Daily Archives

Articles indexed Tuesday March 16 2010

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 114/130 | < Previous Page | 110 111 112 113 114 115 116 117 118 119 120 121  | Next Page >

  • Email This Plugin for Chrome

    - by AngryHacker
    Firefox has this massively useful plugin called EmailThis by LazyRussian. It allows you to right-click on a page and just kick off your webmail compose page and email it. But...Firefox has become a dog, so I now vastly prefer Chrome. Is there something similar to EmailThis for Chrome?

    Read the article

  • Automated incremental backups from Plesk on Centos to Amazon S3

    - by ChrisS
    Hi, I've done a far bit of research on this via Google and there seems to be quite a few ways of possibly doing this. I'm looking to incrementally backup new and updated files in two directories on my Plesk run Centos 5.2 server: /backups and /var/www/vhosts (preferable only httdocs within each vhost) Has anyone got some great feedback from using the various solutions - seems to be various Java, Perl and Ruby based solutions out there. Many thanks, Chris

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • NSPredicate problem with fetchedResultsController

    - by RyJ
    Please help! I've been trying to figure this out for way too long. I can't seem to use an NSPredicate in my fetchedResultsController method: - (NSFetchedResultsController *)fetchedResultsController { if (fetchedResultsController != nil) return fetchedResultsController; NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"Tweet" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; NSPredicate *predicate = [NSPredicate predicateWithFormat: @"column == 0"]; [fetchRequest setPredicate:predicate]; [fetchRequest setReturnsObjectsAsFaults:NO]; [fetchRequest setFetchBatchSize:20]; NSSortDescriptor *sortDescriptor = [[NSSortDescriptor alloc] initWithKey:@"created_at" ascending:NO]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortDescriptor, nil]; [fetchRequest setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:fetchRequest managedObjectContext:managedObjectContext sectionNameKeyPath:nil cacheName:@"Root"]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; [aFetchedResultsController release]; [fetchRequest release]; [sortDescriptor release]; [sortDescriptors release]; return fetchedResultsController; } Yet, in another method, where I simply check to see if an object exists, the predicate works like a charm: - (BOOL)findObjectWithKey:(NSString *)key andValue:(NSString *)value sortBy:(NSString *)sort { NSFetchRequest *request = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"Tweet" inManagedObjectContext:managedObjectContext]; [request setEntity:entity]; NSPredicate *predicate = [NSPredicate predicateWithFormat: @"%K == %@", key, value]; [request setPredicate:predicate]; [request setReturnsObjectsAsFaults:NO]; NSSortDescriptor *sortDescriptor = [[NSSortDescriptor alloc] initWithKey:sort ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortDescriptor, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:nil cacheName:@"Root"]; aFetchedResultsController.delegate = self; NSError *error = nil; NSArray *result = [managedObjectContext executeFetchRequest:request error:&error]; [aFetchedResultsController release]; [request release]; [sortDescriptor release]; [sortDescriptors release]; if ((result != nil) && ([result count]) && (error == nil)) { return TRUE; } else { return FALSE; }} What am I doing wrong? Thanks in advance!

    Read the article

  • How to implement service layer in Zend Framework?

    - by takeshin
    I'm looking for some good resources to learn how to implement internal service layer in Zend Framework. This is interesting post, but with no concrete code samples. Where to put service classes (/application/modules/modulename/services/?); How to autoload them (custom autoloader?) Most common services (user, authentication, cart, cache, feed?) Sample implementations (any github repos?) Good practices?

    Read the article

  • Changing colour of types for VB.net in VS

    - by vdh_ant
    I am currently working on a VB.NET project and the hardest thing that I am having trouble with is that everything is black and blue. Having worked a lot with C#, I really like the way that types are colored differently. I have tried going in and having a look at the "Tools > Options > Fonts and Colors" and the various "User Types" under "Display Items" is set to a different colour but its not reflecting that colour in the text editor. Any assistance would be appreciated.

    Read the article

  • How to rewrite Collection?

    - by latvian
    Hi, I would like to rewrite the collection that is returned by Mage::getResourceModel('sales/order_collection'); My goal is to rewrite this resource so that i can filter out the collection for particular Store. Any ideas on how to do it? I tried directly rewrite collection of the sales/order module but no success. I was able to rewrite sales/order itself but not the collection, because when i call getCollection() it returns "Fatal error: Call to undefined method Mage_Sales_Model_Mysql4_Order::getCollection() " Any idea will help. Thank you, Margots

    Read the article

  • PHP : If...Else...Query

    - by Rachel
    I am executing this statement under while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) Now what I want in else loop is to throw exception only for data value which did not satisfy the if condition. Right now am displaying the complete row as I am not sure how to throw exception only for data which does not satisfy the value. Code if ((strtotime($data[11]) &&strtotime($data[12])&&strtotime($data[16]))!==FALSE && ctype_digit($data[0]) && ctype_alnum($data[1]) && ctype_digit($data[2]) && ctype_alnum($data[3]) && ctype_alnum($data[4]) && ctype_alnum($data[5]) && ctype_alnum($data[6]) && ctype_alnum($data[7]) && ctype_alnum($data[8]) && $this->_is_valid($data[9]) && ctype_digit($data[10]) && ctype_digit($data[13]) && $this->_is_valid($data[14])) { //Some Logic } else { throw new Exception ("Data {$data[0], $data[1], $data[2], $data[3], $data[4], $data[5], $data[6], $data[7], $data[8], $data[9], $data[10], $data[11], $data[12], $data[13], $data[14], $data[16]} is not in valid format"); } Guidance would be highly appreciated as to how can I throw exception only for data which did not satisfy the if value.

    Read the article

  • Abstract base class puzzle

    - by 0x80
    In my class design I ran into the following problem: class MyData { int foo; }; class AbstraktA { public: virtual void A() = 0; }; class AbstraktB : public AbstraktA { public: virtual void B() = 0; }; template<class T> class ImplA : public AbstraktA { public: void A(){ cout << "ImplA A()"; } }; class ImplB : public ImplA<MyData>, public AbstraktB { public: void B(){ cout << "ImplB B()"; } }; void TestAbstrakt() { AbstraktB *b = (AbstraktB *) new ImplB; b->A(); b->B(); }; The problem with the code above is that the compiler will complain that AbstraktA::A() is not defined. Interface A is shared by multiple objects. But the implementation of A is dependent on the template argument. Interface B is the seen by the outside world, and needs to be abstrakt. The reason I would like this is that it would allow me to define object C like this: Define the interface C inheriting from abstrakt A. Define the implementation of C using a different datatype for template A. I hope I'm clear. Is there any way to do this, or do I need to rethink my design?

    Read the article

  • Adjust parameters of serial port reading

    - by clinisbut
    Hello. I'm facing a particular issue that regards serial communication under win32. I'm communicating with a device can only accept frames when it is not already communicating. So I must find a valid frame and then inmediatelly send my request. I developed a class named Serial that handles basic operations on serial port (open, close, read, write) and then a Thread calls inside a loop read and write functions. Thread loop //Device is an object of class Serial while( device->isOpen() && !terminate ) { unsigned int readed = 0; unsigned long error = ERROR_SUCCESS; unsigned char* data = device->read( &readed, &error ); if( error==ERROR_SUCCESS ) { //If data received, deliver to upper level if( readed>0 ) { QByteArray output( (const char*)data, (signed int)readed ); emit dataArrived( output, readed ); } } else { //unrelated stuff } //Here I manage the writting issue //Only when nothing is received, and Upper layer wants to send a frame //(Upper layer only will mark as something to send when it detects a valid frame) if( readed==0 ) { out_lock.lock(); //If something to send... if( something_to_send > 0 ) { if( device->write( output_buffer, output_size, &error ) ) { //things... } } } } The Thread basically keeps reading, and when nothing is received, sees if somebody has signaled to send a frame (this means that a valid frame is just received). When this happens, it writes the frame through serial port. Here comes my problem. Inside the Serial::read() function: I use the overlapped way of reading: ::ClearCommError( handle, &dwErrors, &stat); if( stat.cbInQue ) { //If there's something to read, read it, please note the bytes to read parameter, here 1. bool ok = ::ReadFile( handle, buffer_in, 1, &bytes_read, &ov_reader ); if( !ok ) { DWORD _error = ::GetLastError(); if( _error == ERROR_IO_PENDING ) { DWORD result = ::WaitForMultipleObjects( 2, waiters, FALSE,INFINITE ); switch( result ) { //Eventshutdown case WAIT_OBJECT_0: /*code omitted*/break; case WAIT_OBJECT_0+1: ok = ::GetOverlappedResult( handle, &ov_reader, &bytes_read, true ); //check ok value omitted break; } } } } if( bytes_read>0 ) { *size = bytes_read; } Here starts my problem. When device sends me small frames (around 30 bytes) everything works fine, but when larger frames are sent, the code is not able to find any free time between frames causing the thread to never be able send any frame because readed is never 0. If I increase the number of bytes to read inside the read() function, lose the ability to detect when the device "listens": bool ok = ::ReadFile(handle, buffer_in, 50, &bytes_read, &ov_reader ); This happens because my app can receive the end of a frame together with the start of the next one. This behaviour is very common. In the other hand, if I change the INFINITE argument by a valid timeout in the WaitForMultipleObjects function, I lose data. So my question basically is... what I'm doing wrong? Why when reading 1 byte each time I don't find any free time to send my own frames? Thank you

    Read the article

  • qmake and multiple MSVS versions

    - by goodrone
    From Visual Studio 2008 Command Prompt I run this command to generate .vcproj file: >qmake -spec win32-msvc2008 And get a warning message: WARNING: Generator: MSVC.NET: Found more than one version of Visual Studio in your path! Fallback to lowest version (MSVC.NET 2008 (9.0), MSVC.NET 2008 Express Edition (9.0), MSVC.NET 2005 (8.0), MSVC.NET 2008 (9.0) in path, MSVC.NET 2008 Express Edition (9.0) in path) For this project I use MSVS 2008 Professional. Actually the generated .vcproj file works well, but what is the warning message about?

    Read the article

  • java hashmap flaws ?

    - by Tiberiu Hajas
    hi there, if (agents != null) for (Iterator iter = agents.keySet().iterator(); iter .hasNext();) { // some stuffs here } I have the following piece of java code, the agents is a hashmap, wondering if anyone can figure it out why on the line with "for" statement sometimes I got NPE ? is there any flaw with hashmaps ? thanks

    Read the article

  • reCAPTCHA Ajax API + custom theme not working

    - by Felix
    I can't see where I'm going wrong. I've tried everything I could think of, reCAPTCHA is just not working with the Ajax API. Here's what my code looks like: <!-- this is in <head> --> <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="http://api.recaptcha.net/js/recaptcha_ajax.js"></script> <script type="text/javascript"> $(document).ready(function() { Recaptcha.create("my key here", "recaptcha_widget", { "theme": "custom", "lang": "en", "callback": function() { console.log("callback"); } // this doesn't get called }); }); </script> <!-- ... this is in <body> --> <div id="recaptcha_widget" style="display: none"> <div id="recaptcha_image"></div> <div id="recaptcha_links"> <a href="javascript:Recaptcha.reload()">get another</a> &bull; <a class="recaptcha_only_if_image" href="javascript:Recaptcha.switch_type('audio')">switch to audio</a> <a class="recaptcha_only_if_audio" href="javascript:Recaptcha.switch_type('image')">switch to image</a> &bull; <a href="javascript:Recaptcha.showhelp()">help</a> </div> <dt>Type the words</dt> <dd><input type="text" id="recaptcha_response_field" name="recaptcha_response_field"></dd> </div>

    Read the article

  • Why isn't my log4net appender buffering?

    - by Eric
    I've created a custom log4net appender. It descends from log4net.Appender.SmtpAppender which descends from log4net.Appender.BufferingAppenderSkeleton. I programatically setup the following parameters in its constructor: this.Lossy = false; //don't drop any messages this.BufferSize = 3; //buffer up to 3 messages this.Threshold = log4net.Core.Level.Error; //append messages of Error or higher this.Evaluator = new log4net.Core.LevelEvaluator(Level.Off); //don't flush the buffer for any message, regardless of level I expect this would buffer 3 events of level Error or higher and deliver those events when the buffer is filled. However, I'm finding that the events are not buffered at all; instead, SendBuffer() is called immediately every time an error is logged. Is there a mistake in my configuration? Thanks

    Read the article

  • Why does my Perl CGI program fail with "Software error: ..."?

    - by kiran
    When I try to run my Perl CGI program, the returned web page tells me: Software error: For help, please send mail to the webmaster (root@localhost), giving this error message and the time and date of the error. Here is my code in one of the file: #!/usr/bin/perl use lib "/home/ecoopr/ecoopr.com/CPAN"; use CGI; use CGI::FormBuilder; use CGI::Session; use CGI::Carp (fatalsToBrowser); use CGI::Session; use HTML::Template; use MIME::Base64 (); use strict; require "./db_lib.pl"; require "./config.pl"; my $query = CGI-new; my $url = $query-url(); my $hostname = $query-url(-base = 1); my $login_url = $hostname . '/login.pl'; my $redir_url = $login_url . '?d=' . $url; my $domain_name = get_domain_name(); my $helpful_msg = $query-param('m'); my $new_trusted_user_fname = $query-param('u'); my $action = $query-param('a'); $new_trusted_user_fname = MIME::Base64::decode($new_trusted_user_fname); ####### Colin: Added July 12, 2009 ####### my $view = $query-param('view'); my $offset = $query-param('offset'); ####### Colin: Added July , 2009 ####### #print $session-header; #print $new_trusted_user; my $helpful_msg_txt = qq[]; my $helpful_msg_div = qq[]; if ($helpful_msg)

    Read the article

  • Hibernate - on the stack or on the heap?

    - by Stephano
    As a Java programmer, you usually keep two truths in your pocket: Instance variables and Objects lie on Heap. Local variables and methods lie on the Stack. Now that I use Hibernate in just about everything, I realize I'm not as sure of myself. Are there some good rules of thumb for using hibernate and knowing where your memory lives?

    Read the article

  • Client-side templating frameworks to streamline using jQuery with REST/JSON

    - by Tauren
    I'm starting to migrate some html generation tasks from a server-side framework to the client. I'm using jQuery on the client. My goal is to get JSON data via a REST api and use this data to populate HTML into the page. Right now, when a user on my site clicks a link to My Projects, the server generates HTML like this: <dl> <dt>Clean Toilet</dt> <dd>Get off your butt and clean this filth!</dd> <dt>Clean Car</dt> <dd>I think there's something growing in there...</dd> <dt>Replace Puked on Baby Sheets</dt> </dl> I'm changing this so that clicking My Projects will now do a GET request that returns something like this: [ { "name":"Clean Car", "description":"I think there's something growing in there..." }, { "name":"Clean Toilets", "description":"Get off your butt and clean this filth!" }, { "name":"Replace Puked on Baby Sheets" } ] I can certainly write custom jQuery code to take that JSON and generate the HTML from it. This is not my question, and I don't need advice on how to do that. What I'd like to do is completely separate the presentation and layout from the logic (jquery code). I don't want to be creating DL, DT, and DD elements via jQuery code. I'd rather use some sort of HTML templates that I can fill the data in to. These templates could simply be HTML snippets that are hidden in the page that the application was loaded from. Or they could be dynamically loaded from the server (to support user specific layouts, i18n, etc.). They could be displayed a single time, as well as allow looping and repeating. Perhaps it should support sub-templates, if/then/else, and so forth. I have LOTS of lists and content on my site that are presented in many different ways. I'm looking to create a simple and consistent way to generate and display content without creating custom jQuery code for every different feature on my site. To me, this means I need to find or build a small framework on top of jQuery (probably as a plugin) that meets these requirements. The only sort of framework that I've found that is anything like this is jTemplates. I don't know how good it is, as I haven't used it yet. At first glance, I'm not thrilled by it's template syntax. Anyone know of other frameworks or plugins that I should look into? Any blog posts or other resources out there that discuss doing this sort of thing? I just want to make sure that I've surveyed everything out there before building it myself. Thanks!

    Read the article

  • Reading binary data from serial port using Dejan TComport Delphi component

    - by johnma
    Apologies for this question but I am a bit of a noob with Delphi. I am using Dejan TComport component to get data from a serial port. A box of equipment connected to the port sends about 100 bytes of binary data to the serial port. What I want to do is extract the bytes as numerical values into an array so that I can perform calculations on them. TComport has a method Read(buffer,Count) which reads DATA from input buffer. function Read(var Buffer; Count: Integer): Integer; The help says the Buffer variable must be large enough to hold Count bytes but does not provide any example of how to use this function. I can see that the Count variable holds the number of bytes received but I can't find a way to access the bytes in Buffer. TComport also has a methord Readstr which reads data from input buffer into a STRING variable. function ReadStr(var Str: String; Count: Integer): Integer; Again the Count variable shows the number of bytes received and I can use Memo1.Text:=str to display some information but obviously Memo1 has problems displaying the control characters. I have tried various ways to try and extract the byte data from Str but so far without success. I am sure it must be easy. Here's hoping.

    Read the article

  • Changing Platform

    - by Liam McLennan
    From time to time a developer makes a break from their platform of choice (.NET, Java, VB, Access, COBOL) and moves to perceived greener pastures. Zed Shaw did it, jumping from Ruby to Python, and Mike Gunderloy went from .NET to Rails. But it can be difficult to change platform. My clients don’t come to me looking for  a software developer, they come looking for a .NET developer. This is a tragic side effect of big software companies marketing. If your village is under attack by bandits, would you turn away the first seven samurai who offered to help because you didn’t like their swords? What matters is how effectively they can defend your village. You should not tell your carpenter what sort of hammer to use and you should not tell your software developer what platform to use.

    Read the article

  • Requiring SSH-key Login Via PAM From Specific IP Ranges

    - by Sean M
    I need to be able to access my server (Ubuntu 8.04 LTS) from remote sites, but I'd like to worry a bit less about password complexity. Thus, I'd like to require that SSH keys be used for login instead of name/password. However, I still have a lot to learn about security, and having already badly broken a test box when I was trying to set this up, I'm acutely aware of the chance of screwing myself while trying to accomplish this. So I have a second goal: I'd like to require that certain IP ranges (e.g. 10.0.0.0/8) may log in with name/password, but everyone else must use an SSH key to log in. How can I satisfy both of these goals? There already exists a very similar question here, but I can't quite figure out how to get to what I want from that information. Current tactic: reading through the PAM documentation (pam_access looks promising) and looking at /etc/ssh/sshd_config.

    Read the article

  • Scheduled tasks fail to start unless I'm logged in to the server

    - by Chuck
    Tasks need to open a CMD window and pass net use commands, then do a DIR command, pipping the output to a file on the server. Log in as either me (Sysadmin) or with one of the system accounts and task will only run if I'm physically logged into the server. Run as batch file is set in security properties for both users (me and service account), security is granted to all directories, etc. It almost acts like a scheduled task, since it is not physically connected to a display can't create a CMD window and pass the WinID so the command can be sent. I'm guessing. Anyone know of a document that explains how the server handles initiation of a window if done via scheduled task and no attached user is associated with the task? If I log onto the box and run the scheduled tasks they run fine, but produce no errors or event log entries and then just show that it ran successfully and sets the next run time. Have tried both with the run if logged in checkbox on and off and makes no difference. Other tasks work fine, except that they are acting on local drives with no display writing or updating taking place, so I'm guessing the system either can't instantiate a window if no display is connected to a logged on user, or it can't establish a point if it is trying to create a virtual screen. You'd think it is just creating a memory map and then mapping it to a device to display, but that doesn't seem to be the case, but I can find no documentation on how the system handles a scheduled task and how to invoke a fake or virtual screen that it could write to so it appears that a user was connected. Thanks This is driving me nuts and I've tried everything I can think of as well as our network boys ideas and nothing seems to work.

    Read the article

  • Inexpensive (used) hardware for Xen virtualization test?

    - by Jason Antman
    Virtualization is one of the areas where I could really use some experience. I also run quite a few services (web, mail, dns, etc.) out of my home. Since most of my hardware is getting a bit old (I'm running on stuff that was surplused years ago...) I decided that it's about time I start renewing some things, and also play around with virtualization a bit more. My plan is to setup a SAN box (simple iSCSI target, relatively inexpensive gigE switch), get a pair (for starters) of new servers, and start building some new stuff with Xen, specifically planning on playing with live migration and full virtualization. Does anyone have recommendations for used, older "servers" (really anything in a rack-mount form factor, I'm not too worried about things like iLO/iLOM for the test nodes) that support VT-x/AMD-V? I'm biased to HP, but it looks like they didn't make Proliants with VT-x/Vanderpool processors until G6 (for the DL360) or so, which is way out of my price range. I'm looking in the sub-$300 range (or less, if possible), used, probably Ebay. Any recommendations are greatly appreciated. Edit:And, to catch this before the comments start coming - these are personal systems. I have first-generation Proliants still in use (I got them as corporate surplus in 05, they've been running since then, and probably were running since 01 or 02 prior to being sold). I don't need anything shiny and new - I've got a bunch of old boxes, at least one complete replacement for every model in use, and that's fine for me (and easy on the wallet).

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 110 111 112 113 114 115 116 117 118 119 120 121  | Next Page >