Search Results

Search found 10863 results on 435 pages for 'no refunds no returns'.

Page 96/435 | < Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >

  • Algorithm complexity question

    - by Itsik
    During a recent job interview, I was asked to give a solution to the following problem: Given a string s (without spaces) and a dictionary, return the words in the dictionary that compose the string. For example, s= peachpie, dic= {peach, pie}, result={peach, pie}. I will ask the the decision variation of this problem: if s can be composed of words in the dictionary return yes, otherwise return no. My solution to this was in backtracking (written in Java) public static boolean words(String s, Set<String> dictionary) { if ("".equals(s)) return true; for (int i=0; i <= s.length(); i++) { String pre = prefix(s,i); // returns s[0..i-1] String suf = suffix(s,i); // returns s[i..s.len] if (dictionary.contains(pre) && words(suf, dictionary)) return true; } return false; } public static void main(String[] args) { Set<String> dic = new HashSet<String>(); dic.add("peach"); dic.add("pie"); dic.add("1"); System.out.println(words("peachpie1", dic)); // true System.out.println(words("peachpie2", dic)); // false } What is the time complexity of this solution? I'm calling recursively in the for loop, but only for the prefix's that are in the dictionary. Any idea's?

    Read the article

  • Pagination in a Rich Domain Model

    - by user246790
    I use rich domain model in my app. The basic ideas were taken there. For example I have User and Comment entities. They are defined as following: <?php class Model_User extends Model_Abstract { public function getComments() { /** * @var Model_Mapper_Db_Comment */ $mapper = $this->getMapper(); $commentsBlob = $mapper->getUserComments($this->getId()); return new Model_Collection_Comments($commentsBlob); } } class Model_Mapper_Db_Comment extends Model_Mapper_Db_Abstract { const TABLE_NAME = 'comments'; protected $_mapperTableName = self::TABLE_NAME; public function getUserComments($user_id) { $commentsBlob = $this->_getTable()->fetchAllByUserId((int)$user_id); return $commentsBlob->toArray(); } } class Model_Comment extends Model_Abstract { } ?> Mapper's getUserComments function simply returns something like: return $this->getTable->fetchAllByUserId($user_id) which is array. fetchAllByUserId accepts $count and $offset params, but I don't know to pass them from my Controller to this function through model without rewriting all the model code. So the question is how can I organize pagination through model data (getComments). Is there a "beatiful" method to get comments from 5 to 10, not all, as getComments returns by default.

    Read the article

  • Rails: RESTful Find, Initialize, or Create

    - by Andrew
    I have an app that has Cities in it. I'm looking for some suggestions on how to RESTfully structure a controller so that I can lookup, initialize, and create city records via AJAX requests. For instance: Given a text field city_name A user enters the name of a City, like "Paris, France" The app checks this location to see if there is such a city in the database already If there is, it returns the city object If there is not, it returns a new record initialized with the name "Paris" and the country "France", and prompts the user to confirm they want to add this city to the database If the user says "Yes" the record is saved. If not the record is discarded and the form is cleared. Now, my first approach was to change the Create action to use find_or_create, so that an AJAX post to cities_path would result in either returning the existing city or creating it and returning it. That works ok... However, it would be better to setup controller actions that would take a string input, find , or else initialize and return, then only create if the user confirms the generated record is correct. The ideal scenario would put this all in one action so AJAX request can go to that url, the server responds with JSON objects, and javascript can handle things from there. I'd like to keep all the user-interaction logic client side, and also minimize the number of requests it takes to achieve this. Any suggestions on the cleanest, most RESTful way to accomplish this?

    Read the article

  • Get the src part of a string [duplicate]

    - by Kay Lakeman
    This question already has an answer here: Grabbing the href attribute of an A element 7 answers First post ever here, and i really hope you can help. I use a database where a large piece of html is stored, now i just need the src part of the image tag. I already found a thread, but i just doesn't do the trick. My code: Original string: <p><img alt=\"\" src=\"http://domain.nl/cms/ckeditor/filemanager/userfiles/background.png\" style=\"width: 80px; height: 160px;\" /></p> How i start: $image = strip_tags($row['information'], '<img>'); echo stripslashes($image); This returns: <img alt="" src="http://domain.nl/cms/ckeditor/filemanager/userfiles/background.png" style="width: 80px; height: 160px;" /> Next step: extract the src part: preg_match('/< *img[^>]*src *= *["\']?([^"\']*)/i', $image, $matches); echo $matches ; This last echo returns: Array What is going wrong? Thanks in advance for your anwser.

    Read the article

  • JS: Storing dynamic variables across pages?

    - by user2467599
    I've been looking into local storage options and plugins like Persist.js, sessvars.js, and even sisyphus.js - but I am unsure if any are the best fit (though I'm fairly certain I need to use one). Page one is a form with input fields for data like names, phones, and email. I have a button that replicates a wrapper div (and it's inputs) as long as more inputs are needed. When the form is filled the user hits submit which takes them to a 'confirmation' type php page. I need to the give the user an 'edit' button on page 2 that takes them back to page 1 and leaves all the info alone. For the most part everything returns fine, but if the user had hit the 'replicate' button before submission, and then hits edit afterwards, all the inputs that were dynamically generated return empty and the div no longer exists. Someone suggested that my variables are not persistent (when the replicate button is hit, input with an id="name1" becomes "name2" and so on) so that's when I found out about the plugins mentioned before. Is there a way that I can implement one of those plugins (or any other method) so that when the user returns to page one the div and it's input values remain unchanged? And if I'm on the right track are there any examples?

    Read the article

  • Problems with Threading in Python 2.5, KeyError: 51, Help debugging?

    - by vignesh-k
    I have a python script which runs a particular script large number of times (for monte carlo purpose) and the way I have scripted it is that, I queue up the script the desired number of times it should be run then I spawn threads and each thread runs the script once and again when its done. Once the script in a particular thread is finished, the output is written to a file by accessing a lock (so my guess was that only one thread accesses the lock at a given time). Once the lock is released by one thread, the next thread accesses it and adds its output to the previously written file and rewrites it. I am not facing a problem when the number of iterations is small like 10 or 20 but when its large like 50 or 150, python returns a KeyError: 51 telling me element doesn't exist and the error it points out to is within the lock which puzzles me since only one thread should access the lock at once and I do not expect an error. This is the class I use: class errorclass(threading.Thread): def __init__(self, queue): self.__queue=queue threading.Thread.__init__(self) def run(self): while 1: item = self.__queue.get() if item is None: break result = myfunction() lock = threading.RLock() lock.acquire() ADD entries from current thread to entries in file and REWRITE FILE lock.release() queue = Queue.Queue() for i in range(threads): errorclass(queue).start() for i in range(desired iterations): queue.put(i) for i in range(threads): queue.put(None) Python returns with KeyError: 51 for large number of desired iterations during the adding/write file operation after lock access, I am wondering if this is the correct way to use the lock since every thread has a lock operation rather than every thread accessing a shared lock? What would be the way to rectify this?

    Read the article

  • Hang during databinding of large amount of data to WPF DataGrid

    - by nihi_l_ist
    Im using WPFToolkit datagrid control and do the binding in such way: <WpfToolkit:DataGrid x:Name="dgGeneral" SelectionMode="Single" SelectionUnit="FullRow" AutoGenerateColumns="False" CanUserAddRows="False" CanUserDeleteRows="False" Grid.Row="1" ItemsSource="{Binding Path=Conversations}" > public List<CONVERSATION> Conversations { get { return conversations; } set { if (conversations != value) { conversations = value; NotifyPropertyChanged("Conversations"); } } } public event PropertyChangedEventHandler PropertyChanged; public void NotifyPropertyChanged(string propertyName) { if (PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } public void GenerateData() { BackgroundWorker bw = new BackgroundWorker(); bw.WorkerSupportsCancellation = bw.WorkerReportsProgress = true; List<CONVERSATION> list = new List<CONVERSATION>(); bw.DoWork += delegate { list = RefreshGeneralData(); }; bw.RunWorkerCompleted += delegate { try { Conversations = list; } catch (Exception ex) { CustomException.ExceptionLogCustomMessage(ex); } }; bw.RunWorkerAsync(); } And than in the main window i call GenerateData() after setting DataCotext of the window to instance of the class, containing GenerateData(). RefreshGeneralData() returns some list of data i want and it returns it fast. Overall there are near 2000 records and 6 columns(im not posting the code i used during grid's initialization, because i dont think it can be the reason) and the grid hangs for almost 10 secs!

    Read the article

  • Defining and using controller methods in ember.js

    - by OriginalEXE
    first of all, I am total noob when it comes to OOP in JS, this is new to me so treat me like a noob. I am building my first ember.js application and I am stuck (not the first time but I would get unstuck by myself, this is a tough one though). I have two models: forms entries Entries is of course in (one to many) relationship to forms, so each form can have as many properties. Form properties: id : DS.attr( 'number' ), title : DS.attr( 'string' ), views : DS.attr( 'number' ), conversion : DS.attr( 'number' ), entries : DS.hasMany( 'entry' ) Entry properties: id : DS.attr( 'number' ), parent_id: DS.belongsTo( 'form' ) Now, I have forms route that displays all forms in tabled view, and each table row has some info like form id, name etc. and that works great. What I wanted to do is display the number of entries each form has. I figured I should do that via controller, so here is my controller now: // Form controller App.FormController = Ember.ObjectController.extend({ entriescount: function() { var entries = this.get( 'store').find( 'entry' ); return entries.filterBy( 'parent_id', this.get( 'id' ) ).get( 'length' ); }.property( '[email protected]_id') }); Now for some reason, when I use {{entriescount}} in {{#each}} loop, this returns nothing. It also returns nothing in single form route. Note that in both cases, {{title}} for example works. I am wondering, am I going the right way by using controller for this, and how do I get controller to output the data. Thanks

    Read the article

  • using yield in C# like I would in Ruby

    - by Sarah Vessels
    Besides just using yield for iterators in Ruby, I also use it to pass control briefly back to the caller before resuming control in the called method. What I want to do in C# is similar. In a test class, I want to get a connection instance, create another variable instance that uses that connection, then pass the variable to the calling method so it can be fiddled with. I then want control to return to the called method so that the connection can be disposed. I guess I'm wanting a block/closure like in Ruby. Here's the general idea: private static MyThing getThing() { using (var connection = new Connection()) { yield return new MyThing(connection); } } [TestMethod] public void MyTest1() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } [TestMethod] public void MyTest2() { // call getThing(), use yielded MyThing, control returns to getThing() // for disposal } ... This doesn't work in C#; ReSharper tells me that the body of getThing cannot be an iterator block because MyThing is not an iterator interface type. That's definitely true, but I don't want to iterate through some list. I'm guessing I shouldn't use yield if I'm not working with iterators. Any idea how I can achieve this block/closure thing in C# so I don't have to wrap my code in MyTest1, MyTest2, ... with the code in getThing()'s body?

    Read the article

  • Any suggestions to improve my PDO connection class?

    - by Scarface
    Hey guys I am pretty new to pdo so I basically just put together a simple connection class using information out of the introductory book I was reading but is this connection efficient? If anyone has any informative suggestions, I would really appreciate it. class PDOConnectionFactory{ public $con = null; // swich database? public $dbType = "mysql"; // connection parameters public $host = "localhost"; public $user = "user"; public $senha = "password"; public $db = "database"; public $persistent = false; // new PDOConnectionFactory( true ) <--- persistent connection // new PDOConnectionFactory() <--- no persistent connection public function PDOConnectionFactory( $persistent=false ){ // it verifies the persistence of the connection if( $persistent != false){ $this->persistent = true; } } public function getConnection(){ try{ $this->con = new PDO($this->dbType.":host=".$this->host.";dbname=".$this->db, $this->user, $this->senha, array( PDO::ATTR_PERSISTENT => $this->persistent ) ); // carried through successfully, it returns connected return $this->con; // in case that an error occurs, it returns the error; }catch ( PDOException $ex ){ echo "We are currently experiencing technical difficulties. We have a bunch of monkies working really hard to fix the problem. Check back soon: ".$ex->getMessage(); } } // close connection public function Close(){ if( $this->con != null ) $this->con = null; } }

    Read the article

  • iBatis not populating object when there are no rows found.

    - by Omnipresent
    I am running a stored procedure that returns 2 cursors and none of them have any data. I have the following mapping xml: <resultMap id="resultMap1" class="HashMap"> <result property="firstName" columnIndex="2"/> </resultMap> <resultMap id="resultMap2" class="com.somePackage.MyBean"> <result property="unitStreetName" column="street_name"/> </resultMap> <parameterMap id="parmmap" class="map"> <parameter property="id" jdbcType="String" javaType="java.lang.String" mode="IN"/> <parameter property="Result0" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap1"/> <parameter property="Result1" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap2"/> </parameterMap> <procedure id="proc" parameterMap="parmmap"> { call my_sp (?,?,?) } </procedure> First result set is being put in a HashMap...second resultSet is being put in a MyBean class. code in my DAO follows: HashMap map = new HashMap() map.put("id", "1234"); getSqlMapClientTemplate().queryForList("mymap.proc", map); HashMap result1 = (HashMap)((List)parmMap.get("Result0")).get(0); MyBean myObject = (MyBean)((List)parmMap.get("Result1")).get(0);//code fails here in the last line above..my code fails. It fails because second cursor has no rows and thats why nothing is put into the list. However, first cursor returns nothing as well but since results are being put into a HashMap the list for first cursor atleast has HashMap object inside it.. Why this difference? is there a way to make iBatis put an object of MyBean inside the list even if there are no rows returned? Or should I be handling this in my DAO...I want to avoid handling it in the DAO because I have whole bunch of DAO's like these.

    Read the article

  • Convert enumeration to string

    - by emptyheaded
    I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

    Read the article

  • assembling an object graph without an ORM -- in the service layer or data layer?

    - by Hans Gruber
    At my current gig, our persistence layer uses IBatis going against SQL Server stored procedures (puke). IMHO, this approach has many disadvantages over the use of a "true" ORM such NHibernate or EF, but the one I'm trying to address here revolves around all the boilerplate code needed to map data from a result set into an object graph. Say I have the following DTO object graph I want to return to my presentation layer: IEnumerable<CustomerDTO> |--> IEnumerable<AddressDTO> |--> LatestOrderDTO The way I've implemented this is to have a discrete method in my DAO class to return each IEnumerable<*DTO>, and then have my service class be responsible for orchestrating the calls to the DAO. It then returns the fully assembled object graph to the client: public class SomeService(){ public SomeService(IDao someDao){ this._someDao = someDao; } public IEnumerable<CustomerDTO> ListCustomersForHistory(int brokerId){ var customers = _someDao.ListCustomersForBroker(brokerId); foreach (customer in customers){ customer.Addresses = someDao.ListCustomersAddresses(brokerId); customer.LatestOrder = someDao.GetCustomerLatestOrder(brokerId); } } return customers; } My question is should this logic belong in the service layer or the should I make my DAO such that it instead returns the assembled object graph. If I was using NHibernate, I assume that this kind of relationship association between objects comes for "free"?

    Read the article

  • Converted PHP query to PDO and now getting no results

    - by jaw
    I had a query working just fine, but after converting it to PDO I am getting no results when I do a var_dump($row). But there are no error messages. Can anyone see what I might be doing wrong? //Here is the original query that worked fine and returned results global $wpdb; $results = $wpdb->get_results("SELECT stories.story_name, stories.category, stories.SID, wp_users.ID, wp_users.display_name FROM stories LEFT JOIN wp_users ON stories.ID=wp_users.ID where stories.active = 1"); //Here is the query in PDO form which returns no results $results = $dbh->prepare("select wp_users.ID, wp_users.display_name, stories.SID, stories.story_name, stories.category, FROM stories LEFT JOIN wp_users ON stories.ID=wp_users.ID WHERE stories.active=1"); $results->bindParam(':wp_users.ID', $user_ID, PDO::PARAM_INT); $results->bindParam(':display_name', $display_name, PDO::PARAM_STR); $results->bindParam(':stories.SID', $SID, PDO::PARAM_INT); $results->bindParam(':story_name', $story_name, PDO::PARAM_STR); $results->bindParam(':category', $category, PDO::PARAM_STR); $results->execute(); $row = $results->fetchAll(PDO::FETCH_ASSOC); //returns 0 results but should return 8 as original code above did echo var_dump($row);

    Read the article

  • Function returning a class containing a function returning a class

    - by Scott
    I'm working on an object-oriented Excel add-in to retrieve information from our ERP system's database. Here is an example of a function call: itemDescription = Macola.Item("12345").Description Macola is an instance of a class which takes care of database access. Item() is a function of the Macola class which returns an instance of an ItemMaster class. Description() is a function of the ItemMaster class. This is all working correctly. Items can be be stored in more than one location, so my next step is to do this: quantityOnHand = Macola.Item("12345").Location("A1").QuantityOnHand Location() is a function of the ItemMaster class which returns an instance of the ItemLocation class (well, in theory anyway). QuantityOnHand() is a function of the ItemLocation class. But for some reason, the ItemLocation class is not even being intialized. Public Function Location(inventoryLocation As String) As ItemLocation Set Location = New ItemLocation Location.Item = item_no Location.Code = inventoryLocation End Function In the above sample, the variable item_no is a member variable of the ItemMaster class. Oddly enough, I can successfully instantiate the ItemLocation class outside of the ItemMaster class in a non-class module. Dim test As New ItemLocation test.Item = "12345" test.Code = "A1" quantityOnHand = test.QuantityOnHand Is there some way to make this work the way I want? I'm trying to keep the API as simple as possible. So that it only takes one line of code to retrieve a value.

    Read the article

  • Can isdigit legitimately be locale dependent in C

    - by cdev
    In the section covering setlocale, the ANSI C standard states in a footnote that the only ctype.h functions whose behaviour is not affected by the current locale are isdigit and isxdigit. The Microsoft implementation of isdigit is locale dependent because, for example, in locales using code page 1250 isdigit only returns non-zero for characters in the range 0x30 ('0') - 0x39 ('9'), whereas in locales using code page 1252 isdigit also returns non-zero for the superscript digits 0xB2 ('²'), 0xB3 ('³') and 0xB9 ('¹'). Is Microsoft in violation of the C standard by making isdigit locale dependent? In this question I am primarily interested in C90, which Microsoft claims to conform to, rather than C99. Additional background: Microsoft's own documentation of setlocale incorrectly states that isdigit is unaffected by the LC_CTYPE part of the locale. The section of the C standard that covers the ctype.h functions contains some wording that I consider ambiguous: "The behavior of these functions is affected by the current locale. Those functions that have locale-specific aspects only when not in the "C" locale are noted below." I consider this ambiguous because it is unclear what it is trying to say about functions such as isdigit for which there are no notes about locale-specific aspects. It might be trying to say that such functions must be assumed to be locale dependent, in which case Microsoft's implementation of isdigit would be OK. (Except that the footnote I mentioned earlier seems to contradict this interpretation.)

    Read the article

  • Need a refresher course on property access...

    - by Code Sherpa
    Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • How to support comparisons for QVariant objects containing a custom type?

    - by Tyler McHenry
    According to the Qt documentation, QVariant::operator== does not work as one might expect if the variant contains a custom type: bool QVariant::operator== ( const QVariant & v ) const Compares this QVariant with v and returns true if they are equal; otherwise returns false. In the case of custom types, their equalness operators are not called. Instead the values' addresses are compared. How are you supposed to get this to behave meaningfully for your custom types? In my case, I'm storing an enumerated value in a QVariant, e.g. In a header: enum MyEnum { Foo, Bar }; Q_DECLARE_METATYPE(MyEnum); Somewhere in a function: QVariant var1 = QVariant::fromValue<MyEnum>(Foo); QVariant var2 = QVariant::fromValue<MyEnum>(Foo); assert(var1 == var2); // Fails! What do I need to do differently in order for this assertion to be true? I understand why it's not working -- each variant is storing a separate copy of the enumerated value, so they have different addresses. I want to know how I can change my approach to storing these values in variants so that either this is not an issue, or so that they do both reference the same underlying variable. It don't think it's possible for me to get around needing equality comparisons to work. The context is that I am using this enumeration as the UserData in items in a QComboBox and I want to be able to use QComboBox::findData to locate the item index corresponding to a particular enumerated value.

    Read the article

  • How to test a Grails Service that utilizes a criteria query (with spock)?

    - by user569825
    I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • C++ - Basic WinAPI question

    - by HardCoder1986
    Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Doxygen including methods twice doc files

    - by Maarek
    I'm having this issue where doxygen is adding the method twice in the documentation file. Is there a setting that stops auto-generation of documentation for methods within the .m file. For example in the documentation I'll see something like whats below where the first definition of + (Status *)registerUser is from the header XXXXXX.h file where the second is from XXXXXX.m. Header documentation : /** @brief Test Yada Yada @return <#(description)#> */ + (Status *)registerUser; Output: + (Status *) registerUser Test Yada Yada. Returns: <#(description)#> + (Status *) registerUser <#(brief description)#> <#(comprehensive description)#> registerUser Returns: <#(description)#> Definition at line 24 of file XXXXXX.m. Here are the build related configuration options. I've tried playing with them. EXTRACT_ALL with YES and NO... Hiding uncodumented Members and Classes. #--------------------------------------------------------------------------- # Build related configuration options #--------------------------------------------------------------------------- EXTRACT_ALL = NO EXTRACT_PRIVATE = NO EXTRACT_STATIC = NO EXTRACT_LOCAL_CLASSES = YES EXTRACT_LOCAL_METHODS = NO EXTRACT_ANON_NSPACES = NO HIDE_UNDOC_MEMBERS = YES HIDE_UNDOC_CLASSES = YES HIDE_FRIEND_COMPOUNDS = NO HIDE_IN_BODY_DOCS = NO INTERNAL_DOCS = NO CASE_SENSE_NAMES = NO HIDE_SCOPE_NAMES = NO SHOW_INCLUDE_FILES = YES FORCE_LOCAL_INCLUDES = NO INLINE_INFO = YES SORT_MEMBER_DOCS = YES SORT_BRIEF_DOCS = NO SORT_MEMBERS_CTORS_1ST = NO SORT_GROUP_NAMES = NO SORT_BY_SCOPE_NAME = NO

    Read the article

  • How string accepting interface should look like?

    - by ybungalobill
    Hello, This is a follow up of this question. Suppose I write a C++ interface that accepts or returns a const string. I can use a const char* zero-terminated string: void f(const char* str); // (1) The other way would be to use an std::string: void f(const string& str); // (2) It's also possible to write an overload and accept both: void f(const char* str); // (3) void f(const string& str); Or even a template in conjunction with boost string algorithms: template<class Range> void f(const Range& str); // (4) My thoughts are: (1) is not C++ish and may be less efficient when subsequent operations may need to know the string length. (2) is bad because now f("long very long C string"); invokes a construction of std::string which involves a heap allocation. If f uses that string just to pass it to some low-level interface that expects a C-string (like fopen) then it is just a waste of resources. (3) causes code duplication. Although one f can call the other depending on what is the most efficient implementation. However we can't overload based on return type, like in case of std::exception::what() that returns a const char*. (4) doesn't work with separate compilation and may cause even larger code bloat. Choosing between (1) and (2) based on what's needed by the implementation is, well, leaking an implementation detail to the interface. The question is: what is the preffered way? Is there any single guideline I can follow? What's your experience?

    Read the article

< Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >