Search Results

Search found 3004 results on 121 pages for 'plain'.

Page 94/121 | < Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >

  • run time error wats the wrong?

    - by javacode
    I am getting run time error import javax.mail.*; import javax.mail.internet.*; import java.util.*; public class SendMail { public static void main(String [] args)throws MessagingException { SendMail sm=new SendMail(); sm.postMail(new String[]{"[email protected]"},"hi","hello","[email protected]"); } public void postMail( String recipients[ ], String subject, String message , String from) throws MessagingException { boolean debug = false; //Set the host smtp address Properties props = new Properties(); props.put("mail.smtp.host", "webmail.emailmyname.com"); // create some properties and get the default Session Session session = Session.getDefaultInstance(props, null); session.setDebug(debug); // create a message Message msg = new MimeMessage(session); // set the from and to address InternetAddress addressFrom = new InternetAddress(from); msg.setFrom(addressFrom); InternetAddress[] addressTo = new InternetAddress[recipients.length]; for (int i = 0; i < recipients.length; i++) { addressTo[i] = new InternetAddress(recipients[i]); } msg.setRecipients(Message.RecipientType.TO, addressTo); // Optional : You can also set your custom headers in the Email if you Want msg.addHeader("MyHeaderName", "myHeaderValue"); // Setting the Subject and Content Type msg.setSubject(subject); msg.setContent(message, "text/plain"); Transport.send(msg); } } Error Exception in thread "main" java.lang.NoClassDefFoundError: SendMail Caused by: java.lang.ClassNotFoundException: SendMail at java.net.URLClassLoader$1.run(Unknown Source) at java.security.AccessController.doPrivileged(Native Method) at java.net.URLClassLoader.findClass(Unknown Source) at java.lang.ClassLoader.loadClass(Unknown Source) at sun.misc.Launcher$AppClassLoader.loadClass(Unknown Source) at java.lang.ClassLoader.loadClass(Unknown Source) Could not find the main class: SendMail. Program will exit.

    Read the article

  • How to insert an element between the two elements dynamically?

    - by Harish
    I am using a table, in which there are buttons, on button click i want the new TR element to be inserted between the two TR or at the end of the TR... my code goes here <table> <tbody> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> <tr> <td> <input type="submit" value="Add" onclick="addFunction()" /> </td> </tr> </tbody> </table> i want to insert new TR element next to the element which has triggered the event... NOTE: i am not using any javascript library, just plain javascript

    Read the article

  • Access class instance "name" dynamically in Python

    - by user328317
    In plain english: I am creating class instances dynamically in a for loop, the class then defines a few attributes for the instance. I need to later be able to look up those values in another for loop. Sample code: class A: def init(self, name, attr): self.name=name self.attr=attr names=("a1", "a2", "a3") x=10 for name in names: name=A(name, x) x += 1 ... ... ... for name in names: print name.attr How can I create an identifier for these instances so they can be accessed later on by "name"? I've figured a way to get this by associating "name" with the memory location: class A: instances=[] names=[] def init(self, name, attr): self.name=name self.attr=attr A.instances.append(self) A.names.append(name) names=("a1", "a2", "a3") x=10 for name in names: name=A(name, x) x += 1 ... ... ... for name in names: index=A.names.index(name) print "name: " + name print "att: " + str(A.instances[index].att) This has had me scouring the web for 2 days now, and I have not been able to find an answer. Maybe I don't know how to ask the question properly, or maybe it can't be done (as many other posts seemed to be suggesting). Now this 2nd example works, and for now I will use it. I'm just thinking there has to be an easier way than creating your own makeshift dictionary of index numbers and I'm hoping I didn't waste 2 days looking for an answer that doesn't exist. Anyone have anything? Thanks in advance, Andy Update: A coworker just showed me what he thinks is the simplest way and that is to make an actual dictionary of class instances using the instance "name" as the key.

    Read the article

  • Dynamic loading of shared objects using dlopen()

    - by Andy
    Hi, I'm working on a plain X11 app. By default, my app only requires libX11.so and the standard gcc C and math libs. My app has also support for extensions like Xfixes and Xrender and the ALSA sound system. But this feature shall be made optional, i.e. if Xfixes/Xrender/ALSA is installed on the host system, my app will offer extended functionality. If Xfixes or Xrender or ALSA is not there, my app will still run but some functionality will not be available. To achieve this behaviour, I'm not linking dynamically against -lXfixes, -lXrender and -lasound. Instead, I'm opening these libraries manually using dlopen(). By doing it this way, I can be sure that my app won't fail in case one of these optional components is not present. Now to my question: What library names should I use when calling dlopen()? I've seen that these differ from distro to distro. For example, on openSUSE 11, they're named the following: libXfixes.so libXrender.so libasound.so On Ubuntu, however, the names have a version number attached, like this: libXfixes.so.3 libXrender.so.1 libasound.so.2 So trying to open "libXfixes.so" would fail on Ubuntu, although the lib is obviously there. It just has a version number attached. So how should my app handle this? Should I let my app scan /usr/lib/ first manually to see which libs we have and then choose an appropriate one? Or does anyone have a better idea? Thanks guys, Andy

    Read the article

  • Unable to HTTP PUT with libcurl

    - by Jesse Beder
    I'm trying to PUT data using libcurl to mimic the command curl -u test:test -X PUT --data-binary @data.yaml "http://127.0.0.1:8000/foo/" which works correctly. My options look like: curl_easy_setopt(handle, CURLOPT_USERPWD, "test:test"); curl_easy_setopt(handle, CURLOPT_URL, "http://127.0.0.1:8000/foo/"); curl_easy_setopt(handle, CURLOPT_VERBOSE, 1); curl_easy_setopt(handle, CURLOPT_UPLOAD, 1); curl_easy_setopt(handle, CURLOPT_READFUNCTION, read_data); curl_easy_setopt(handle, CURLOPT_READDATA, &yaml); curl_easy_setopt(handle, CURLOPT_INFILESIZE, yaml.size()); curl_easy_perform(handle); I believe the read_data function works correctly, but if you ask, I'll post that code. I'm using Django with django-piston, and my update function is never called! (It is called when I use the command line version above.) libcurl's output is: * About to connect() to 127.0.0.1 port 8000 (#0) * Trying 127.0.0.1... * connected * Connected to 127.0.0.1 (127.0.0.1) port 8000 (#0) * Server auth using Basic with user 'test' > PUT /foo/ HTTP/1.1 Authorization: Basic dGVzdDp0ZXN0 Host: 127.0.0.1:8000 Accept: */* Content-Length: 244 Expect: 100-continue * Done waiting for 100-continue ** this is where my read_data handler confirms: read 244 bytes ** * HTTP 1.0, assume close after body < HTTP/1.0 400 BAD REQUEST < Date: Thu, 13 May 2010 08:22:52 GMT < Server: WSGIServer/0.1 Python/2.5.1 < Vary: Authorization < Content-Type: text/plain < Bad Request* Closing connection #0

    Read the article

  • How can I reorder an mbox file chronologically?

    - by Joshxtothe4
    Hello, I have a single spool mbox file that was created with evolution, containing a selection of emails that I wish to print. My problem is that the emails are not placed into the mbox file chronologically. I would like to know the best way to place order the files from first to last using bash, perl or python. I would like to oder by received for files addressed to me, and sent for files sent by me. Would it perhaps be easier to use maildir files or such? The emails currently exist in the format: From [email protected] Fri Aug 12 09:34:09 2005 Message-ID: <[email protected]> Date: Fri, 12 Aug 2005 09:34:09 +0900 From: me <[email protected]> User-Agent: Mozilla Thunderbird 1.0.6 (Windows/20050716) X-Accept-Language: en-us, en MIME-Version: 1.0 To: someone <[email protected]> Subject: Re: (no subject) References: <[email protected]> In-Reply-To: <[email protected]> Content-Type: text/plain; charset=ISO-8859-1; format=flowed Content-Transfer-Encoding: 8bit Status: RO X-Status: X-Keywords: X-UID: 371 X-Evolution-Source: imap://[email protected]/ X-Evolution: 00000002-0010 Hey the actual content of the email someone wrote: > lines of quotedtext I am wondering if there is a way to use this information to easily reorganize the file, perhaps with perl or such.

    Read the article

  • Why do Scala maps have poor performance relative to Java?

    - by Mike Hanafey
    I am working on a Scala app that consumes large amounts of CPU time, so performance matters. The prototype of the system was written in Python, and performance was unacceptable. The application does a lot with inserting and manipulating data in maps. Rex Kerr's Thyme was used to look at the performance of updating and retrieving data from maps. Basically "n" random Ints were stored in maps, and retrieved from the maps, with the time relative to java.util.HashMap used as a reference. The full results for a range of "n" are here. Sample (n=100,000) performance relative to java, smaller is worse: Update Read Mutable 16.06% 76.51% Immutable 31.30% 20.68% I do not understand why the scala immutable map beats the scala mutable map in update performance. Using the sizeHint on the mutable map does not help (it appears to be ignored in the tested implementation, 2.10.3). Even more surprisingly the immutable read performance is worse than the mutable read performance, more significantly so with larger maps. The update performance of the scala mutable map is surprisingly bad, relative to both scala immutable and plain Java. What is the explanation?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • performSelector:withObject:afterDelay: not working from scrollViewDidZoom

    - by oldbeamer
    Hi all, I feel like I should know this but I've been stumped for hours now and I've run out of ideas. The theory is simple, the user manipulates the zoom and positioning in a scrollview using a pinch. If they hold that pinch for a short period of time then the scrollview records the zoom level and content offsets. So I thought I'd start a performSelector:withObject:withDelay on the scrollViewDidZoom delegate method. If it expires then I record the settings. I delete the scheduled call every time scrollViewDidZoom is called and when the pinch gesture finishes. This is what I have: - (void)scrollViewDidZoom:(UIScrollView *)scrollView{ NSLog(@"resetting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; [self performSelector:@selector(positionLock) withObject:nil afterDelay:0.4]; } -(void)positionLock{ NSLog(@"position locked "); } - (void)scrollViewDidEndZooming:(UIScrollView *)scrollView withView:(UIView *)view atScale:(float)scale{ NSLog(@"deleting timer"); [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(positionLock) object:nil]; } This is the output: 2010-05-19 22:43:01.931 resetting timer 2010-05-19 22:43:01.964 resetting timer 2010-05-19 22:43:02.231 resetting timer 2010-05-19 22:43:02.253 resetting timer 2010-05-19 22:43:02.269 resetting timer 2010-05-19 22:43:02.298 resetting timer 2010-05-19 22:43:05.399 deleting timer As you can see the delay between the last and second last events should have been more than enough for the delayed selector call to execute. If I replace performSelector:withObject:withDelay with plain old performSelector: I get this: 2010-05-19 23:08:30.333 resetting timer 2010-05-19 23:08:30.333 position locked 2010-05-19 23:08:30.366 resetting timer 2010-05-19 23:08:30.367 position locked 2010-05-19 23:08:30.688 deleting timer Which isn't what I want but serves to show that it's only the delay that's causing it to not function, not something to do with the selector not being declared in the header, being misspelt or any other reason. Any ideas as to why it's not working?

    Read the article

  • UTF-8 HTML and CSS files with BOM (and how to remove the BOM with Python)

    - by Cameron
    First, some background: I'm developing a web application using Python. All of my (text) files are currently stored in UTF-8 with the BOM. This includes all my HTML templates and CSS files. These resources are stored as binary data (BOM and all) in my DB. When I retrieve the templates from the DB, I decode them using template.decode('utf-8'). When the HTML arrives in the browser, the BOM is present at the beginning of the HTTP response body. This generates a very interesting error in Chrome: Extra <html> encountered. Migrating attributes back to the original <html> element and ignoring the tag. Chrome seems to generate an <html> tag automatically when it sees the BOM and mistakes it for content, making the real <html> tag an error. So, using Python, what is the best way to remove the BOM from my UTF-8 encoded templates (if it exists -- I can't guarantee this in the future)? For other text-based files like CSS, will major browsers correctly interpret (or ignore) the BOM? They are being sent as plain binary data without .decode('utf-8'). Note: I am using Python 2.5. Thanks!

    Read the article

  • Are there more secure alternatives to the .Net SQLConnection class?

    - by KeyboardMonkey
    Hi SO people, I'm very surprised this issue hasn't been discussed in-depth: This article tells us how to use windbg to dump a running .Net process strings in memory. I spent much time researching the SecureString class, which uses unmanaged pinned memory blocks, and keeps the data encrypted too. Great stuff. The problem comes in when you use it's value, and assign it to the SQLConnection.ConnectionString property, which is of the System.String type. What does this mean? Well... It's stored in plain text Garbage Collection moves it around, leaving copies in memory It can be read with windbg memory dumps That totally negates the SecureString functionality! On top of that, the SQLConnection class is non-inheritable, I can't even roll my own with a SecureString property instead; Yay for closed-source. Yay. A new DAL layer is in progress, but for a new major version and for so many users it will be at least 2 years before every user is upgraded, others might stay on the old version indefinitely, for whatever reason. Because of the frequency the connection is used, marshalling from a SecureString won't help, since the immutable old copies stick in memory until GC comes around. Integrated Windows security isn't an option, since some clients don't work on domains, and other roam and connect over the net. How can I secure the connection string, in memory, so it can't be viewed with windbg?

    Read the article

  • Function pointers in Objective-C

    - by Stefan Klumpp
    I have the following scenario: Class_A - method_U - method_V - method_X - method_Y Class_B - method_M - method_N HttpClass - startRequest - didReceiveResponse // is a callback Now I want to realize these three flows (actually there are many more, but these are enough to demonstrate my question): Class_A :: method_X -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_A :: method_Y:result and: Class_A :: method_U -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_A :: method_V:result and the last one: Class_B :: method_M -> HttpClass :: startRequest:params -> ... wait, wait, wait ... -> HttpClass :: didReceiveResponse -> Class_B :: method_N:result Please note, that the methods in Class_A and Class_B have different names and functionality, they just make us of the same HttpClass. My solution now would be to pass a C function pointer to startRequest, store it in the HttpClass and when didReceiveResponse gets called I invoke the function pointer and pass the result (which will always be a JSON Dictionary). Now I'm wondering if there can be any problems using plain C or if there are better solutions doing it in a more Objective-C way. Any ideas?

    Read the article

  • How to install Zend Framework on Windows

    - by sombe
    "installing Zend Framework is so easy!!!!" yeah right... Ok I'm working with a beginner's book and the ONE thing that is not excessively detailed is the most important part: Installing the darn thing. After browsing the quickstart guide for hours, all it said was: "download Zend [...] add the include directory (bla bla) and YOU'RE DONE!" right, i'm done using Zend. Ok, not really, not yet anyway. I beg of you people, I wanna go to bed, please tell me how (in simple 6th grade detail) to install the framework. I've got the unzipped folder in my htdocs directory, and I placed zf.bat+zf.php in the htdocs root. What's next? thank you so much. EDIT: Thanks guys for all the answers. Unfortunately I haven't been able to work with this or find a good enough resource to explain it to me in plain english. It seems that this framework adheres more so to programmers than to beginners. I've since yesterday read a little on CakePHP and found that it was incredibly easy to install and tune. As oppose to Zend Framework, where I had to dig in my "environment variables", configure "httpd.conf" and almost tie the knot between my computer driver cables to just get it running, CakePHP has already allowed me to put together a nice newbie application. In conclusion, I very much appreciate all of your help. I hope someone else venturing on ZF will be more successful with it. Thanks!

    Read the article

  • PHP weirdness extending IMagick class

    - by Jamie Carl
    This is a really weird one. I have some code that is happily working on version 2.1.1RC1 of the php5-imagick module. It's basically just a class I wrote that extends the Imagick class and manages images stored in a database. Since upgrading to version 3.0.0RC1 (thankfully only on my dev box) things have gone to hell. It seems that object members are writeable but are NOT readable. Take the following sample code: class db_image extends IMagick { private $data; function __construct( $id = null ){ parent::__construct(); $this->data = 'some plain text'; echo $this->data; } This will output absolutely NOTHING. My debugger indicates that the contents of $this-data are the correct string value, but I am unable to read the value back out of the member variable. Seriously. WTF? Does anyone know what is causing this or has seen it before? I don't even know how to replicate this behaviour in my own classes.

    Read the article

  • Prohibit ampersand in Rails form

    - by snlsn
    NOT a Rails 3 issue In a Contact model I have a company_name attribute. For reasons that don't matter to this question, I want to prohibit an ampersand character. We have a lot of clients with ampersands in their company name, and users forget they aren't allowed to use this character. This isn't an html sanitize issue. I don't care about whitespace or CDATA or anything. The entries in this field are plain text and I don't want an ampersand to be entered in this one field in any way, shape or form. I assume a validation on the model is the way to go. I have tried validates_exclusion_of. I have tried validates_format_of. No success. I'm unsophisticated when it comes to regex, so I might be doing things very wrong. But the bottom line is - I need to prevent a user from entering that "&" character in the company_name field. Thanks a million. Steve

    Read the article

  • Initialize listitem with blanks?

    - by VBartilucci
    Say I have a list made up of a listitem which contains three strings. I add a new listitem, and try to assign the values of said strings from an outside source. If one of those items is unassigned, the value in the listitem remains as null (unassigned). As a result I get an error if I try to assign that value to a field on my page. I can do a check on isNullOrEmpty for each field on the page, but that seems inefficient. I'd rather initialize the values to "" (Empty string) in the codebehind and send valid data. I can do it manually: ClaimPwk emptyNode = new ClaimPwk(); emptyNode.cdeAttachmentControl = ""; emptyNode.cdeRptTransmission = ""; emptyNode.cdeRptType = ""; headerKeys.Add(emptyNode); But I have some BIG list items, and writing that for those will get tedious. So is there a command, or just plain an easier way to initialize a listitem to empty string as opposed to null? Or has anyone got a better idea?

    Read the article

  • Parsing the Youtube API with DOM

    - by Kirk
    I'm using the Youtube API and I can retrieve the date information without a problem, but don't know how to retrieve the description information. My Code: <?php $v = "dQw4w9WgXcQ"; $url = "http://gdata.youtube.com/feeds/api/videos/". $v; $doc = new DOMDocument; $doc->load($url); $pub = $doc->getElementsByTagName("published")->item(0)->nodeValue; $desc = $doc->getElementsByTagName("media:description")->item(0)->nodeValue; echo "<b>Video Uploaded:</b> "; echo date( "F jS, Y", strtotime( $pub ) ); echo '<br>'; if (isset ($desc)) { echo "<b>Description:</b> "; echo $desc; echo '<br>'; } ?> Here's a link to the feed: http://gdata.youtube.com/feeds/api/videos/dQw4w9WgXcQ?prettyprint=true And the excerpt of code I don't know how to retrieve data from: <media:group> <media:description type='plain'>Music video by Rick Astley performing Never Gonna Give You Up. (C) 1987 PWL</media:description> </media:group> Thanks in advance.

    Read the article

  • Syntax for documenting JSON structure

    - by Roman A. Taycher
    So I'm trying to document the format of the json returned by an api I am writing against and I'd like to know if there is any popular format for the documentation of json structure. Note I'm not trying to to test or validate anything, I'm just using this for documentation. Also some ways to add comments to non-constants(items always returned w/ the same value) would be nice. This the not totally thought out scheme I'm currently using: Plain names refer to identifiers or types. Some types have type-comment Strings that appear to be constant(always returned for that type of request) strings are "str" Constant Numbers would be just the number Constant null is null Booleans are true/false for constant booleans or Boolean otherwise [a,b,c] are lists with 3 items a,b,c [... ...] is a list of repeating elements of some types/constants/patterns {a:A,b:B,c:c} and {... ...} is the same for a dictionary. example: story := [header,footer] header := {"data":realHeader,"kind":"Listing"} realHeader := {"after": null, "before": null, "children": [{"data": realRealHeader, "kind": "t3"}], "modhash": ""} footer := {"data":AlmostComments,"kind":"Listing"} AlmostComments := {"data": {"after": null, "before": null, "children": comments, "modhash": ""}, "kind": "t1"} comments := [...{"data":comment, "kind":"t1"}...] realRealHeader := {"author": string, "clicked": boolean, "created": int, "created_utc": int, "domain": "code.reddit.com", "downs": int, "hidden": boolean, "id": string-id, "is_self": boolean, "levenshtein": null, "likes": null, "media": null, "media_embed": { }, "name": string-id, "num_comments": int, "over_18": false, "permalink": string-urlLinkToStoryStartingFrom/r, "saved": false, "score": int, "selftext": string, "selftext_html": string-html, "subreddit": string-subredditname, "subreddit_id": string-id, "thumbnail": "", "title": string, "ups": int, "url": "http://code.reddit.com/" } comments := { "author": string, "body": string-body_html-wout-html, "body_html": string-html-formated, "created": int, "created_utc": int, "downs": int, "id": string-id, "levenshtein": null, "likes": null, "link_id": string-id, "name": string-id", "parent_id": string-id, "replies": AlmostComments or null, "subreddit": string-subredditname, "subreddit_id": string-id, "ups": int }

    Read the article

  • PHP/Javascript limiting amount of checkboxes

    - by Carl294
    Hi everyone Im trying to limit the amount of checkboxes that can be checked, in this case only 3 can be checked. When using plain HTML this works fine. The code can be seen below. HTML example <td ><input type=checkbox name=ckb value=2 onclick='chkcontrol()';></td><td>Perl</td> Javascript Function <script type="text/javascript"> function chkcontrol(j) { var total=0; for(var i=0; i < document.form1.ckb.length; i++){ if(document.form1.ckb[i].checked){ total =total +1;} if(total > 3){ alert("Please Select only three") document.form1.ckb[j].checked = false; return false; } } } </script> The problem appears when replacing the fixed HTML values with values from a MYSQL database. All the information appears correctly, and can be posted to another page via a submit button. However, it seems like the 'value' assigned to each record from the database is not making its way too the javascript function. <td><input name="checkbox[]" type="checkbox" value="<?php echo $rows['TCA_QID'];?>" onclick="chkcontrol();"></td> I have tried changed the name in the javascript function to match the 'checkbox' name.Any advice would be greatly appreciated Thanks

    Read the article

  • Create new or update existing entity at one go with JPA

    - by Alex R
    A have a JPA entity that has timestamp field and is distinguished by a complex identifier field. What I need is to update timestamp in an entity that has already been stored, otherwise create and store new entity with the current timestamp. As it turns out the task is not as simple as it seems from the first sight. The problem is that in concurrent environment I get nasty "Unique index or primary key violation" exception. Here's my code: // Load existing entity, if any. Entity e = entityManager.find(Entity.class, id); if (e == null) { // Could not find entity with the specified id in the database, so create new one. e = entityManager.merge(new Entity(id)); } // Set current time... e.setTimestamp(new Date()); // ...and finally save entity. entityManager.flush(); Please note that in this example entity identifier is not generated on insert, it is known in advance. When two or more of threads run this block of code in parallel, they may simultaneously get null from entityManager.find(Entity.class, id) method call, so they will attempt to save two or more entities at the same time, with the same identifier resulting in error. I think that there are few solutions to the problem. Sure I could synchronize this code block with a global lock to prevent concurrent access to the database, but would it be the most efficient way? Some databases support very handy MERGE statement that updates existing or creates new row if none exists. But I doubt that OpenJPA (JPA implementation of my choice) supports it. Event if JPA does not support SQL MERGE, I can always fall back to plain old JDBC and do whatever I want with the database. But I don't want to leave comfortable API and mess with hairy JDBC+SQL combination. There is a magic trick to fix it using standard JPA API only, but I don't know it yet. Please help.

    Read the article

  • Font advance calculation problem on Blackberry OS 5.0

    - by John
    I am currently working on my own implementation of a tab bar for a BlackBerry app, where each tab bar has a title that is right aligned (i.e. the last character in each should be the same distance from the right hand side of the screen). To work out where to draw the text I am using the following calculation: screen width - advance of title - indent. The font I am using is 'BBAlpha Sans' (height 28). Using BlackBerry OS 4.6 everything seems to be calculated properly and the text is aligned when I move between tabs, however I am finding that when I use OS 5.0 it doesn't calculate the advance properly and as a result the alignment is off by maybe 5 pixels or so. With the default font (also BBAlpha Sans, but height 24 - for OS 5.0 at least) it works fine in both versions.. but I don't necessarily always want to use the default font/size, so any ideas what could be going wrong? Is this a bug in the 5.0 API? Thanks. Code: public class TitleBarBackground extends Background { .. public void draw(Graphics graphics, XYRect rect) { graphics.pushRegion(rect); .. Font titleBarFont = FontFamily.forName("BBAlpha Sans").getFont(Font.PLAIN, 28); ... int textWidth = titleBarFont.getAdvance(title); graphics.drawText(title, rect.width - textWidth - TITLE_OFFSET, textYOffset); graphics.popContext(); } .. }

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Using DotNetOpenAuth AccessToken for uploading docx file to google

    - by PrashantC
    Hi , I am using DotNetOpenAuth Package, I am trying to upload a package to google docs, Using client credentials i am able to do it successfully using following code, DocumentEntry objDocumentEntry = new DocumentEntry(); objDocumentsService.setUserCredentials(strUserName,strPassWord); string strAuthenticationToken = objDocumentsService.QueryAuthenticationToken(); objDocumentEntry = objDocumentsService.UploadDocument(Server.MapPath("test.docx"), "New Name"); I want achieve save with plain oAuth, I am having following code written for it, if (this.TokenManager != null) { if (!IsPostBack) { var google = new WebConsumer(GoogleConsumer.ServiceDescription, this.TokenManager); // Is Google calling back with authorization? var accessTokenResponse = google.ProcessUserAuthorization(); if (accessTokenResponse != null) { this.AccessToken = accessTokenResponse.AccessToken; } else if (this.AccessToken == null) { // If we don't yet have access, immediately request it. GoogleConsumer.RequestAuthorization(google, GoogleConsumer.Applications.DocumentsList); } } } I successfully get "AccessToken", But i am not sure how to use it.. Do we need to exchange this token? what excatly to do with this token? Is it a sessionToken? Please provide some inputs, I am badly stuck with this problem from last 3 days, Prashant C

    Read the article

  • JavaFX: File upload to REST service / servlet fails because of missing boundary

    - by spa
    I'm trying to upload a file using JavaFX using the HttpRequest. For this purpose I have written the following function. function uploadFile(inputFile : File) : Void { // check file if (inputFile == null or not(inputFile.exists()) or inputFile.isDirectory()) { return; } def httpRequest : HttpRequest = HttpRequest { location: urlConverter.encodeURL("{serverUrl}"); source: new FileInputStream(inputFile) method: HttpRequest.POST headers: [ HttpHeader { name: HttpHeader.CONTENT_TYPE value: "multipart/form-data" } ] } httpRequest.start(); } On the server side, I am trying to handle the incoming data using the Apache Commons FileUpload API using a Jersey REST service. The code used to do this is a simple copy of the FileUpload tutorial on the Apache homepage. @Path("Upload") public class UploadService { public static final String RC_OK = "OK"; public static final String RC_ERROR = "ERROR"; @POST @Produces("text/plain") public String handleFileUpload(@Context HttpServletRequest request) { if (!ServletFileUpload.isMultipartContent(request)) { return RC_ERROR; } FileItemFactory factory = new DiskFileItemFactory(); ServletFileUpload upload = new ServletFileUpload(factory); List<FileItem> items = null; try { items = upload.parseRequest(request); } catch (FileUploadException e) { e.printStackTrace(); return RC_ERROR; } ... } } However, I get a exception at items = upload.parseRequest(request);: org.apache.commons.fileupload.FileUploadException: the request was rejected because no multipart boundary was found I guess I have to add a manual boundary info to the InputStream. Is there any easy solution to do this? Or are there even other solutions?

    Read the article

  • How can you push a new view with a grouped table?

    - by Tanner
    Hi All, Ive been trying to push a new view when a cell is tapped but absolutely nothing happens. I figured grouped style pushed the same as plain. Here is my code: -(void)viewDidLoad { [super viewDidLoad]; contactArray = [[NSArray alloc] initWithObjects:@"iPhone",@"iPod",@"MacBook",@"MacBook Pro",nil]; shareArray = [[NSArray alloc] initWithObjects:@"Flex",@"AIR",@"PhotoShop",@"Flash",nil]; } -(NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 2; } // Customize the number of rows in the table view. -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { if(section == 0) return [contactArray count]; else return [shareArray count]; } -(NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section{ if(section == 0){ return @"Contact"; }else{ return @"Share"; } } -(NSString *)tableView:(UITableView *)tableView titleForFooterInSection:(NSInteger)section{ if(section == 0){ return @"Footer for Apple Products"; }else{ return @"Footer for Adobe Softwares"; } } // Customize the appearance of table view cells. -(UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; } // Set up the cell... if(indexPath.section == 0){ cell.text = [contactArray objectAtIndex:indexPath.row]; }else{ cell.text = [shareArray objectAtIndex:indexPath.row]; } return cell; } -(void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { //NextViewController *nextController = [[NextViewController alloc] initWithNibName:@"NextView" bundle:nil]; //[self.navigationController pushViewController:nextController animated:YES]; if([contactArray objectAtIndex:indexPath.row] == @"iPhone"){ LandscapeHydrogen *abo = [[LandscapeHydrogen alloc] initWithNibName:@"LandscapeHydrogen" bundle:nil]; [self.navigationController pushViewController:abo animated:NO]; [abo release]; } } Any help is appreciated.

    Read the article

< Previous Page | 90 91 92 93 94 95 96 97 98 99 100 101  | Next Page >