Search Results

Search found 10850 results on 434 pages for 'shihab returns'.

Page 96/434 | < Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >

• iBatis not populating object when there are no rows found.

  - by Omnipresent

  I am running a stored procedure that returns 2 cursors and none of them have any data. I have the following mapping xml: <resultMap id="resultMap1" class="HashMap"> <result property="firstName" columnIndex="2"/> </resultMap> <resultMap id="resultMap2" class="com.somePackage.MyBean"> <result property="unitStreetName" column="street_name"/> </resultMap> <parameterMap id="parmmap" class="map"> <parameter property="id" jdbcType="String" javaType="java.lang.String" mode="IN"/> <parameter property="Result0" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap1"/> <parameter property="Result1" jdbcType="ORACLECURSOR" javaType="java.sql.ResultSet" mode="OUT" resultMap="resultMap2"/> </parameterMap> <procedure id="proc" parameterMap="parmmap"> { call my_sp (?,?,?) } </procedure> First result set is being put in a HashMap...second resultSet is being put in a MyBean class. code in my DAO follows: HashMap map = new HashMap() map.put("id", "1234"); getSqlMapClientTemplate().queryForList("mymap.proc", map); HashMap result1 = (HashMap)((List)parmMap.get("Result0")).get(0); MyBean myObject = (MyBean)((List)parmMap.get("Result1")).get(0);//code fails here in the last line above..my code fails. It fails because second cursor has no rows and thats why nothing is put into the list. However, first cursor returns nothing as well but since results are being put into a HashMap the list for first cursor atleast has HashMap object inside it.. Why this difference? is there a way to make iBatis put an object of MyBean inside the list even if there are no rows returned? Or should I be handling this in my DAO...I want to avoid handling it in the DAO because I have whole bunch of DAO's like these.

  Read the article

• Any suggestions to improve my PDO connection class?

  - by Scarface

  Hey guys I am pretty new to pdo so I basically just put together a simple connection class using information out of the introductory book I was reading but is this connection efficient? If anyone has any informative suggestions, I would really appreciate it. class PDOConnectionFactory{ public $con = null; // swich database? public $dbType = "mysql"; // connection parameters public $host = "localhost"; public $user = "user"; public $senha = "password"; public $db = "database"; public $persistent = false; // new PDOConnectionFactory( true ) <--- persistent connection // new PDOConnectionFactory() <--- no persistent connection public function PDOConnectionFactory( $persistent=false ){ // it verifies the persistence of the connection if( $persistent != false){ $this->persistent = true; } } public function getConnection(){ try{ $this->con = new PDO($this->dbType.":host=".$this->host.";dbname=".$this->db, $this->user, $this->senha, array( PDO::ATTR_PERSISTENT => $this->persistent ) ); // carried through successfully, it returns connected return $this->con; // in case that an error occurs, it returns the error; }catch ( PDOException $ex ){ echo "We are currently experiencing technical difficulties. We have a bunch of monkies working really hard to fix the problem. Check back soon: ".$ex->getMessage(); } } // close connection public function Close(){ if( $this->con != null ) $this->con = null; } }

  Read the article

• is it possible to write a program which prints its own source code utilizing a "sequence-generating-

  - by guest

  is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

  Read the article

• Function returning a class containing a function returning a class

  - by Scott

  I'm working on an object-oriented Excel add-in to retrieve information from our ERP system's database. Here is an example of a function call: itemDescription = Macola.Item("12345").Description Macola is an instance of a class which takes care of database access. Item() is a function of the Macola class which returns an instance of an ItemMaster class. Description() is a function of the ItemMaster class. This is all working correctly. Items can be be stored in more than one location, so my next step is to do this: quantityOnHand = Macola.Item("12345").Location("A1").QuantityOnHand Location() is a function of the ItemMaster class which returns an instance of the ItemLocation class (well, in theory anyway). QuantityOnHand() is a function of the ItemLocation class. But for some reason, the ItemLocation class is not even being intialized. Public Function Location(inventoryLocation As String) As ItemLocation Set Location = New ItemLocation Location.Item = item_no Location.Code = inventoryLocation End Function In the above sample, the variable item_no is a member variable of the ItemMaster class. Oddly enough, I can successfully instantiate the ItemLocation class outside of the ItemMaster class in a non-class module. Dim test As New ItemLocation test.Item = "12345" test.Code = "A1" quantityOnHand = test.QuantityOnHand Is there some way to make this work the way I want? I'm trying to keep the API as simple as possible. So that it only takes one line of code to retrieve a value.

  Read the article

• Convert enumeration to string

  - by emptyheaded

  I am trying to build a function that converts an item from an enum to its corresponding string. The enums I use are fairly long, so I didn't want to use a switch-case. I found a method using boost::unordered_map very convenient, but I don't know how to make a default return (when there is no item matching the enum). const boost::unordered_map<enum_type, const std::string> enumToString = boost::assign::map_list_of (data_1, "data_1") (data_2, "data_2"); I tried to create an additional function: std::string convert(enum_type entry) { if (enumToString.find(entry)) // not sure what test to place here, return enumToString.at(entry); //because the find method returns an iter else return "invalid_value"; } I even tried something exceedingly wrong: std::string convert(enum_type entry) { try{ return enumToString.at(entry); } catch(...){ return "invalid_value"; } } Result: evil "Debug" runtime error. Can somebody give me a suggestion on how to either 1) find an easier method to convert enum to a string with the same name as the enum item 2) find a way to use already built boost methods to get a default value from a hash map (best option) 3) find what to place in the test to use a function that returns either the pair of the key-value, or a different string if the key is not found in the map. Thank you very much.

  Read the article

• Need a refresher course on property access...

  - by Code Sherpa

  Hi. I need help with accessing class properties within a given class. For example, take the below class: public partial class Account { private Profile _profile; private Email _email; private HostInfo _hostInfo; public Profile Profile { get { return _profile; } set { _profile = value; } } public Email Email { get { return _email; } set { _email = value; } } public HostInfo HostInfo { get { return _hostInfo; } set { _hostInfo = value; } } In the class "Account" exists a bunch of class properties such as Email or Profile. Now, when I want to access those properties at run-time, I do something like this (for Email): _accountRepository = ObjectFactory.GetInstance<IAccountRepository>(); string username = Cryptography.Decrypt(_webContext.UserNameToVerify, "verify"); Account account = _accountRepository.GetAccountByUserName(username); if(account != null) { account.Email.IsConfirmed = true; But, I get "Object reference not set..." for account.Email... Why is that? How do I access Account such that account.Email, account.Profile, and so on returns the correct data for a given AccountId or UserName. Here is a method that returns Account: public Account GetAccountByUserName(string userName) { Account account = null; using (MyDataContext dc = _conn.GetContext()) { try { account = (from a in dc.Accounts where a.UserName == userName select a).FirstOrDefault(); } catch { //oops } } return account; } The above works but when I try: account = (from a in dc.Accounts join em in dc.Emails on a.AccountId equals em.AccountId join p in dc.Profiles on em.AccountId equals p.AccountId where a.UserName == userName select a).FirstOrDefault(); I am still getting object reference exceptions for my Email and Profile properties. Is this simply a SQL problem or is there something else I need to be doing to be able to fully access all the properties within my Account class? Thanks!

  Read the article

• Can isdigit legitimately be locale dependent in C

  - by cdev

  In the section covering setlocale, the ANSI C standard states in a footnote that the only ctype.h functions whose behaviour is not affected by the current locale are isdigit and isxdigit. The Microsoft implementation of isdigit is locale dependent because, for example, in locales using code page 1250 isdigit only returns non-zero for characters in the range 0x30 ('0') - 0x39 ('9'), whereas in locales using code page 1252 isdigit also returns non-zero for the superscript digits 0xB2 ('²'), 0xB3 ('³') and 0xB9 ('¹'). Is Microsoft in violation of the C standard by making isdigit locale dependent? In this question I am primarily interested in C90, which Microsoft claims to conform to, rather than C99. Additional background: Microsoft's own documentation of setlocale incorrectly states that isdigit is unaffected by the LC_CTYPE part of the locale. The section of the C standard that covers the ctype.h functions contains some wording that I consider ambiguous: "The behavior of these functions is affected by the current locale. Those functions that have locale-specific aspects only when not in the "C" locale are noted below." I consider this ambiguous because it is unclear what it is trying to say about functions such as isdigit for which there are no notes about locale-specific aspects. It might be trying to say that such functions must be assumed to be locale dependent, in which case Microsoft's implementation of isdigit would be OK. (Except that the footnote I mentioned earlier seems to contradict this interpretation.)

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• C++ - Basic WinAPI question

  - by HardCoder1986

  Hello! I am now working on a some sort of a game engine and I had an idea to put everything engine-related into a static library and then link it to my actual problem. Right now I achieved it and actually link that library and every functions seem to work fine, except those, which are windows-related. I have a chunk of code in my library that looks like this: hWnd = CreateWindow(className, "Name", WS_OVERLAPPED | WS_CAPTION | WS_EX_TOPMOST, 0, 0, 800, 600, NULL, NULL, GetModuleHandle(NULL), this); if (hWnd) { ShowWindow(hWnd, SW_NORMAL); UpdateWindow(hWnd); } else { MessageBox(NULL, "Internal program error", "Error", MB_OK | MB_ICONERROR); return; } When this code was not in the library, but in the actual project, it worked fine, created the window and everything was ok. Right now (when I'm linking to my library that contains this code) CreateWindow(...) call returns NULL and GetLastError() returns "Operation succesfully completed" (wtf?). Could anybody help me with this? Is it possible to create a window and display it using a static library call and why could my code fail? Thank you.

  Read the article

• How to test a Grails Service that utilizes a criteria query (with spock)?

  - by user569825

  I am trying to test a simple service method. That method mainly just returns the results of a criteria query for which I want to test if it returns the one result or not (depending on what is queried for). The problem is, that I am unaware of how to right the corresponding test correctly. I am trying to accomplish it via spock, but doing the same with any other way of testing also fails. Can one tell me how to amend the test in order to make it work for the task at hand? (BTW I'd like to keep it a unit test, if possible.) The EventService Method public HashSet<Event> listEventsForDate(Date date, int offset, int max) { date.clearTime() def c = Event.createCriteria() def results = c { and { le("startDate", date+1) // starts tonight at midnight or prior? ge("endDate", date) // ends today or later? } maxResults(max) order("startDate", "desc") } return results } The Spock Specification package myapp import grails.plugin.spock.* import spock.lang.* class EventServiceSpec extends Specification { def event def eventService = new EventService() def setup() { event = new Event() event.publisher = Mock(User) event.title = 'et' event.urlTitle = 'ut' event.details = 'details' event.location = 'location' event.startDate = new Date(2010,11,20, 9, 0) event.endDate = new Date(2011, 3, 7,18, 0) } def "list the Events of a specific date"() { given: "An event ranging over multiple days" when: "I look up a date for its respective events" def results = eventService.listEventsForDate(searchDate, 0, 100) then: "The event is found or not - depending on the requested date" numberOfResults == results.size() where: searchDate | numberOfResults new Date(2010,10,19) | 0 // one day before startDate new Date(2010,10,20) | 1 // at startDate new Date(2010,10,21) | 1 // one day after startDate new Date(2011, 1, 1) | 1 // someday during the event range new Date(2011, 3, 6) | 1 // one day before endDate new Date(2011, 3, 7) | 1 // at endDate new Date(2011, 3, 8) | 0 // one day after endDate } } The Error groovy.lang.MissingMethodException: No signature of method: static myapp.Event.createCriteria() is applicable for argument types: () values: [] at myapp.EventService.listEventsForDate(EventService.groovy:47) at myapp.EventServiceSpec.list the Events of a specific date(EventServiceSpec.groovy:29)

  Read the article

• Doxygen including methods twice doc files

  - by Maarek

  I'm having this issue where doxygen is adding the method twice in the documentation file. Is there a setting that stops auto-generation of documentation for methods within the .m file. For example in the documentation I'll see something like whats below where the first definition of + (Status *)registerUser is from the header XXXXXX.h file where the second is from XXXXXX.m. Header documentation : /** @brief Test Yada Yada @return <#(description)#> */ + (Status *)registerUser; Output: + (Status *) registerUser Test Yada Yada. Returns: <#(description)#> + (Status *) registerUser <#(brief description)#> <#(comprehensive description)#> registerUser Returns: <#(description)#> Definition at line 24 of file XXXXXX.m. Here are the build related configuration options. I've tried playing with them. EXTRACT_ALL with YES and NO... Hiding uncodumented Members and Classes. #--------------------------------------------------------------------------- # Build related configuration options #--------------------------------------------------------------------------- EXTRACT_ALL = NO EXTRACT_PRIVATE = NO EXTRACT_STATIC = NO EXTRACT_LOCAL_CLASSES = YES EXTRACT_LOCAL_METHODS = NO EXTRACT_ANON_NSPACES = NO HIDE_UNDOC_MEMBERS = YES HIDE_UNDOC_CLASSES = YES HIDE_FRIEND_COMPOUNDS = NO HIDE_IN_BODY_DOCS = NO INTERNAL_DOCS = NO CASE_SENSE_NAMES = NO HIDE_SCOPE_NAMES = NO SHOW_INCLUDE_FILES = YES FORCE_LOCAL_INCLUDES = NO INLINE_INFO = YES SORT_MEMBER_DOCS = YES SORT_BRIEF_DOCS = NO SORT_MEMBERS_CTORS_1ST = NO SORT_GROUP_NAMES = NO SORT_BY_SCOPE_NAME = NO

  Read the article

• Haskell quiz: a simple function

  - by levy

  I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

  Read the article

• em.createQuery keeps returning null

  - by Developer106

  I have this application which i use JSF 2.0 and EclipseLink, i have entities created for a database made in MySQL, Created these entities using netbeans 7.1.2, it gets created automaticly. Then i use session beans to work with these entities, the thing is the em.createQuery always returns a null, though I checked NamedQueries in the entities and they perfectly match a sample from the entities named queries:- @NamedQueries({ @NamedQuery(name = "Users.findAll", query = "SELECT u FROM Users u"), @NamedQuery(name = "Users.findByUserId", query = "SELECT u FROM Users u WHERE u.userId = :userId"), @NamedQuery(name = "Users.findByUsername", query = "SELECT u FROM Users u WHERE u.username = :username"), @NamedQuery(name = "Users.findByEmail", query = "SELECT u FROM Users u WHERE u.email = :email"), notice how i use this findByEmail query in the session bean :- public Users findByEmail(String email){ em.getTransaction().begin(); String find = "Users.findByEmail"; Query query = em.createNamedQuery(find); query.setParameter("email", email); Users user = (Users) query.getSingleResult(); but it always returns null from this em.createNamedQuery, i tried using .createQuery first but it also was no good. the stacktrace of the exception Caused by: java.lang.NullPointerException at com.readme.entities.sessionBeans.UsersFacade.findByEmail(UsersFacade.java:48) at com.readme.user.signup.SignupBean.checkAvailability(SignupBean.java:137) at com.readme.user.signup.SignupBean.save(SignupBean.java:146) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:57) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:601) What Seems To Be The Problem Here ?

  Read the article

• Is it possible to return a list of numbers from a Sybase function?

  - by ps_rs4

  I'm trying to overcome a very serious performance issue in which Sybase refuses to use the primary key index on a large table because one of the required fields is specified indirectly through another table - or, in other words; SELECT ... FROM BIGTABLE WHERE KFIELD = 123 runs in ms but SELECT ... FROM BIGTABLE, LTLTBL WHERE KFIELD = LTLTBL.LOOKUP AND LTLTBL.UNIQUEID = 'STRINGREPOF123' takes 30 - 40 seconds. I've managed to work around this first problem by using a function that basically lets me do this; SELECT ... FROM BIGTABLE WHERE KFIELD = MYFUNC('STRINGREPOF123') which also runs in ms. The problem, however, is that this approach only works when there is a single value returned by MYFUNCT but I have some cases where it may return 2 or 3 values. I know that the SQL SELECT ... FROM BIGTABLE WHERE KFIELD IN (123,456,789) also returns in millis so I'd like to have a function that returns a list of possible values rather than just a single one - is this possible? Sadly the application is running on Sybase ASA 9. Yes I know it is old and is scheduled to be refreshed but there's nothing I can do about it now so I need logic that will work with this version of the DB. Thanks in advance for any assistance on this matter.

  Read the article

• How string accepting interface should look like?

  - by ybungalobill

  Hello, This is a follow up of this question. Suppose I write a C++ interface that accepts or returns a const string. I can use a const char* zero-terminated string: void f(const char* str); // (1) The other way would be to use an std::string: void f(const string& str); // (2) It's also possible to write an overload and accept both: void f(const char* str); // (3) void f(const string& str); Or even a template in conjunction with boost string algorithms: template<class Range> void f(const Range& str); // (4) My thoughts are: (1) is not C++ish and may be less efficient when subsequent operations may need to know the string length. (2) is bad because now f("long very long C string"); invokes a construction of std::string which involves a heap allocation. If f uses that string just to pass it to some low-level interface that expects a C-string (like fopen) then it is just a waste of resources. (3) causes code duplication. Although one f can call the other depending on what is the most efficient implementation. However we can't overload based on return type, like in case of std::exception::what() that returns a const char*. (4) doesn't work with separate compilation and may cause even larger code bloat. Choosing between (1) and (2) based on what's needed by the implementation is, well, leaking an implementation detail to the interface. The question is: what is the preffered way? Is there any single guideline I can follow? What's your experience?

  Read the article

• PDF search on the iPhone

  - by pt2ph8

  After two days trying to read annotations from a PDF using Quartz, I've managed to do it and posted my code. Now I'd like to do the same for another frequently asked question: searching PDF documents with Quartz. Same situation as before, this question has been asked many times with almost no practical answers. So I need some pointers first, as I still haven't implemented this myself. What I tried: I tried using CGPDFScannerScan handling the TJ and Tj operators - returns the right text on some PDF, whereas on other documents it returns mostly random letters. Maybe it's related to text encoding? Someone pointed out that text blocks (marked by BT/ET operators) should be handled instead, but I still haven't managed to do so. Anyone managed to extract text from any PDF? After that, searching should be easy by storing all the text in a NSMutableString and using rangeOfString (if there's a better way please let me know). But then how to highlight the result? I know there are a few operators to find the glyph sizes, so I could calculate the resulting rect based on those values, but I've been reading the spec for hours... it's a bloated mess and I'm going insane. Anyone with a practical explanation? Thanks.

  Read the article

• Delphi static method of a class returning property value

  - by mitko.berbatov

  I'm making a Delphi VCL application. There is a class TStudent where I have two static functions: one which returns last name from an array of TStudent and another one which returns the first name of the student. Their code is something like: class function TStudent.FirstNameOf(aLastName: string): string; var i : integer; begin for i := 0 to Length(studentsArray) - 1 do begin if studentsArray[i].LastName = aLastName then begin result := studentsArray[i].FirstName; Exit; end; end; result := 'no match was found'; end; class function TStudent.LastNameOf(aFirstName: string): string; var i : integer; begin for i := 0 to Length(studentsArray) - 1 do begin if studentsArray[i].FirstName = aFirstName then begin result := studentsArray[i].LastName; Exit; end; end; result := 'no match was found'; end; My question is how can I avoid writing almost same code twice. Is there any way to pass the property as parameter of the functions.

  Read the article

• How do I make a function in SQL Server that accepts a column of data?

  - by brandon k

  I made the following function in SQL Server 2008 earlier this week that takes two parameters and uses them to select a column of "detail" records and returns them as a single varchar list of comma separated values. Now that I get to thinking about it, I would like to take this table and application-specific function and make it more generic. I am not well-versed in defining SQL functions, as this is my first. How can I change this function to accept a single "column" worth of data, so that I can use it in a more generic way? Instead of calling: SELECT ejc_concatFormDetails(formuid, categoryName) I would like to make it work like: SELECT concatColumnValues(SELECT someColumn FROM SomeTable) Here is my function definition: FUNCTION [DNet].[ejc_concatFormDetails](@formuid AS int, @category as VARCHAR(75)) RETURNS VARCHAR(1000) AS BEGIN DECLARE @returnData VARCHAR(1000) DECLARE @currentData VARCHAR(75) DECLARE dataCursor CURSOR FAST_FORWARD FOR SELECT data FROM DNet.ejc_FormDetails WHERE formuid = @formuid AND category = @category SET @returnData = '' OPEN dataCursor FETCH NEXT FROM dataCursor INTO @currentData WHILE (@@FETCH_STATUS = 0) BEGIN SET @returnData = @returnData + ', ' + @currentData FETCH NEXT FROM dataCursor INTO @currentData END CLOSE dataCursor DEALLOCATE dataCursor RETURN SUBSTRING(@returnData,3,1000) END As you can see, I am selecting the column data within my function and then looping over the results with a cursor to build my comma separated varchar. How can I alter this to accept a single parameter that is a result set and then access that result set with a cursor?

  Read the article

• Scheme Function to reverse elements of list of 2-list

  - by sudhirc

  This is an exercise from EOPL. Procedure (invert lst) takes lst which is a list of 2-lists and returns a list with each 2-list reversed. (define invert (lambda (lst) (cond((null? lst ) '()) ((= 2 (rtn-len (car lst))) ( cons(swap-elem (car lst)) (invert (cdr lst)))) ("List is not a 2-List")))) ;; Auxiliry Procedure swap-elements of 2 element list (define swap-elem (lambda (lst) (cons (car (cdr lst)) (car lst)))) ;; returns lengh of the list by calling (define rtn-len (lambda (lst) (calc-len lst 0))) ;; calculate length of the list (define calc-len (lambda (lst n) (if (null? lst) n (calc-len (cdr lst) (+ n 1))))) This seems to work however looks very verbose. Can this be shortened or written in more elegant way ? How I can halt the processing in any of the individual element is not a 2-list? At the moment execution proceed to next member and replacing current member with "List is not a 2-List" if current member is not a 2-list.

  Read the article

• Finding and marking the largest of three values in a two dimensional array

  - by DavidYell

  I am working on a display screen for our office, and I can't seem to think of a good way to find the largest numerical value in a set of data in a two dimensional array. I've looked at using max() and also asort() but they don't seem to cope with a two dimensional array. I'm returning my data through our mysql class, so the rows are returned in a two dimensional array. Array( [0] => Array( [am] => 12, [sales] => 981), [1] => Array( [am] => 43, [sales] => 1012), [2] => Array( [am] => 17, [sales] => 876) ) I need to output a class when foreaching the data in my table for the AM with the highest sales value. Short of comparing them all in if statements. I have tried to get max() on the array, but it returns an array, as it's look within the dimension. When pointing it at a specific dimension it returns the key not the value. I figured that I could asort() the array and pop the top value off, store it in a variable and then compare against that in my foreach() loop, but that seems to have trouble sorting across two dimensions. Lastly, I figured that I could foreach() the values, comparing them against the previous one each time, untill I found the largest. This approach however means storing every value, luckily only three, but then comparing against them all again. Surely there must be a simpler way to achieve this, short of converting it into a single dimension array, then doing an asort() on that?

  Read the article

• Problem: Movie Clip contains just one frame

  - by Doug

  I'm a newbie at Flash, so started playing with a pretty standard code sample: one layer contains a movie clip with a flying rectangle, another layer has a button to control it. All script code is in Main.as file. The rectangle was named square1 through the Property window. Here is the problem: the constructor for Main has a line: square1.stop(); to prevent clip from playing, but it doesn't help - it plays. I know the constructor fires, because it has trace("stuff") in it. The code does check that the stage has been created. What strange is that square1.currentFrame always returns 1, and square1.totalFrames returns 1 as well. The layer has 24 frames on the timeline. I tried a tween with just 2 keyframes, then converted whole tween into frames - same result. I mean, the thing is flying before my eyes, how can it be 1 frame??? I even added a listener: square1.addEventListener(Event.ENTER_FRAME, onFrameChange); The event fires all the time, i.e. the frames change, but currentFrame is still 1. Also, tried to name individual frames and use square1.gotoAndStop("begin") and stuff like that. Nothing helps. I am really stuck with this stupid problem.

  Read the article

• Session does not giving right records?

  - by Jugal

  I want to keep one session, but when I rollback transaction then transaction gets isActive=false, so I can not commit and rollback in next statements by using same transaction. then I need to create new transaction but what is going wrong here ? var session = NHibernateHelper.OpenSession();/* It returns new session. */ var transaction1 = session.BeginTransaction(); var list1 = session.Query<Make>().ToList(); /* It returs 4 records. */ session.Delete(list1[2]); /* After Rollback, transaction is isActive=false so I can not commit * and rollback from this transaction in future. so I need to create new transaction. */ transaction1.Rollback(); var transaction2 = session.BeginTransaction(); /* It returns 3 records. * I am not getting object(which was deleted but after that rollback) here why ? */ var list2 = session.Query<Make>().ToList(); Anyone have idea what is going wrong here ? I am not getting deleted object which was rollback.

  Read the article

• Array of Arrays - writing to File problem

  - by iFloh

  Hi, and again my array of arrays ... I try to improve my app performance by buffering arrays on file for later reuse. I have an NSMutableArray that contains about 30 NSMutableArrays with NSNumber, NSDate and NSString Objects. I try to write the file using this call: bool result = [myArray writeToFile:[fileMethods getFullPath:[NSString stringWithFormat:@"iEts%@.arr", [aDate shortDateString]]] atomically:NO]; = result = FALSE. The Path method is: + (NSString *) getFullPath:(NSString *)forFileName { NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectory = [paths objectAtIndex:0]; return [documentsDirectory stringByAppendingPathComponent:forFileName]; } and the aDate call returns a shortDateString with ddMMyy. The NSLog NSLog(@"%@", [fileMethods getFullPath:[NSString stringWithFormat:@"iEts%@.arr", [aDate shortDateString]]]); on the path generation returns: /Users/me/Library/Application Support/iPhone Simulator/User/Applications/86729620-EC1D-4C10-A799-0C638BB27933/Documents/iEts010510.arr FURTHER: It must have something to do with the Array of Arrays, since I also write 3 further simple arrays (containing NSStrings) that all succeed. The Array of Arrays gets generated using the addObject method Any ideas what could cause the trouble?

  Read the article

• Retain numerical precision in an R data frame?

  - by David

  When I create a dataframe from numeric vectors, R seems to truncate the value below the precision that I require in my analysis: data.frame(x=0.99999996) returns 1 (see update 1) I am stuck when fitting spline(x,y) and two of the x values are set to 1 due to rounding while y changes. I could hack around this but I would prefer to use a standard solution if available. example Here is an example data set d <- data.frame(x = c(0.668732936336141, 0.95351462456867, 0.994620622127435, 0.999602102672081, 0.999987126195509, 0.999999955814133, 0.999999999999966), y = c(38.3026509783688, 11.5895099585560, 10.0443344234229, 9.86152339768516, 9.84461434575695, 9.81648333804257, 9.83306725758297)) The following solution works, but I would prefer something that is less subjective: plot(d$x, d$y, ylim=c(0,50)) lines(spline(d$x, d$y),col='grey') #bad fit lines(spline(d[-c(4:6),]$x, d[-c(4:6),]$y),col='red') #reasonable fit Update 1 Since posting this question, I realize that this will return 1 even though the data frame still contains the original value, e.g. > dput(data.frame(x=0.99999999996)) returns structure(list(x = 0.99999999996), .Names = "x", row.names = c(NA, -1L), class = "data.frame") Update 2 After using dput to post this example data set, and some pointers from Dirk, I can see that the problem is not in the truncation of the x values but the limits of the numerical errors in the model that I have used to calculate y. This justifies dropping a few of the equivalent data points (as in the example red line).

  Read the article

• Algorithm to determine indices i..j of array A containing all the elements of another array B

  - by Skylark

  I came across this question on an interview questions thread. Here is the question: Given two integer arrays A [1..n] and B[1..m], find the smallest window in A that contains all elements of B. In other words, find a pair < i , j such that A[i..j] contains B[1..m]. If A doesn't contain all the elements of B, then i,j can be returned as -1. The integers in A need not be in the same order as they are in B. If there are more than one smallest window (different, but have the same size), then its enough to return one of them. Example: A[1,2,5,11,2,6,8,24,101,17,8] and B[5,2,11,8,17]. The algorithm should return i = 2 (index of 5 in A) and j = 9 (index of 17 in A). Now I can think of two variations. Let's suppose that B has duplicates. This variation doesn't consider the number of times each element occurs in B. It just checks for all the unique elements that occur in B and finds the smallest corresponding window in A that satisfies the above problem. For example, if A[1,2,4,5,7] and B[2,2,5], this variation doesn't bother about there being two 2's in B and just checks A for the unique integers in B namely 2 and 5 and hence returns i=1, j=3. This variation accounts for duplicates in B. If there are two 2's in B, then it expects to see at least two 2's in A as well. If not, it returns -1,-1. When you answer, please do let me know which variation you are answering. Pseudocode should do. Please mention space and time complexity if it is tricky to calculate it. Mention if your solution assumes array indices to start at 1 or 0 too. Thanks in advance.

  Read the article

< Previous Page | 92 93 94 95 96 97 98 99 100 101 102 103  | Next Page >