Search Results

Search found 10863 results on 435 pages for 'no refunds no returns'.

Page 96/435 | < Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >

  • using yield in C# like I would in Ruby

    - by Sarah Vessels
    Besides just using yield for iterators in Ruby, I also use it to pass control briefly back to the caller before resuming control in the called method. What I want to do in C# is similar. In a test class, I want to get a connection instance, create another variable instance that uses that connection, then pass the variable to the calling method so it can be fiddled with. I then want control to return to the called method so that the connection can be disposed. I guess I'm wanting a block/closure like in Ruby. Here's the general idea: private static MyThing getThing() { using (var connection = new Connection()) { yield return new MyThing(connection); } } [TestMethod] public void MyTest1() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } [TestMethod] public void MyTest2() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } ... This doesn't work in C#; ReSharper tells me that the body of getThing cannot be an iterator block because MyThing is not an iterator interface type. That's definitely true, but I don't want to iterate through some list. I'm guessing I shouldn't use yield if I'm not working with iterators. Any idea how I can achieve this block/closure thing in C# so I don't have to wrap my code in MyTest1, MyTest2, ... with the code in getThing()'s body?

    Read the article

  • Problems with Threading in Python 2.5, KeyError: 51, Help debugging?

    - by vignesh-k
    I have a python script which runs a particular script large number of times (for monte carlo purpose) and the way I have scripted it is that, I queue up the script the desired number of times it should be run then I spawn threads and each thread runs the script once and again when its done. Once the script in a particular thread is finished, the output is written to a file by accessing a lock (so my guess was that only one thread accesses the lock at a given time). Once the lock is released by one thread, the next thread accesses it and adds its output to the previously written file and rewrites it. I am not facing a problem when the number of iterations is small like 10 or 20 but when its large like 50 or 150, python returns a KeyError: 51 telling me element doesn't exist and the error it points out to is within the lock which puzzles me since only one thread should access the lock at once and I do not expect an error. This is the class I use: class errorclass(threading.Thread): def __init__(self, queue): self.__queue=queue threading.Thread.__init__(self) def run(self): while 1: item = self.__queue.get() if item is None: break result = myfunction() lock = threading.RLock() lock.acquire() ADD entries from current thread to entries in file and REWRITE FILE lock.release() queue = Queue.Queue() for i in range(threads): errorclass(queue).start() for i in range(desired iterations): queue.put(i) for i in range(threads): queue.put(None) Python returns with KeyError: 51 for large number of desired iterations during the adding/write file operation after lock access, I am wondering if this is the correct way to use the lock since every thread has a lock operation rather than every thread accessing a shared lock? What would be the way to rectify this?

    Read the article

  • Function returning a class containing a function returning a class

    - by Scott
    I'm working on an object-oriented Excel add-in to retrieve information from our ERP system's database. Here is an example of a function call: itemDescription = Macola.Item("12345").Description Macola is an instance of a class which takes care of database access. Item() is a function of the Macola class which returns an instance of an ItemMaster class. Description() is a function of the ItemMaster class. This is all working correctly. Items can be be stored in more than one location, so my next step is to do this: quantityOnHand = Macola.Item("12345").Location("A1").QuantityOnHand Location() is a function of the ItemMaster class which returns an instance of the ItemLocation class (well, in theory anyway). QuantityOnHand() is a function of the ItemLocation class. But for some reason, the ItemLocation class is not even being intialized. Public Function Location(inventoryLocation As String) As ItemLocation Set Location = New ItemLocation Location.Item = item_no Location.Code = inventoryLocation End Function In the above sample, the variable item_no is a member variable of the ItemMaster class. Oddly enough, I can successfully instantiate the ItemLocation class outside of the ItemMaster class in a non-class module. Dim test As New ItemLocation test.Item = "12345" test.Code = "A1" quantityOnHand = test.QuantityOnHand Is there some way to make this work the way I want? I'm trying to keep the API as simple as possible. So that it only takes one line of code to retrieve a value.

    Read the article

  • C++ - Basic WinAPI question

    - by HardCoder1986
    Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

    Read the article

  • pyPDF - Retrieve page numbers from document

    - by SquidneyPoitier
    At the moment I'm looking into doing some PDF merging with pyPdf, but sometimes the inputs are not in the right order, so I'm looking into scraping each page for its page number to determine the order it should go in (e.g. if someone split up a book into 20 10-page PDFs and I want to put them back together). I have two questions - 1.) I know that sometimes the page number is stored in the document data somewhere, as I've seen PDFs that render on Adobe as something like [1243] (10 of 150), but I've read documents of this sort into pyPDF and I can't find any information indicating the page number - where is this stored? 2.) If avenue #1 isn't available, I think I could iterate through the objects on a given page to try to find a page number - likely it would be its own object that has a single number in it. However, I can't seem to find any clear way to determine the contents of objects. If I run: pdf.getPage(0).getContents() This usually either returns: {'/Filter': '/FlateDecode'} or it returns a list of IndirectObject(num, num) objects. I don't really know what to do with either of these and there's no real documentation on it as far as I can tell. Is anyone familiar with this kind of thing that could point me in the right direction?

    Read the article

  • Strange behavior while returning csv file from spring controller

    - by Fanooos
    I working in a spring application which have an action method that returns a CSV file. This action works fine but in some cases it throws a predefined exception (MyAppException). I have another method that is annotated @ExceptionHandler(MyAppException.class) In the exception handler method I return another csv file but with different contents. The code that returns the csv file is almost the same in the two methods. List<String[]> list= new ArrayList<String[]>(); list.add(new String[]{ integrationRequestErrorLog.getErrorMessage(), Long.toString(integrationRequestErrorLog.getId()), Integer.toString(integrationRequestErrorLog.getErrorCode()) }); CSVWriter writer = new CSVWriter(response.getWriter(), ','); writer.writeAll(list); writer.close(); the difference between the two method is the list of contents. In the first method the file is returned normally while in the exception handler method I have a strange behavior. The exception handler method works fine with Opera browser while it gives me a 404 with FireFox. Opera browser give me 404 also but it download the file while firefox does not? Really I do not understand what is the difference here.

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • Get the src part of a string [duplicate]

    - by Kay Lakeman
    This question already has an answer here: Grabbing the href attribute of an A element 7 answers First post ever here, and i really hope you can help. I use a database where a large piece of html is stored, now i just need the src part of the image tag. I already found a thread, but i just doesn't do the trick. My code: Original string: <p><img alt=\"\" src=\"http://domain.nl/cms/ckeditor/filemanager/userfiles/background.png\" style=\"width: 80px; height: 160px;\" /></p> How i start: $image = strip_tags($row['information'], '<img>'); echo stripslashes($image); This returns: <img alt="" src="http://domain.nl/cms/ckeditor/filemanager/userfiles/background.png" style="width: 80px; height: 160px;" /> Next step: extract the src part: preg_match('/< *img[^>]*src *= *["\']?([^"\']*)/i', $image, $matches); echo $matches ; This last echo returns: Array What is going wrong? Thanks in advance for your anwser.

    Read the article

  • iBatis not populating object when there are no rows found.

    - by Omnipresent
    I am running a stored procedure that returns 2 cursors and none of them have any data. I have the following mapping xml: <resultMap id="resultMap1" class="HashMap"> <result property="firstName" columnIndex="2"/> </resultMap> <resultMap id="resultMap2" class="com.somePackage.MyBean"> <result property="unitStreetName" column="street_name"/> </resultMap> <parameterMap id="parmmap" class="map"> <parameter property="id" jdbcType="String" javaType="java.lang.String" mode="IN"/> <parameter property="Result0" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap1"/> <parameter property="Result1" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap2"/> </parameterMap> <procedure id="proc" parameterMap="parmmap"> { call my_sp (?,?,?) } </procedure> First result set is being put in a HashMap...second resultSet is being put in a MyBean class. code in my DAO follows: HashMap map = new HashMap() map.put("id", "1234"); getSqlMapClientTemplate().queryForList("mymap.proc", map); HashMap result1 = (HashMap)((List)parmMap.get("Result0")).get(0); MyBean myObject = (MyBean)((List)parmMap.get("Result1")).get(0);//code fails here in the last line above..my code fails. It fails because second cursor has no rows and thats why nothing is put into the list. However, first cursor returns nothing as well but since results are being put into a HashMap the list for first cursor atleast has HashMap object inside it.. Why this difference? is there a way to make iBatis put an object of MyBean inside the list even if there are no rows returned? Or should I be handling this in my DAO...I want to avoid handling it in the DAO because I have whole bunch of DAO's like these.

    Read the article

  • Can isdigit legitimately be locale dependent in C

    - by cdev
    In the section covering setlocale, the ANSI C standard states in a footnote that the only ctype.h functions whose behaviour is not affected by the current locale are isdigit and isxdigit. The Microsoft implementation of isdigit is locale dependent because, for example, in locales using code page 1250 isdigit only returns non-zero for characters in the range 0x30 ('0') - 0x39 ('9'), whereas in locales using code page 1252 isdigit also returns non-zero for the superscript digits 0xB2 ('²'), 0xB3 ('³') and 0xB9 ('¹'). Is Microsoft in violation of the C standard by making isdigit locale dependent? In this question I am primarily interested in C90, which Microsoft claims to conform to, rather than C99. Additional background: Microsoft's own documentation of setlocale incorrectly states that isdigit is unaffected by the LC_CTYPE part of the locale. The section of the C standard that covers the ctype.h functions contains some wording that I consider ambiguous: "The behavior of these functions is affected by the current locale. Those functions that have locale-specific aspects only when not in the "C" locale are noted below." I consider this ambiguous because it is unclear what it is trying to say about functions such as isdigit for which there are no notes about locale-specific aspects. It might be trying to say that such functions must be assumed to be locale dependent, in which case Microsoft's implementation of isdigit would be OK. (Except that the footnote I mentioned earlier seems to contradict this interpretation.)

    Read the article

  • Need a refresher course on property access...

    - by Code Sherpa
    Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

    Read the article

  • assembling an object graph without an ORM -- in the service layer or data layer?

    - by Hans Gruber
    At my current gig, our persistence layer uses IBatis going against SQL Server stored procedures (puke). IMHO, this approach has many disadvantages over the use of a "true" ORM such NHibernate or EF, but the one I'm trying to address here revolves around all the boilerplate code needed to map data from a result set into an object graph. Say I have the following DTO object graph I want to return to my presentation layer: IEnumerable<CustomerDTO> |--> IEnumerable<AddressDTO> |--> LatestOrderDTO The way I've implemented this is to have a discrete method in my DAO class to return each IEnumerable<*DTO>, and then have my service class be responsible for orchestrating the calls to the DAO. It then returns the fully assembled object graph to the client: public class SomeService(){ public SomeService(IDao someDao){ this._someDao = someDao; } public IEnumerable<CustomerDTO> ListCustomersForHistory(int brokerId){ var customers = _someDao.ListCustomersForBroker(brokerId); foreach (customer in customers){ customer.Addresses = someDao.ListCustomersAddresses(brokerId); customer.LatestOrder = someDao.GetCustomerLatestOrder(brokerId); } } return customers; } My question is should this logic belong in the service layer or the should I make my DAO such that it instead returns the assembled object graph. If I was using NHibernate, I assume that this kind of relationship association between objects comes for "free"?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Decimal To Octal Converter, last digit issue

    - by Srishan Supertramp
    I tried making a C program to convert a user entered decimal number to octal. I wrote the C code with my own logic without any research of how other users try to do it. It works fine for the number 601 and some other numbers but for most numbers it returns the octal equivalent with the last digit being 1 less than it should be. For 75 it returns 112 instead of 113. I realize using printf with %o gets the job done but it's kind of defeating the purpose of learning to program. Here's my code: #include <stdio.h> #include <math.h> /* converting decimal to octal */ int main() { int n,x,y,p,s; printf("Enter a decimal number "); scanf("%d",&x); s=0;p=0; while (x!=0) { y=x%8; s=s+y*pow(10,p); x=(x-y)/8; p=p+1; } printf("the octal equivalent is: %d\n",s); getch(); return 0; }

    Read the article

  • Windows Phone - failing to get a string from a website with login information

    - by jumantyn
    I am new to accessing web services with Windows Phone 7/8. I'm using a WebClient to get a string from a php-website. The site returns a JSON string but at the moment I'm just trying to put it into a TextBox as a normal string just to test if the connection works. The php-page requires an authentication and I think that's where my code is failing. Here's my code: WebClient client = new WebClient(); client.Credentials = new NetworkCredential("myUsername", "myPassword"); client.DownloadStringCompleted += new DownloadStringCompletedEventHandler(client_DownloadStringCompleted); client.DownloadStringAsync(new Uri("https://www.mywebsite.com/ba/php/jsonstuff.php")); void client_DownloadStringCompleted(object sender, DownloadStringCompletedEventArgs e) { try { string data = e.Result; this.jsonText.Text = data; } catch (Exception ex) { System.Diagnostics.Debug.WriteLine(ex.Message); } } This returns first a WebException and then a TargetInvocationException. If I replace the Uri with for example "http://www.google.com/index.html" the jsonText TextBox gets filled with html text from Google (oddly enough, this also works even when the WebClient credentials are still set). So is the problem in the setting of the credentials? I couldn't find any good results when searching for guides on how to access php-pages with credentials, only without them. Then I found a short mention somewhere to use the WebClient.Credentials property. But should it work some other way? Update: here's what I can get out of the WebException (sorry for the bad formatting): System.Net.WebException: The remote server returned an error: NotFound. ---System.Net.WebException: The remote server returned an error: NotFound. at System.Net.Browser.ClientHttpWebRequest.InternalEndGetResponse(IAsyncResult asyncResult) at System.Net.Browser.ClientHttpWebRequest.<c_DisplayClasse.b_d(Object sendState) at System.Net.Browser.AsyncHelper.<c_DisplayClass1.b_0(Object sendState) --- End of inner exception stack trace --- at System.Net.Browser.AsyncHelper.BeginOnUI(SendOrPostCallback beginMethod, Object state) at System.Net.Browser.ClientHttpWebRequest.EndGetResponse(IAsyncResult asyncResult) at System.Net.WebClient.GetWebResponse(WebRequest request, IAsyncResult result) at System.Net.WebClient.DownloadBitsResponseCallback(IAsyncResult result)

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Problem: Movie Clip contains just one frame

    - by Doug
    I'm a newbie at Flash, so started playing with a pretty standard code sample: one layer contains a movie clip with a flying rectangle, another layer has a button to control it. All script code is in Main.as file. The rectangle was named square1 through the Property window. Here is the problem: the constructor for Main has a line: square1.stop(); to prevent clip from playing, but it doesn't help - it plays. I know the constructor fires, because it has trace("stuff") in it. The code does check that the stage has been created. What strange is that square1.currentFrame always returns 1, and square1.totalFrames returns 1 as well. The layer has 24 frames on the timeline. I tried a tween with just 2 keyframes, then converted whole tween into frames - same result. I mean, the thing is flying before my eyes, how can it be 1 frame??? I even added a listener: square1.addEventListener(Event.ENTER_FRAME, onFrameChange); The event fires all the time, i.e. the frames change, but currentFrame is still 1. Also, tried to name individual frames and use square1.gotoAndStop("begin") and stuff like that. Nothing helps. I am really stuck with this stupid problem.

    Read the article

  • Rails: RESTful Find, Initialize, or Create

    - by Andrew
    I have an app that has Cities in it. I'm looking for some suggestions on how to RESTfully structure a controller so that I can lookup, initialize, and create city records via AJAX requests. For instance: Given a text field city_name A user enters the name of a City, like "Paris, France" The app checks this location to see if there is such a city in the database already If there is, it returns the city object If there is not, it returns a new record initialized with the name "Paris" and the country "France", and prompts the user to confirm they want to add this city to the database If the user says "Yes" the record is saved. If not the record is discarded and the form is cleared. Now, my first approach was to change the Create action to use find_or_create, so that an AJAX post to cities_path would result in either returning the existing city or creating it and returning it. That works ok... However, it would be better to setup controller actions that would take a string input, find , or else initialize and return, then only create if the user confirms the generated record is correct. The ideal scenario would put this all in one action so AJAX request can go to that url, the server responds with JSON objects, and javascript can handle things from there. I'd like to keep all the user-interaction logic client side, and also minimize the number of requests it takes to achieve this. Any suggestions on the cleanest, most RESTful way to accomplish this?

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • Doxygen including methods twice doc files

    - by Maarek
    I'm having this issue where doxygen is adding the method twice in the documentation file. Is there a setting that stops auto-generation of documentation for methods within the .m file. For example in the documentation I'll see something like whats below where the first definition of + (Status *)registerUser is from the header XXXXXX.h file where the second is from XXXXXX.m. Header documentation : /** @brief Test Yada Yada @return <#(description)#> */ + (Status *)registerUser; Output: + (Status *) registerUser Test Yada Yada. Returns: <#(description)#> + (Status *) registerUser <#(brief description)#> <#(comprehensive description)#> registerUser Returns: <#(description)#> Definition at line 24 of file XXXXXX.m. Here are the build related configuration options. I've tried playing with them. EXTRACT_ALL with YES and NO... Hiding uncodumented Members and Classes. #--------------------------------------------------------------------------- # Build related configuration options #--------------------------------------------------------------------------- EXTRACT_ALL = NO EXTRACT_PRIVATE = NO EXTRACT_STATIC = NO EXTRACT_LOCAL_CLASSES = YES EXTRACT_LOCAL_METHODS = NO EXTRACT_ANON_NSPACES = NO HIDE_UNDOC_MEMBERS = YES HIDE_UNDOC_CLASSES = YES HIDE_FRIEND_COMPOUNDS = NO HIDE_IN_BODY_DOCS = NO INTERNAL_DOCS = NO CASE_SENSE_NAMES = NO HIDE_SCOPE_NAMES = NO SHOW_INCLUDE_FILES = YES FORCE_LOCAL_INCLUDES = NO INLINE_INFO = YES SORT_MEMBER_DOCS = YES SORT_BRIEF_DOCS = NO SORT_MEMBERS_CTORS_1ST = NO SORT_GROUP_NAMES = NO SORT_BY_SCOPE_NAME = NO

    Read the article

  • Is it possible to return a list of numbers from a Sybase function?

    - by ps_rs4
    I'm trying to overcome a very serious performance issue in which Sybase refuses to use the primary key index on a large table because one of the required fields is specified indirectly through another table - or, in other words; SELECT ... FROM BIGTABLE WHERE KFIELD = 123 runs in ms but SELECT ... FROM BIGTABLE, LTLTBL WHERE KFIELD = LTLTBL.LOOKUP AND LTLTBL.UNIQUEID = 'STRINGREPOF123' takes 30 - 40 seconds. I've managed to work around this first problem by using a function that basically lets me do this; SELECT ... FROM BIGTABLE WHERE KFIELD = MYFUNC('STRINGREPOF123') which also runs in ms. The problem, however, is that this approach only works when there is a single value returned by MYFUNCT but I have some cases where it may return 2 or 3 values. I know that the SQL SELECT ... FROM BIGTABLE WHERE KFIELD IN (123,456,789) also returns in millis so I'd like to have a function that returns a list of possible values rather than just a single one - is this possible? Sadly the application is running on Sybase ASA 9. Yes I know it is old and is scheduled to be refreshed but there's nothing I can do about it now so I need logic that will work with this version of the DB. Thanks in advance for any assistance on this matter.

    Read the article

  • Scheme Function to reverse elements of list of 2-list

    - by sudhirc
    This is an exercise from EOPL. Procedure (invert lst) takes lst which is a list of 2-lists and returns a list with each 2-list reversed. (define invert (lambda (lst) (cond((null? lst ) '()) ((= 2 (rtn-len (car lst))) ( cons(swap-elem (car lst)) (invert (cdr lst)))) ("List is not a 2-List")))) ;; Auxiliry Procedure swap-elements of 2 element list (define swap-elem (lambda (lst) (cons (car (cdr lst)) (car lst)))) ;; returns lengh of the list by calling (define rtn-len (lambda (lst) (calc-len lst 0))) ;; calculate length of the list (define calc-len (lambda (lst n) (if (null? lst) n (calc-len (cdr lst) (+ n 1))))) This seems to work however looks very verbose. Can this be shortened or written in more elegant way ? How I can halt the processing in any of the individual element is not a 2-list? At the moment execution proceed to next member and replacing current member with "List is not a 2-List" if current member is not a 2-list.

    Read the article

  • Defining and using controller methods in ember.js

    - by OriginalEXE
    first of all, I am total noob when it comes to OOP in JS, this is new to me so treat me like a noob. I am building my first ember.js application and I am stuck (not the first time but I would get unstuck by myself, this is a tough one though). I have two models: forms entries Entries is of course in (one to many) relationship to forms, so each form can have as many properties. Form properties: id : DS.attr( 'number' ), title : DS.attr( 'string' ), views : DS.attr( 'number' ), conversion : DS.attr( 'number' ), entries : DS.hasMany( 'entry' ) Entry properties: id : DS.attr( 'number' ), parent_id: DS.belongsTo( 'form' ) Now, I have forms route that displays all forms in tabled view, and each table row has some info like form id, name etc. and that works great. What I wanted to do is display the number of entries each form has. I figured I should do that via controller, so here is my controller now: // Form controller App.FormController = Ember.ObjectController.extend({ entriescount: function() { var entries = this.get( 'store').find( 'entry' ); return entries.filterBy( 'parent_id', this.get( 'id' ) ).get( 'length' ); }.property( '[email protected]_id') }); Now for some reason, when I use {{entriescount}} in {{#each}} loop, this returns nothing. It also returns nothing in single form route. Note that in both cases, {{title}} for example works. I am wondering, am I going the right way by using controller for this, and how do I get controller to output the data. Thanks

    Read the article

  • How to support comparisons for QVariant objects containing a custom type?

    - by Tyler McHenry
    According to the Qt documentation, QVariant::operator== does not work as one might expect if the variant contains a custom type: bool QVariant::operator== ( const QVariant & v ) const Compares this QVariant with v and returns true if they are equal; otherwise returns false. In the case of custom types, their equalness operators are not called. Instead the values' addresses are compared. How are you supposed to get this to behave meaningfully for your custom types? In my case, I'm storing an enumerated value in a QVariant, e.g. In a header: enum MyEnum { Foo, Bar }; Q_DECLARE_METATYPE(MyEnum); Somewhere in a function: QVariant var1 = QVariant::fromValue<MyEnum>(Foo); QVariant var2 = QVariant::fromValue<MyEnum>(Foo); assert(var1 == var2); // Fails! What do I need to do differently in order for this assertion to be true? I understand why it's not working -- each variant is storing a separate copy of the enumerated value, so they have different addresses. I want to know how I can change my approach to storing these values in variants so that either this is not an issue, or so that they do both reference the same underlying variable. It don't think it's possible for me to get around needing equality comparisons to work. The context is that I am using this enumeration as the UserData in items in a QComboBox and I want to be able to use QComboBox::findData to locate the item index corresponding to a particular enumerated value.

    Read the article

  • Paginating requests to an API

    - by user332912
    I'm consuming (via urllib/urllib2) an API that returns XML results. The API always returns the total_hit_count for my query, but only allows me to retrieve results in batches of, say, 100 or 1000. The API stipulates I need to specify a start_pos and end_pos for offsetting this, in order to walk through the results. Say the urllib request looks like "http://someservice?query='test'&start_pos=X&end_pos=Y". If I send an initial 'taster' query with lowest data transfer such as http://someservice?query='test'&start_pos=1&end_pos=1 in order to get back a result of, for conjecture, total_hits = 1234, I'd like to work out an approach to most cleanly request those 1234 results in batches of, again say, 100 or 1000 or... This is what I came up with so far, and it seems to work, but I'd like to know if you would have done things differently or if I could improve upon this: hits_per_page=1000 # or 1000 or 200 or whatever, adjustable total_hits = 1234 # retreived with BSoup from 'taster query' base_url = "http://someservice?query='test'" startdoc_positions = [n for n in range(1, total_hits, hits_per_page)] enddoc_positions = [startdoc_position + hits_per_page - 1 for startdoc_position in startdoc_positions] for start, end in zip(startdoc_positions, enddoc_positions): if end total_hits: end = total_hits print "url to request is:\n ", print "%s&start_pos=%s&end_pos=%s" % (base_url, start, end) p.s. I'm a long time consumer of StackOverflow, especially the Python questions, but this is my first question posted. You guys are just brilliant.

    Read the article

< Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >