Search Results

Search found 15389 results on 616 pages for 'external js'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 97/616 | < Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • image with external interface

    - by Leo
    I need to send a picture to flash with external interface (as3)... can not be an url because don't have connection... I'm trying open the image file and send to flash like text but without success any idea?

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • Alligator tags(<% %>) inside js string?

    - by bangoker
    I am trying to redirect a page reading the url from the config file. However, when I try this: <script type="text/javascript"> <%string redirectUrl = System.Web.Configuration.WebConfigurationManager.AppSettings["RedirectURL"];%> window.parent.location.replace("<%=redirectUrl%>"); </script> the alligator tags <% % are Not being highlighted, and when I run I get the following error in the yellow screen: the controls collection cannot be modified because the control contains code blocks (i.e. <% ... %>). What am I doing wrong?? Thanks!

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • With JS add default date on TextBox

    - by senzacionale
    <asp:TextBox ID="txtDate" runat="server" AutoPostBack="true" OnTextChanged="txtDate_TextChanged"></asp:TextBox> how can with Jquery add default date. I do not know where and when to call this code: function addDefaultDate() { if ($('#txtDate').val().length == 0) { var now = new Date(); $('#txtDate').text(now.getDate() + '.' + now.getMonth() + '.' + now.getYear()); } }

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • ReSharper 5 external sources in a .NET 4.0 project

    - by RasmusKL
    I've read about the ReSharper external sources feature in ReSharper 5. But when attempting to use it on a .NET 4.0 project, but my attempts to make it work / use it have failed. Whenever I attempt to navigate to "Sources from Symbol Files" - I just get the message that the symbols are not available. Are the debug symbols for .NET 4 not released yet or are they placed somewhere else? It works fine and downloads the proper symbols for .NET 3.5 projects.

    Read the article

  • I want to style within JS

    - by 422
    Issue I have is I can use tags, but I would like to style particular words. Adding a class doesnt work, is it because I am within script dom ? Example: var config = [ { "name" : "tour_1", "bgcolor" : "black", "color" : "white", "position" : "BR", "text" : "Customize your user profile, it's easy. This is your shop window on <strong>here</strong> and <strong>there</strong>", "time" : 4000 } Instead of strong, I would like to apply class, like <p class="orange"> But it wont have it, any suggestions... please

    Read the article

  • JS regular expression to find a substring surrounded by double quotes

    - by 2619
    I need to find a substring surrounded by double quotes, for example, like "test", "te\"st" or "", but not """ neither "\". To achieve this, which is the best way to go for it in the following 1) /".*"/g 2) /"[^"\\]*(?:\\[\S\s][^"\\]*)*"/g 3) /"(?:\\?[\S\s])*?"/g 4) /"([^"\\]*("|\\[\S\s]))+/g I was asked this question yesterday during an interview, and would like to know the answer for future reference.

    Read the article

  • MooTools is not a function js error

    - by Adriane
    hello whatever i append to $('click_filter1') it shows the error ... is not a function (for show(), hide(), toggle()) if i insert an alert, the alert gets executed, so the framework is init ok the element with the id exists for sure what can be the problem of this? why iam getting this error? $('click_filter1').addEvent('click', function() { $('click_filter1').show(); }.bind(this));

    Read the article

  • trying to understand some codes related to window.onload in js

    - by user2507818
    <body> <script language="javascript"> window.tdiff = []; fred = function(a,b){return a-b;}; window.onload = function(e){ console.log("window.onload", e, Date.now() ,window.tdiff, (window.tdiff[1] = Date.now()) && window.tdiff.reduce(fred) ); } </script> </body> Above code is taken from a site. In firefox-console, it shows: window.onload load 1372646227664 [undefined, 1372646227664] 1372646227664 Question: For window.tdiff->[undefined, 1372646227664], why not:[], because when runs to code:window.tdiff, it is still an empty array? For window.tdiff.reduce(fred)->1372646227664, window.tdiff = [undefined, 1372646227664], undefined - 1372646227664, should be NaN, why it shows 1372646227664?

    Read the article

  • Hide / show content via CSS:hover (or JS if need be)

    - by Chris
    I have the following html: <li> <span class="one">Stuff here</span> <span class="two">More stuff</span> </li> .one { display: block; } .two { display: none; } What is the easiest method, preferably CSS only, to hide one and show two when the mouse rolls over the <li> container. If this cannot be done via CSS and only Javascript, I would prefer jQuery via something like live() as the content is updated live and do not wish to constantly rebind manually. EDIT: I forgot to mention that this has to work in IE6 :/

    Read the article

  • Is it easy to develop a simple Firefox plugin (JS injection)

    - by Moons
    Hello everyone! So I was just wondering if it was easy to develop a very simple Firefox plugin where you could click a button, and it would execute some Javascript code! Please note that I have never developed any kind of plugin for firefox, I just want to know if that is an easy task to do (like less than an hour)

    Read the article

  • How can I get the Forever to write to a different log file every day?

    - by user1438940
    I have a cluster of production servers running a Node.JS app via Forever. As far as I can tell, my options for log files are as follows: Let Forever do it on its own, in which case it will log to ~/.forever/XXXX.log Specify one specific log file for the entire life of the process What I'd like to do, however, is have it log to a different file every day. eg. 20121027.log, 20121028.log, etc. Is this possible? If so, how can it be done?

    Read the article

  • Coding with laptop and external screen - neck, back, comfort ...

    - by Xorty
    Guess I'm not the only one here coding on laptop + external keyboard + external screen. I can't really decide. Figure 1: Putting screen directly in front of (upright) my eyes and move laptop to the side. That feels like more comfortable but I can't really see so good to 15" laptop which is now quite away. Feels unused. Figure 2: Putting laptop in front of me and move external monitor on side. Feels like more efficient space usage, but I am afraid that my neck/back might start hurting since I need to turn my head often. What do you prefer? Some good advice? Sacrificing health is definitely no option here so that's why I'm worried and asking this silly question. Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >