframe files from Win32 application and IBM RDZ/Eclipse?

    - by Ira Baxter
    I have a suite of tools for processing IBM COBOL source code; these tools are built as Win32 applications and talk to Windows (including network) files using traditional Windows file system calls (open, close, read, write) and work just fine, thank you. I'd like to integrate these with Eclipse; we understand how to get Eclipse to do UI for us we think. The problem is that Eclipse/RDZ users access mainframe files through some IBM magic. In How does RDZ access mainframe files I tried to understand how Eclipse accessed files on a mainframe. Apparantly Eclipse/RDZ has a secret filesystem access backdoor not available to normal mortals. At issue is how our tools, reading some Windows-accessible file (local disk file, NFS to mainframe, ...) can associate such files with the files that Eclipse can access or is using? Ideally we'd like UI-integrated versions of our tools take an Eclipse file-name string for a mainframe file, pass it to our Windows application to process, have the Windows application open/read/process the file, and return results associated with that file to the Eclipse UI. Is there a canonical file name path that would be used with mainframe NFS that would be equivalent to the name or access object the Eclipse RDZ used to access the same file? Are all operations doable internally by Eclipse, doable by the mainframe NFS [for instance, can NFS read/update an element in a partitioned data set? Can Eclipse RDZ? Does it matter?] Is the mainframe file access available to custom Java code running under Eclipse RDZ (e.g., equivalents of open/close/read/write based on filename/path/something?) If so, can somebody steer me towards documentation describing the access methods? Anybody else already solve this problem or have a good suggestion?

    Read the article

  • javascript addEventListener onStateChange not working in IE

    - by user347456
    Hi, I have two colorbox popup boxes which show a youtube video in each. When they're finished playing, I'm trying to have them automatically close the colorbox window. This code below works perfect in firefox, but in IE I can't get addEventListener to work. I've tried attachEvent with no success. Can anybody offer any suggestions as to how to solve this? It seems simple but I'm exhausted trying to find a solution. By the way, this is my first time as stackoverflow and it's very impressive. var params = { allowScriptAccess: "always" }; var atts = { id: "ytplayer1" }; swfobject.embedSWF("http://www.youtube.com/v/VIDEO1&rel=0&hl=en_US&fs=0&autoplay=1&enablejsapi=1&playerapiid=ytvideo1", "popupVideoContainer1", "640", "385", "8", null, null, params, atts); var params2 = { allowScriptAccess: "always" }; var atts2 = { id: "ytplayer2" }; swfobject.embedSWF("http://www.youtube.com/v/VIDEO2&rel=0&hl=en_US&fs=0&autoplay=1&enablejsapi=1&playerapiid=ytvideo2", "popupVideoContainer2", "640", "385", "8", null, null, params2, atts2); function onYouTubePlayerReady(playerId) { if(playerId == 'ytvideo1'){ var ytplayer = document.getElementById('ytplayer1'); ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); } else if(playerId == 'ytvideo2'){ var ytplayer = document.getElementById("ytplayer2"); //ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); if (ytplayer.addEventListener) { ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); } else if (ytplayer.attachEvent) { ytplayer.attachEvent("onStateChange", onytplayerStateChange); } } } function onytplayerStateChange(newState) { if(newState == 0){ $.fn.colorbox.close(); } }

    Read the article

  • Call Multiple Stored Procedures with the Zend Framework

    - by Brian Fisher
    I'm using Zend Framework 1.7.2, MySQL and the MySQLi PDO adapter. I would like to call multiple stored procedures during a given action. I've found that on Windows there is a problem calling multiple stored procedures. If you try it you get the following error message: SQLSTATE[HY000]: General error: 2014 Cannot execute queries while other unbuffered queries are active. Consider using PDOStatement::fetchAll(). Alternatively, if your code is only ever going to run against mysql, you may enable query buffering by setting the PDO::MYSQL_ATTR_USE_BUFFERED_QUERY attribute. I found that to work around this issue I could just close the connection to the database after each call to a stored procedure: if (strtoupper(substr(PHP_OS, 0, 3)) === 'WIN') { //If on windows close the connection $db->closeConnection(); } This has worked well for me, however, now I want to call multiple stored procedures wrapped in a transaction. Of course, closing the connection isn't an option in this situation, since it causes a rollback of the open transaction. Any ideas, how to fix this problem and/or work around the issue. More info about the work around Bug report about the problem

    Read the article

  • GZIP Java vs .NET

    - by Jim Jones
    Using the following Java code to compress/decompress bytes[] to/from GZIP. First text bytes to gzip bytes: public static byte[] fromByteToGByte(byte[] bytes) { ByteArrayOutputStream baos = null; try { ByteArrayInputStream bais = new ByteArrayInputStream(bytes); baos = new ByteArrayOutputStream(); GZIPOutputStream gzos = new GZIPOutputStream(baos); byte[] buffer = new byte[1024]; int len; while((len = bais.read(buffer)) >= 0) { gzos.write(buffer, 0, len); } gzos.close(); baos.close(); } catch (IOException e) { e.printStackTrace(); } return(baos.toByteArray()); } Then the method that goes the other way compressed bytes to uncompressed bytes: public static byte[] fromGByteToByte(byte[] gbytes) { ByteArrayOutputStream baos = null; ByteArrayInputStream bais = new ByteArrayInputStream(gbytes); try { baos = new ByteArrayOutputStream(); GZIPInputStream gzis = new GZIPInputStream(bais); byte[] bytes = new byte[1024]; int len; while((len = gzis.read(bytes)) > 0) { baos.write(bytes, 0, len); } } catch (IOException e) { e.printStackTrace(); } return(baos.toByteArray()); } Think there is any effect since I'm not writing out to a gzip file? Also I noticed that in the standard C# function that BitConverter reads the first four bytes and then the MemoryStream Write function is called with a start point of 4 and a length of input buffer length - 4. So is that effect the validity of the header? Jim

    Read the article

  • How does Subsonic handle connections?

    - by Quintin Par
    In Nhibernate you start a session by creating it during a BeginRequest and close at EndRequest public class Global: System.Web.HttpApplication { public static ISessionFactory SessionFactory = CreateSessionFactory(); protected static ISessionFactory CreateSessionFactory() { return new Configuration() .Configure(Path.Combine(AppDomain.CurrentDomain.BaseDirectory, "hibernate.cfg.xml")) .BuildSessionFactory(); } public static ISession CurrentSession { get{ return (ISession)HttpContext.Current.Items["current.session"]; } set { HttpContext.Current.Items["current.session"] = value; } } protected void Global() { BeginRequest += delegate { CurrentSession = SessionFactory.OpenSession(); }; EndRequest += delegate { if(CurrentSession != null) CurrentSession.Dispose(); }; } } What’s the equivalent in Subsonic? The way I understand, Nhibernate will close all the connections at endrequest. Reason: While trouble shooting some legacy code in a Subsonic project I get a lot of MySQL timeouts,suggesting that the code is not closing the connections MySql.Data.MySqlClient.MySqlException: error connecting: Timeout expired. The timeout period elapsed prior to obtaining a connection from the pool. This may have occurred because all pooled connections were in use and max pool size was reached. Generated: Tue, 11 Aug 2009 05:26:05 GMT System.Web.HttpUnhandledException: Exception of type 'System.Web.HttpUnhandledException' was thrown. --- MySql.Data.MySqlClient.MySqlException: error connecting: Timeout expired. The timeout period elapsed prior to obtaining a connection from the pool. This may have occurred because all pooled connections were in use and max pool size was reached. at MySql.Data.MySqlClient.MySqlPool.GetConnection() at MySql.Data.MySqlClient.MySqlConnection.Open() at SubSonic.MySqlDataProvider.CreateConnection(String newConnectionString) at SubSonic.MySqlDataProvider.CreateConnection() at SubSonic.AutomaticConnectionScope..ctor(DataProvider provider) at SubSonic.MySqlDataProvider.GetReader(QueryCommand qry) at SubSonic.DataService.GetReader(QueryCommand cmd) at SubSonic.ReadOnlyRecord`1.LoadByParam(String columnName, Object paramValue) My connection string is as follows <connectionStrings> <add name="xx" connectionString="Data Source=xx.net; Port=3306; Database=db; UID=dbuid; PWD=xx;Pooling=true;Max Pool Size=12;Min Pool Size=2;Connection Lifetime=60" /> </connectionStrings>

    Read the article

  • Java HttpURLConnection bekommt keine cookies

    - by TeNNoX
    ich versuche über eine HttpURLConnection einen Login auf einer Webseite durchzuführen, und davon dann die cookies zu erhalten... Bei meinen Testseiten auf einem eigenen Server geht es problemlos, ich sende "a=3&b=5" und als cookie erhalte ich "8", also die Summe. Wenn ich dies allerdings auf der gewollten Seite anwende, kommt einfach nur die Seite, als ob ich gar nichts per POST gesendet hätte... :( Generelle Verbesserungsvorschläge sind auch erwünscht! :) Mein Code: HttpURLConnection conn = (HttpURLConnection) new URL(url).openConnection(); conn.setDoInput(true); conn.setDoOutput(true); conn.setRequestMethod("POST"); conn.setRequestProperty("useragent", "Mozilla/5.0 (Windows NT 6.1; WOW64; rv:17.0) Gecko/20100101 Firefox/17.0"); conn.setRequestProperty("Connection", "keep-alive"); DataOutputStream out = new DataOutputStream(conn.getOutputStream()); out.writeBytes("USER=tennox&PASS=*****"); out.close(); BufferedReader in = new BufferedReader(new InputStreamReader(conn.getInputStream())); String line; String response = new String(); while ((line = in.readLine()) != null) { response = response + line + "\n"; } in.close(); System.out.println("headers:"); int i = 0; String header; while ((header = conn.getHeaderField(i)) != null) { String key = conn.getHeaderFieldKey(i); System.out.println(((key == null) ? "" : key + ": ") + header); i++; } String cookies = conn.getHeaderField("Set-Cookie"); System.out.println("\nCookies: \"" + cookies + "\"");

    Read the article

  • record output sound in python

    - by aaronstacy
    i want to programatically record sound coming out of my laptop in python. i found PyAudio and came up with the following program that accomplishes the task: import pyaudio, wave, sys chunk = 1024 FORMAT = pyaudio.paInt16 CHANNELS = 1 RATE = 44100 RECORD_SECONDS = 5 WAVE_OUTPUT_FILENAME = sys.argv[1] p = pyaudio.PyAudio() channel_map = (0, 1) stream_info = pyaudio.PaMacCoreStreamInfo( flags = pyaudio.PaMacCoreStreamInfo.paMacCorePlayNice, channel_map = channel_map) stream = p.open(format = FORMAT, rate = RATE, input = True, input_host_api_specific_stream_info = stream_info, channels = CHANNELS) all = [] for i in range(0, RATE / chunk * RECORD_SECONDS): data = stream.read(chunk) all.append(data) stream.close() p.terminate() data = ''.join(all) wf = wave.open(WAVE_OUTPUT_FILENAME, 'wb') wf.setnchannels(CHANNELS) wf.setsampwidth(p.get_sample_size(FORMAT)) wf.setframerate(RATE) wf.writeframes(data) wf.close() the problem is i have to connect the headphone jack to the microphone jack. i tried replacing these lines: input = True, input_host_api_specific_stream_info = stream_info, with these: output = True, output_host_api_specific_stream_info = stream_info, but then i get this error: Traceback (most recent call last): File "./test.py", line 25, in data = stream.read(chunk) File "/Library/Python/2.5/site-packages/pyaudio.py", line 562, in read paCanNotReadFromAnOutputOnlyStream) IOError: [Errno Not input stream] -9975 is there a way to instantiate the PyAudio stream so that it inputs from the computer's output and i don't have to connect the headphone jack to the microphone? is there a better way to go about this? i'd prefer to stick w/ a python app and avoid cocoa.

    Read the article

  • How should bug tracking and help tickets integrate?

    - by Max Schmeling
    I have a little experience with bug tracking systems such as FogBugz where help tickets are issues are (or can be) bugs, and I have some experience using a bug tracking system internally completely separate from a help center system. My question is, in a company with an existing (home-grown) help center system where replacing it is not an option, how should a bug tracking system (probably Mantis) be integrated into the process? Right now help tickets get put in for issues, questions, etc and they get assigned to the appropriate person (PC Tech, Help Desk staff, or if it's an application issue they can't solve in the help desk it gets assigned to a developer). A user can put a request for small modifications or fixes to an application in a help ticket and the developer it gets assigned to will make the change at some point, apply their time to that ticket, and then close the ticket when it goes to production. We don't currently have a bug tracking system, so I'm looking into the best way to integrate one. Should we just take the help tickets and put it into the bug tracking system if it's a bug (or issue or feature request) and then close the ticket if it's not an emergency fix? We probably don't want to expose the bug tracking system to anyone else as they wouldn't know what to put in the help center system and what to put in the bug tracker... right? Any thoughts? Suggestions? Tips? Advice? To-dos? Not to-dos? etc...

    Read the article

  • Implementing IDisposable on a subclass when the parent also implements IDisposable

    - by Tanzelax
    I have a parent and child class that both need to implement IDisposable. Where should virtual (and base.Dispose()?) calls come into play? When I just override the Dispose(bool disposing) call, it feels really strange stating that I implement IDisposable without having an explicit Dispose() function (just utilizing the inherited one), but having everything else. What I had been doing (trivialized quite a bit): internal class FooBase : IDisposable { Socket baseSocket; private void SendNormalShutdown() { } public void Dispose() { Dispose(true); GC.SuppressFinalize(this); } private bool _disposed = false; protected virtual void Dispose(bool disposing) { if (!_disposed) { if (disposing) { SendNormalShutdown(); } baseSocket.Close(); } } ~FooBase() { Dispose(false); } } internal class Foo : FooBase, IDisposable { Socket extraSocket; private bool _disposed = false; protected override void Dispose(bool disposing) { if (!_disposed) { extraSocket.Close(); } base.Dispose(disposing); } ~Foo() { Dispose(false); } }

    Read the article

  • Payapl sandbox a/c in Dotnet..IPN Response Invaild

    - by Sam
    Hi, I am Integrating paypal to mysite.. i use sandbox account,One Buyer a/c and one more for seller a/c...and downloaded the below code from paypal site string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } and when add this snippets in pageload event of success page i get the ipn response as INVALID but amount paid successfully but i am getting invalid..any help..Paypal Docs in not Clear. thanks in advance

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • In Java, send commands to another command-line program

    - by bradvido
    I am using Java on Windows XP and want to be able to send commands to another program such as telnet. I do not want to simply execute another program. I want to execute it, and then send it a sequence of commands once it's running. Here's my code of what I want to do, but it does not work: (If you uncomment and change the command to "cmd" it works as expected. Please help.) try { Runtime rt = Runtime.getRuntime(); String command = "telnet"; //command = "cmd"; Process pr = rt.exec(command); BufferedReader processOutput = new BufferedReader(new InputStreamReader(pr.getInputStream())); BufferedWriter processInput = new BufferedWriter(new OutputStreamWriter(pr.getOutputStream())); String commandToSend = "open localhost\n"; //commandToSend = "dir\n" + "exit\n"; processInput.write(commandToSend); processInput.flush(); int lineCounter = 0; while(true) { String line = processOutput.readLine(); if(line == null) break; System.out.println(++lineCounter + ": " + line); } processInput.close(); processOutput.close(); pr.waitFor(); } catch(Exception x) { x.printStackTrace(); }

    Read the article

  • Simple perl program failing to execute

    - by yves Baumes
    Here is a sample that fails: #!/usr/bin/perl -w # client.pl #---------------- use strict; use Socket; # initialize host and port my $host = shift || 'localhost'; my $port = shift || 55555; my $server = "10.126.142.22"; # create the socket, connect to the port socket(SOCKET,PF_INET,SOCK_STREAM,(getprotobyname('tcp'))[2]) or die "Can't create a socket $!\n"; connect( SOCKET, pack( 'Sn4x8', AF_INET, $port, $server )) or die "Can't connect to port $port! \n"; my $line; while ($line = <SOCKET>) { print "$line\n"; } close SOCKET or die "close: $!"; with the error: Argument "10.126.142.22" isn't numeric in pack at D:\send.pl line 16. Can't connect to port 55555! I am using this version of Perl: This is perl, v5.10.1 built for MSWin32-x86-multi-thread (with 2 registered patches, see perl -V for more detail) Copyright 1987-2009, Larry Wall Binary build 1006 [291086] provided by ActiveState http://www.ActiveState.com Built Aug 24 2009 13:48:26 Perl may be copied only under the terms of either the Artistic License or the GNU General Public License, which may be found in the Perl 5 source kit. Complete documentation for Perl, including FAQ lists, should be found on this system using "man perl" or "perldoc perl". If you have access to the Internet, point your browser at http://www.perl.org/, the Perl Home Page. While I am running the netcat command on the server side. Telnet does work.

    Read the article

  • MS-Access: What could cause one form with a join query to load right and another not?

    - by Daniel Straight
    Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

    Read the article

  • Excel Reader ASP.NET

    - by user304429
    I declared a DataGrid in a ASP.NET View and I'd like to generate some C# code to populate said DataGrid with an Excel spreadsheet (.xlsx). Here's the code I have: <asp:DataGrid id="DataGrid1" runat="server"/> <script language="C#" runat="server"> protected void Page_Load(object sender, EventArgs e) { string connString = @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=c:\FileName.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; // Create the connection object OleDbConnection oledbConn = new OleDbConnection(connString); try { // Open connection oledbConn.Open(); // Create OleDbCommand object and select data from worksheet Sheet1 OleDbCommand cmd = new OleDbCommand("SELECT * FROM [sheetname$]", oledbConn); // Create new OleDbDataAdapter OleDbDataAdapter oleda = new OleDbDataAdapter(); oleda.SelectCommand = cmd; // Create a DataSet which will hold the data extracted from the worksheet. DataSet ds = new DataSet(); // Fill the DataSet from the data extracted from the worksheet. oleda.Fill(ds, "Something"); // Bind the data to the GridView DataGrid1.DataSource = ds.Tables[0].DefaultView; DataGrid1.DataBind(); } catch { } finally { // Close connection oledbConn.Close(); } } </script> When I run the website, nothing really happens. What gives?

    Read the article

< Previous Page | 89 90 91 92 93 94 95 96 97 98 99 100  | Next Page >